(Circulation. 1999;99:3125-3131.)
© 1999 American Heart Association, Inc.
Clinical Investigation and Reports |
PPAR
Activators Inhibit Cytokine-Induced Vascular Cell Adhesion Molecule-1 Expression in Human Endothelial Cells
From the Vascular Medicine and Atherosclerosis Unit, Cardiovascular Division (N.M., G.K.S., P.L., J.P.) and the Vascular Research Division, Department of Pathology (T.C.), Brigham and Women's Hospital, Harvard Medical School, Boston, Mass.
Correspondence to Jorge Plutzky, MD, Vascular Medicine and Atherosclerosis Unit, Cardiovascular Division, Brigham and Women's Hospital, Harvard Medical School, 221 Longwood Ave, Boston, MA 02115. E-mail jplutzky{at}rics.bwh.harvard.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Background—Adhesion molecule expression on the endothelial cell (EC) surface is critical for leukocyte recruitment to atherosclerotic lesions. Better understanding of transcriptional regulation of adhesion molecules in ECs may provide important insight into plaque formation. Peroxisome proliferator–activated receptor-
(PPAR), a member of the
nuclear receptor family, regulates gene expression in response to
certain fatty acids and fibric acid derivatives. The present study
investigated PPAR expression in human ECs and their regulation of
vascular cell adhesion molecule-1 (VCAM-1).
Methods and Results—Immunohistochemistry revealed that human
carotid artery ECs express PPAR. Pretreatment of cultured human ECs
with the PPAR activators fenofibrate or WY14643
inhibited TNF-–induced VCAM-1 in a time- and
concentration-dependent manner, an effect not seen with PPAR
activators. Both PPAR activators decreased
cytokine-induced VCAM-1 mRNA expression without altering
its mRNA half-life. Transient transfection of deletional VCAM-1
promoter constructs and electrophoretic mobility shift assays suggest
that fenofibrate inhibits VCAM-1 transcription in part by inhibiting
NF-
B. Finally, PPAR activators significantly reduced
adhesion of U937 cells to cultured human ECs.
Conclusions—Human ECs express PPAR, a potentially important
regulator of atherogenesis through its transcriptional control of
VCAM-1 gene expression. Such findings also have implications regarding
the clinical use of lipid-lowering agents, like fibric acids, which can
activate PPAR.
Key Words: atherosclerosis • endothelium • leukocytes
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Adhesion of circulating leukocytes to the endothelium is a critical early step in atherogenesis.1 2 3 4 5 This process depends on the interaction between adhesion molecules on the endothelial cell (EC) surface and their cognate ligands on leukocytes. These EC adhesion molecules include vascular cell adhesion molecule-1 (VCAM-1), intercellular adhesion molecule 1 (ICAM-1), E-selectin, and P-selectin.6 7 Increased adhesion molecule expression by ECs in human atherosclerotic lesions may contribute to further leukocyte recruitment to sites of atherosclerosis.6 8 9 Although inducers of EC adhesion molecule expression, such as the inflammatory mediators tumor necrosis factor (TNF)-
and interleukin (IL)-1,10
have received much attention, less is known about the negative
regulation of adhesion molecule transcription. Such understanding may
provide important insight into plaque formation.
Certain polyunsaturated fatty acids, for example, docosahexaenoic
acid (DHA), can inhibit cytokine-induced VCAM-1 expression
in ECs, although the underlying mechanism remains
unclear.11 Interestingly, some polyunsaturated fatty acids
can activate the peroxisome proliferator–activated
receptor- (PPAR), a nuclear receptor involved with
transcriptional responses to fatty acids. Fibric acid derivatives, such
as fenofibrate, are also thought to act as specific
activators for PPAR.12 13 14 In addition to
PPAR, the PPAR family also includes PPAR and PPAR
. PPARs,
activated by binding of specific agonists, form heterodimers
with the retinoid X receptor and associate with PPAR response elements
in the promoter region of target genes whose expression they
regulate.15 We have demonstrated expression of PPAR in
human ECs and identified plasminogen activator
inhibitor-1 as a potential PPAR target gene in these
cells.16 Although PPAR mRNA expression in human ECs has
been reported,17 its role in EC biology, including
candidate target genes, remains essentially unexplored.
We hypothesized that PPAR might regulate VCAM-1 expression in human
ECs, thus potentially modulating leukocyte adhesion. To this end, we
investigated the presence of PPAR in human ECs, studying the effect
of well-established PPAR and PPAR activators on
adhesion molecule expression in these cells.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Immunohistochemistry of Human Carotid Artery Specimens
Staining for PPAR
was performed on acetone-fixed serial
cryostat sections of human carotid arteries (protocols approved by
Brigham and Women's Institutional Review Board) with a
polyclonal goat anti-human PPAR antibody (Santa Cruz). ECs were
identified by staining with anti-CD31 antibodies (Dako). Sections were
blocked with PBS/5% serum, and incubated with appropriate biotinylated
secondary antibody (Vector Laboratories), then avidin-biotin-peroxidase
complex (Vectastain ABC kit). Antibody binding was visualized with True
Blue peroxidase substrate (Kirkegaard & Perry Laboratories) and
counterstained with Gill's hematoxylin or contrast red (Kirkegaard &
Perry Laboratories).
Cell Culture
Human saphenous vein ECs were isolated from explants from unused
portions of saphenous veins harvested at coronary artery bypass
surgery. Cells, cultured as described before,11 were
>99% von Willebrand factor–positive by flow cytometry,
exhibited typical EC cobblestone growth pattern, and were of low
passage number (p2–5). Bovine aortic ECs (BAECs) and human fibroblasts
were cultured in DMEM (Biowhittaker) containing 1% glutamine, 1%
penicillin-streptomycin, and 10% FCS. The hematopoietic cell line U937
was cultured in RPMI medium (Biowhittaker) containing 1% glutamine,
1% penicillin-streptomycin, and 10% FCS.
Preparation of Nuclear and Cytosolic Extracts and Western Blot
Analysis
For Western blotting, nuclear and cytosolic extracts of
107 cells were prepared as previously
described.18 Processed samples were applied to 10%
SDS-PAGE and transferred to nitrocellulose membranes (Millipore) by use
of semidry blotting.18 Membranes were treated overnight
with TBS-Tween/5% dry milk and incubated with goat anti-human PPAR
antibodies (Santa Cruz) for 1 hour. After washing, membranes were
incubated with horseradish peroxidase–conjugated rabbit anti-goat
monoclonal antibodies. Antigen detection was performed via
chemiluminescence (NEN); Nuclear extracts from human fibroblasts
transfected with a PPAR expression construct (provided by Dr Bruce
Spiegelman, Dana Farber Cancer Institute, Boston, Mass) served as a
positive control.
Cell-Surface Enzyme Immunoassays
For determination of cell-surface expression of adhesion
molecules, ECs were pretreated with PPAR activators
[PPAR activators: fenofibrate (Sigma) and WY14643
(Biomol); PPAR activators:
15-deoxy-
12,14-prostaglandin
J2 (15d-PGJ2) (Calbiochem),
troglitazone (Parke-Davis), and BRL 49653 (SmithKline Beecham)] at the
times and concentrations indicated and then stimulated with the
specified cytokines (8 hours). Enzyme immunoassay (EIA) was
performed by incubating EC monolayers first with specific monoclonal
antibodies against VCAM-1 (E1/6), ICAM-1 (HU5/3), or E-selectin
(H18/7), then with biotinylated goat anti-mouse IgG (Vector
Laboratories), and finally with streptavidin–alkaline phosphatase
(Zymed Laboratories). (All monoclonal antibodies were a generous gift
from Dr Michael Gimbrone, Brigham and Women's Hospital, Boston, Mass).
Cells were washed in PBS/1% BSA after each incubation step, and the
integrity of the cellular monolayer was ensured by phase-contrast
microscopy. Surface expression of each adhesion molecule was measured
spectrophotometrically at 410 nm 15 to 30 minutes after addition of the
chromogenic substrate (para-nitrophenylphosphate, Sigma).
Experiments were performed in triplicate for each condition.
Adhesion Assay
ECs were grown to confluence in 96-well plates, pretreated with
PPAR activators for 24 hours, and stimulated with
TNF- for 8 hours, then adhesion assays were
performed.19 Briefly, U937 cells were labeled with
2',7'-bis(2-carboxy)-fluorescein acetoxymethyl ester
(Molecular Probes) and then added, under rolling conditions (63 rpm,
23°C, 15 minutes), to a rinsed EC monolayer
(2x106 cells/mL) in RPMI medium/10% FCS/1
mmol/L CaCl2. Nonadherent cells were removed by
inverting the plate under rotation (20 minutes). After solubilization
of well contents, fluorescence intensity was measured in a
microtiter plate fluorimeter (Pandex, FCA). A standard curve using
dilutions of labeled U937 cells was determined, and results were
expressed as cells/cm2.
RNA Extraction and Northern Blot Analysis
For Northern blot experiments, human ECs were pretreated with
PPAR activators for 24 hours and then stimulated with
the specified cytokines for 3 hours. Total RNA
(107 cells) was isolated by the guanidinium
thiocyanate–phenol-chloroform method (RNAzol, Tel-Test) and 5 µg of
RNA used in standard Northern blot analysis with a VCAM-1
probe.
VCAM-1 mRNA half-life was determined by stimulating ECs with TNF-
for 3 hours before blocking transcription by treatment with actinomycin
D 5 µg/L. Cells then received fenofibrate for the times indicated;
mRNA levels were compared with those of untreated cells.
Transient Transfections
To investigate the effect of PPAR activators on
VCAM-1 promoter activity, we transiently transfected BAECs with a
series of deletional VCAM-1 promoter constructs, all containing the
chloramphenicol acetyltransferase (CAT) reporter.20
[-755]F0.CAT is the putative full-length human VCAM-1 promoter
containing AP-1, GATA, and NF-B binding sites. [-98]F3.CAT lacks
the AP-1 and GATA sites but retains NF-B binding sites.
[-44]F4.CAT lacks NF-B binding sites (Figure 5A
). BAECs,
which are more easily transfectable than human ECs, were cotransfected
via calcium phosphate precipitation21 with each reporter
construct (5 µg) and a pCMV.ß-GAL (4 µg) as an internal control.
Cells were stimulated (48 hours after transfection) with TNF- 10
µg/L with or without fenofibrate 100 µmol/L. BAECs were then
harvested after 36 hours, and lysates were subjected to CAT and
ß-galactosidase assay (Tropix) as described.22
Normalized CAT activity was calculated as the ratio of CAT activity to
ß-galactosidase activity. Results for each reporter construct were
expressed as multiples of induction compared with transfected,
unstimulated cells.
|
Electrophoretic Mobility Shift Assay
For electrophoretic mobility shift assays (EMSAs), human ECs
were preincubated for 24 hours with fenofibrate 100 µmol/L and
then stimulated for 2 hours with TNF- 10 µg/L before nuclear
extracts were prepared. The NF-B oligonucleotide
(CCTGGGTTTCCCCTTGAAGGGATTTCCCTCC)
(Genosys Biotechnologies) spanning the 2 tandem NF-B sites
(as underlined above) in the human VCAM-1 promoter was end-labeled with
[-32P]ATP (3000 Ci/mmol) by T4
polynucleotide kinase (New England Biolabs) and purified
(Sephadex G-25 columns, Pharmacia LKB Biotechnology). Nuclear
extracts (5 µg) were incubated with the labeled NF-B
oligonucleotide under standard
conditions.11 In the indicated experiments, nuclear
extracts were incubated with anti-p50 [polyclonal rabbit anti-p50
(NLS)X, Santa Cruz] or anti-p65 (polyclonal rabbit anti-p65 AX, Santa
Cruz) or nonspecific IgG before the addition of radiolabeled NF-B
probes. DNA-protein complexes were electrophoretically separated (5%
nondenaturing polyacrylamide gel). Specificity was determined
by addition of an excess of unlabeled (cold) NF-B
oligonucleotide to the nuclear extracts before
formation of DNA-protein complexes.
Assessment of Total Protein Synthesis
Total protein synthesis was assessed as
35S-methionine incorporation as described
previously.11
Statistical Analysis
Results of the experimental studies are reported as mean±SEM.
Differences were analyzed by 1-way ANOVA followed by Fisher's
protected least significant difference test. A value of
P<0.05 was regarded as significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Human ECs Express PPAR
In Vivo and In VitroImmunohistochemistry of human carotid artery specimens (n=6) revealed PPAR
staining in the EC nuclei (Figure 1A; blue staining, arrowheads). Parallel
sections stained with goat IgG showed no immunostaining
(Figure 1B). ECs were identified by immunoreactive CD31
(platelet and endothelial cell adhesion molecule-1)
in parallel sections (Figure 1C; red staining).
|
To demonstrate PPAR expression in vitro in a homogeneous
population of human ECs, Western blot analysis of cultured
human saphenous vein ECs was performed. Consistent with the in
situ findings, PPAR protein was detected in nuclear but not
cytosolic fractions. The identity of the detected band was confirmed by
comigration with a band from fibroblasts transfected with a PPAR
expression construct (Figure 1D
); untransfected fibroblasts
reveal no such band (data not shown).
PPAR but Not PPAR Activators Reduce EC Surface
Expression of VCAM-1
As expected, cell surface EIAs of human ECs revealed a marked
increase of VCAM-1 expression in response to stimulation with TNF-
10 µg/L. Pretreatment of ECs with the PPAR activator
fenofibrate 100 µmol/L or WY14643 250 µmol/L reduced
VCAM-1 expression levels significantly, to 33±9% (P<0.01)
or 52±2% (P<0.01) of TNF-–stimulated cells,
respectively (Figure 2A). Similar results
were obtained by flow cytometry (data not shown). None of 3 different
PPAR activators (troglitazone, 10 µmol/L;
15d-PGJ2, 10 µmol/L; or BRL49653, 10 µmol/L);
significantly affected TNF-–induced VCAM-1 expression (Figure 2A).
Treatment of unstimulated human ECs with PPAR or PPAR
activators did not alter VCAM-1 expression (data not
shown). Fenofibrate did not affect EC viability (>95% excluded trypan
blue) or total protein synthesis (263±5x103
cpm/cm2 well in TNF-–treated cells versus
283±22x103 cpm/cm2 well
in TNF-– and fenofibrate-treated cells; P=NS).
|
Neither PPAR nor PPAR activators significantly
reduced the TNF-–induced cell surface expression of ICAM-1 (Figure 2B, solid bars) or E-selectin (Figure 2B, open bars) in
ECs.
Fenofibrate Reduces Cytokine-Induced VCAM-1 Expression in a
Time- and Concentration-Dependent Manner
To investigate the time- and concentration-dependence of PPAR
activator treatment on VCAM-1 expression, human ECs were
pretreated with fenofibrate for different times or concentrations
before stimulation with TNF- and subsequent EIA determination of
VCAM-1 expression. Inhibition of TNF-–induced VCAM-1 expression
depended on the time of fenofibrate exposure, with a maximal reduction
after 24 hours of fenofibrate pretreatment (Figure 2C). In
addition, fenofibrate inhibited VCAM-1 expression in human ECs induced
by TNF- (Figure 2D, solid bars) or IL-1 (Figure 2D, open bars) in a concentration-dependent manner with a maximal reduction
at 100 µmol/L fenofibrate.
PPAR Activators Inhibit the Adhesion of
Monocyte-Like Cells on Human ECs
To investigate the potential functional relevance of PPAR
activator–reduced VCAM-1 expression in human ECs, we
performed an in vitro adhesion assay using fluorescently labeled U937
cells and monolayers of human ECs. Stimulation of the EC monolayer with
TNF- increased the number of adherent cells from
9.1±1.5x103 cells/cm2 to
73.2±2.4x103 cells/cm2
(P<0.01) (Figure 3B).
Pretreatment of ECs with fenofibrate or WY14643 before TNF-
stimulation reduced U937 cell adhesion significantly, to
36.7±2.2x103 cells/cm2
(P<0.01) or 37.3±4.3x103
cells/cm2 (P<0.01), respectively
(Figure 3A and 3B). Preincubation of TNF-–stimulated ECs
with blocking anti-VCAM monoclonal antibody inhibited U937 cell
adhesion almost completely (data not shown).
|
PPAR Activators Reduce Cytokine-Induced
VCAM-1 mRNA Levels in Human ECs
Northern blot analysis revealed increased VCAM-1
mRNA levels after 3 hours of stimulation of human ECs with TNF- 10
µg/L, which could be inhibited in a concentration-dependent manner by
pretreatment with the PPAR activators fenofibrate or
WY14643 (Figure 4A). Similar results were
seen when ECs were stimulated with IL-1 instead of TNF- (data not
shown). In the presence of actinomycin D, fenofibrate did not
significantly reduce VCAM-1 mRNA half-life compared with control cells
(6.4±0.6 hours in control cells versus 6.4±1.1 hours in
fenofibrate-stimulated cells, P=NS), indicating that the
inhibitory effect of PPAR activators on
VCAM-1 does not result from altered mRNA stability (Figure 4B).
|
Fenofibrate Inhibits TNF-–Induced VCAM-1 Promoter
Activity
To determine potential sites of interaction of PPAR
activators with the VCAM-1 promoter, we performed transient
transfections of various deletional VCAM-1 promoter reporter CAT
constructs in bovine ECs (Figure 5A).
After stimulation for 36 hours, CAT activity, as well as the activity
of a cotransfected ß-galactosidase construct, was measured (Figure 5B).
TNF- stimulation of cells transfected with the
full-length promoter construct (F0) led to a 5.9±1.6-fold increase in
normalized promoter activity (CAT/ß-galactosidase activity).
Treatment with fenofibrate significantly reduced this response to
2.4±0.4-fold (P<0.05 compared with TNF-–stimulated
cells). Transfection studies with a VCAM-1 promoter deletion construct
(F3) containing the 2 tandem NF-B sites, but lacking the AP-1 and
GATA sites, revealed similar PPAR agonist responsiveness.
Stimulation of transfected cells with TNF- enhanced relative CAT
activity 3.4±0.6-fold; treatment with fenofibrate significantly
inhibited this increase to 1.4±0.2 (P<0.05 compared with
TNF-–stimulated cells). Transfection studies with the VCAM-1
deletion construct (F4), lacking the 2 NF-B sites, revealed no
change in relative CAT activity after treatment with TNF- or
fenofibrate. In the case of all constructs, treatment with fenofibrate
alone had no effect on relative CAT activity compared with control,
consistent with the absence of consensus PPAR response elements
in the VCAM promoter.
Fenofibrate Inhibits TNF-–Induced NF-B Activation
EMSAs that used radiolabeled oligonucleotides
corresponding to the 2 tandem NF-B sites in the VCAM-1 promoter were
performed to investigate whether PPAR activators inhibit
NF-B activation. Fenofibrate decreased the amount of shifted
complexes induced by TNF-, which suggests that PPAR
activators directly inhibit NF-B activation (Figure 5C).
To further investigate these findings, supershift analysis was
performed to define fenofibrate effects on the NF-B transcriptional
complex (Figure 5C). As described by others, TNF-–induced
NF-B activation involves the p50 and p65 subunits. Fenofibrate
treatment of similarly stimulated ECs resulted in a parallel decrease
in the amount of supershifted p50 and p65 complexes.
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The present study reports expression of PPAR
in ECs of
human arteries and reduction of cytokine-induced VCAM-1
expression by PPAR agonists through inhibition of NF-B. This
inhibition of VCAM-1 expression by PPAR activators
decreased adhesion of monocyte-like cells to stimulated ECs. PPAR
activators exhibited no such effects.
Initially, PPAR was thought to be limited to tissues such as liver
and fat, in which it participates in the regulation of lipid, and in
particular fatty acid, metabolism.23 24 A
recent study demonstrated PPAR expression in human vascular
smooth muscle cells with inhibition of IL-6,
cyclooxygenase-2, and prostaglandin
gene expression by the same PPAR activators used here
(WY14643, fenofibrate).25 Human ECs, like vascular smooth
muscle cells, express both PPAR and PPAR,16 with
each PPAR probably having unique effects relevant to vascular biology
in these cellular settings. We have previously shown PPAR expression
in ECs and suggested a role of PPAR in the regulation of
plasminogen activator inhibitor-1
gene expression.16 We report here that PPAR activation
does not appear to be involved in the regulation of adhesion molecule
expression (Figure 2).
In contrast, 2 different established PPAR activators,
fenofibrate and WY14643, inhibit cytokine-induced VCAM-1
expression in ECs. These agents probably act in ECs by activating
PPAR. Both of these agonists have high binding affinities to PPAR
while selectively interacting with PPAR, with little to no activity
on other PPAR isoforms.12 26 The fibrates used here
produced inhibitory effects at concentrations similar to
those that induced established PPAR response genes, eg,
apolipoprotein A-II.27 In contrast, various PPAR
activators, among them the highly specific PPAR agonist
BRL49653,12 26 added either before or after (data not
shown) cytokine treatment, had no effect on VCAM-1 levels.
Therefore, PPAR activation by PPAR agonists seems an unlikely
explanation for our results.
The reduction of VCAM-1 expression by PPAR activators
appears at a transcriptional level because fenofibrate did not alter
VCAM-1 mRNA half-life but did inhibit TNF-–induced VCAM-1 promoter
activity. This effect appears to stem from inhibition of NF-B
activation, as suggested by the reduction of CAT activity of the
promoter construct lacking NF-B binding sites ([-44]F4) and gel
shift assays. The inhibition of NF-B activation by PPAR could
result from direct interference with NF-B binding to the VCAM-1
promoter, as postulated for the interaction of NF-B with the
estrogen receptor.28 Alternatively, the
inhibitory effects might occur through competitive binding
of transcriptional coactivators by PPAR or by
PPAR-induced transcription factors. Such "negative crosstalk"
has been suggested between other nuclear receptors and the
transcription factor AP-1.29 In fact, one such
coactivator, p300, involved in VCAM-1
expression30 reportedly interacts with
PPAR.31 Our data also do not exclude a PPAR effect
on IB or an effect on the transcription of NF-B subunits p50 and
p65.
The genes encoding ICAM-1 and E-selectin have NF-B sites in
their promoter; nonetheless, PPAR activators did not
alter ICAM-1 or E-selectin expression. This result may be explained in
several ways. It could derive from the distinct nature of the VCAM-1
promoter, either its NF-B sites or another undefined VCAM-1
transcriptional element,32 ie, the interferon regulatory
factor-1 site. We saw no effect of fenofibrate on the known TNF-
induction of interferon regulatory factor-1 expression in ECs (data not
shown).22 Other mechanisms might include competition for
transcriptional coactivators as described above.
Interestingly, retinoic acid, acting through the retinoic acid
receptor, another nuclear receptor family member, also appears to
inhibit activation of the NF-B site of the VCAM-1 promoter, but not
NF-B activation of either the ICAM-1 or E-selectin
promoters.33
Inhibition of VCAM-1 expression in human ECs by PPAR
activators, with a consequent decrease in monocyte
adherence to ECs, has important implications regarding atherogenic
mechanisms as well as the treatment of atherosclerosis,
especially given the similarity of fenofibrate concentrations used here
and those achieved in patients.34 Human angiographic
studies have reported that fenofibrate treatment reduces
coronary artery stenoses.35
Epidemiological36 as well as experimental
work37 38 suggests that the intake of polyunsaturated
fatty acids, some of them also known PPAR agonists,12
reduces the incidence of cardiovascular events. Given
the likely involvement of VCAM-1 in monocyte recruitment to early
atherosclerotic lesions,6 our findings suggest PPAR as
a potential mediator of critical inflammatory processes in the vessel
wall.
|
Acknowledgments |
|---|
This work was supported by grants from the Deutsche Forschungsgemeinschaft to Dr Marx (MA 2047/1-1) and from the NIH/NHLBI to Dr Libby (HL-48743) and to Dr Plutzky (HL-03107). We thank Eugenia Shvartz, Dr Maria Muszynski, Irina Chulsky, Dr Todd Bourcier, Dr Mitch Lazar, and Dr Francis W. Luscinskas for their assistance.
|
Footnotes |
|---|
Drs Libby and Plutzky are speakers/consultants for Abbott Laboratories, Groupe Fournier, and Parke-Davis, Warner-Lambert Company.
Received December 31, 1998; revision received April 6, 1999; accepted April 6, 1999.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Poole JCF, Florey HW. Changes in the endothelium of the aorta and the behavior of macrophages in experimental atheroma of rabbits. J Pathol Bacteriol. 1958;75:245–253.[Medline] [Order article via Infotrieve]
2. Gerrity RG. The role of the monocyte in atherogenesis, I: transition of blood-borne monocytes into foam cells in fatty lesions. Am J Pathol. 1981;103:181–190.[Abstract]
3.
Faggiotto A, Ross R, Harker L. Studies of
hypercholesterolemia in the nonhuman primate,
I: changes that lead to fatty streak formation.
Arteriosclerosis. 1984;4:323–340.
4. Joris I, Zand T, Nunnari JJ, Krolikowski FJ, Majno G. Studies on the pathogenesis of atherosclerosis, I: adhesion and emigration of mononuclear cells in the aorta of hypercholesterolemic rats. Am J Pathol. 1983;113:341–358.[Abstract]
5.
Li H, Cybulsky MI, Gimbrone MA Jr, Libby P. An
atherogenic diet rapidly induces VCAM-1, a cytokine-regulatable
mononuclear leukocyte adhesion molecule, in rabbit aortic
endothelium. Arterioscler Thromb. 1993;13:197–204.
6.
Cybulsky MI, Gimbrone MA Jr.
Endothelial expression of a mononuclear leukocyte
adhesion molecule during atherogenesis. Science. 1991;251:788–791.
7. Springer TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell. 1994;76:301–314.[Medline] [Order article via Infotrieve]
8. O'Brien KD, Allen MD, McDonald TO, Chait A, Harlan JM, Fishbein D, McCarty J, Ferguson M, Hudkins K, Benjamin CD, Lobb R, Alpers CE. Vascular cell adhesion molecule-1 is expressed in human coronary atherosclerotic plaques: implications for the mode of progression of advanced coronary atherosclerosis. J Clin Invest. 1993;92:945–951.
9. van der Wal AC, Das PK, Tigges AJ, Becker AE. Adhesion molecules on the endothelium and mononuclear cells in human atherosclerotic lesions. Am J Pathol. 1992;141:1427–1433.[Abstract]
10. Pober J, Cotran RS. What can be learned from the expression of endothelial adhesion molecules in tissues? Lab Invest. 1991;64:301–305.[Medline] [Order article via Infotrieve]
11.
De Caterina R, Cybulsky MI, Clinton SK, Gimbrone MA Jr,
Libby P. The omega-3 fatty acid docosahexaenoate reduces
cytokine-induced expression of proatherogenic and
proinflammatory proteins in human endothelial cells.
Arterioscler Thromb. 1994;14:1829–1836.
12.
Forman BM, Chen J, Evans RM. Hypolipidemic drugs,
polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome
proliferator-activated receptors alpha and delta. Proc
Natl Acad Sci U S A. 1997;94:4312–4317.
13.
Kliewer SA, Sundseth SS, Jones SA, Brown PJ, Wisely GB,
Koble CS, Devchand P, Wahli W, Willson TM, Lenhard JM, Lehmann JM.
Fatty acids and eicosanoids regulate gene expression through direct
interactions with the peroxisome proliferator-activated
receptor and . Proc Natl Acad Sci. 1997;94:4318–4323.
14.
Staels B, Dallongeville J, Auwerx J, Schoonjans K,
Leitersdorf E, Fruchart JC. Mechanism of action of fibrates on lipid
and lipoprotein metabolism. Circulation. 1998;98:2088–2093.
15. Schoonjans K, Martin G, Staels B, Auwerx J. Peroxisome proliferator-activated receptors, orphans with ligands and functions. Curr Opin Lipidol. 1997;8:159–166.[Medline] [Order article via Infotrieve]
16.
Marx N, Bourcier T, Sukhova G, Libby P, Plutzky J.
PPAR activation in human endothelial cells
increases plasminogen activator
inhibitor type-1 expression: PPAR as a potential
mediator in vascular disease. Arterioscler Thromb Vasc Biol. 1999;19:546–51.
17. Inoue I, Shino K, Noji S, Awata T, Katayama S. Expression of peroxisome proliferator-activated receptor alpha (PPAR alpha) in primary cultures of human vascular endothelial cells. Biochem Biophys Res Commun. 1998;246:370–374.[Medline] [Order article via Infotrieve]
18.
Marx N, Sukhova G, Murphy C, Libby P, Plutzky J.
Macrophages in human atheroma contain PPAR:
differentiation-dependent PPAR expression and reduction of MMP-9
activity through PPAR activation in mononuclear phagocytes.
Am J Pathol. 1998;153:17–23.
19. Luscinskas FW, Cybulsky MI, Kiely JM, Peckins CS, Davis VM, Gimbrone MA Jr. Cytokine-activated human endothelial monolayers support enhanced neutrophil transmigration via a mechanism involving both endothelial-leukocyte adhesion molecule-1 and intercellular adhesion molecule-1. J Immunol. 1991;146:1617–1625.[Abstract]
20.
Neish AS, Williams AJ, Palmer HJ, Whitley MZ, Collins
T. Functional analysis of the human vascular cell adhesion
molecule 1 promoter. J Exp Med. 1992;176:1583–1593.
21.
Chen C, Okayama H. High-efficiency transformation of
mammalian cells by plasmid DNA. Mol Cell Biol. 1987;7:2745–2752.
22.
Neish AS, Read MA, Thanos D, Pine R, Maniatis T,
Collins T. Endothelial interferon regulatory factor 1
cooperates with NF-B as a transcriptional activator
of vascular cell adhesion molecule 1. Mol Cell Biol. 1995;15:2558–2569.[Abstract]
23. Sterchele PF, Sun H, Peterson RE, Vanden Heuvel JP. Regulation of peroxisome proliferator-activated receptor-alpha mRNA in rat liver. Arch Biochem Biophys. 1996;326:281–289.[Medline] [Order article via Infotrieve]
24. Lee SS, Pineau T, Drago J, Lee EJ, Owens JW, Kroetz DL, Fernandez-Salguero PM, Westphal H, Gonzalez FJ. Targeted disruption of the alpha isoform of the peroxisome proliferator-activated receptor gene in mice results in abolishment of the pleiotropic effects of peroxisome proliferators. Mol Cell Biol. 1995;15:3012–3022.[Abstract]
25.
Staels B, Koenig W, Habib A, Merval R, Lebret M, Pineda
Torra I, Delerive P, Fadel A, Chinetti G, Fruchart J-C, Najib J,
Maclouf J, Tedgui A. Activation of human aortic smooth muscle cells is
inhibited by PPAR but not by PPAR activators.
Nature. 1998;393:790–793.[Medline]
[Order article via Infotrieve]
26.
Krey G, Braissant O, L'Horset F, Kalkhoven E, Perroud
M, Parker MG, Wahli W. Fatty acids, eicosanoids, and hypolipidemic
agents identified as ligands of peroxisome
proliferator-activated receptors by
coactivator-dependent receptor ligand assay. Mol
Endocrinol. 1997;11:779–791.
27. Vu-Dac N, Schoonjans K, Kosykh V, Dallongeville J, Fruchart JC, Staels B, Auwerx J. Fibrates increase human apolipoprotein A-II expression through activation of the peroxisome proliferator-activated receptor. J Clin Invest. 1995;96:741–750.
28.
Ray P, Ghosh SK, Zhang DH, Ray A. Repression of
interleukin-6 gene expression by 17ß-estradiol: inhibition of
the DNA-binding activity of the transcription factors NF-IL6 and
NF-B by the estrogen receptor. FEBS Lett. 1997;409:79–85.[Medline]
[Order article via Infotrieve]
29.
Schule R, Rangarajan P, Yang N, Kliewer S, Ransone LJ,
Bolado J, Verma IM, Evans RM. Retinoic acid is a negative regulator of
AP-1-responsive genes. Proc Natl Acad Sci U S A. 1991;88:6092–6096.
30.
Gerritsen ME, Williams AJ, Neish AS, Moore S, Shi Y,
Collins T. CREB-binding protein/p300 are transcriptional
co-activators of p65. Proc Natl Acad Science. 1997;94:2927–2932.
31.
Dowell P, Ishmael JE, Avram D, Peterson VJ, Nevrivy DJ,
Leid M. p300 functions as a coactivator for the peroxisome
proliferator-activated receptor alpha. J Biol
Chem. 1997;272:33435–33443.
32. Collins T, Read MA, Neish AS, Whitley MZ, Thanos D, Maniatis T. Transcriptional regulation of endothelial cell adhesion molecules: NF-kappa B and cytokine-inducible enhancers. FASEB J. 1995;9:899–909.[Abstract]
33. Gille J, Paxton LL, Lawley TJ, Caughman SW, Swerlick RA. Retinoic acid inhibits the regulated expression of vascular cell adhesion molecule-1 by cultured dermal microvascular endothelial cells. J Clin Invest. 1997;99:492–500.[Medline] [Order article via Infotrieve]
34. Weil A, Caldwell J, Strolin-Benedetti M. The metabolism and disposition of 14C-fenofibrate in human volunteers. Drug Metab Dispos. 1990;18:115–120.[Abstract]
35. Hahmann HW, Bunte T, Hellwig N, Hau U, Becker D, Dyckmans J, Keller HE, Schieffer HJ. Progression and regression of minor coronary arterial narrowings by quantitative angiography after fenofibrate therapy. Am J Cardiol. 1991;67:957–961.[Medline] [Order article via Infotrieve]
36. Kromhout D, Bosschieter EB, de Lezenne Coulander C. The inverse relation between fish consumption and 20-year mortality from coronary heart disease. N Engl J Med. 1985;312:1205–1209.[Abstract]
37.
Davis HR, Bridenstine RT, Vesselinovitch D, Wissler RW.
Fish oil inhibits development of atherosclerosis in
rhesus monkeys. Arteriosclerosis. 1987;7:441–449.
38.
Harker LA, Kelly AB, Hanson SR, Krupski W, Bass A,
Osterud B, FitzGerald GA, Goodnight SH, Connor WE. Interruption of
vascular thrombus formation and vascular lesion formation by dietary
n-3 fatty acids in fish oil in nonhuman primates.
Circulation. 1993;87:1017–1029.
This article has been cited by other articles:
 |
|
 |
|
  A. A. Bulhak, C. Jung, C.-G. Ostenson, J. O. Lundberg, P.-O. Sjoquist, and J. Pernow PPAR-{alpha} activation protects the type 2 diabetic myocardium against ischemia-reperfusion injury: involvement of the PI3-Kinase/Akt and NO pathway Am J Physiol Heart Circ Physiol, March 1, 2009; 296(3): H719 - H727. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. D. Kane, K. A. Stevens, J. E. Fischer, M. Haghpassand, L. J. Royer, C. Aldinger, K. T. Landschulz, P. Zagouras, S. W. Bagley, W. Hada, et al. Molecular Characterization of Novel and Selective Peroxisome Proliferator-Activated Receptor {alpha} Agonists with Robust Hypolipidemic Activity in Vivo Mol. Pharmacol., February 1, 2009; 75(2): 296 - 306. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. B. Schaefer, A. Pose, J. Ott, M. Hecker, A. Behnk, R. Schulz, N. Weissmann, A. Gunther, W. Seeger, and K. Mayer Peroxisome proliferator-activated receptor-{alpha} reduces inflammation and vascular leakage in a murine model of acute lung injury Eur. Respir. J., November 1, 2008; 32(5): 1344 - 1353. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Harari, D. Harats, D. Marko, H. Cohen, I. Barshack, Y. Kamari, A. Gonen, Y. Gerber, A. Ben-Amotz, and A. Shaish A 9-cis {beta}-Carotene-Enriched Diet Inhibits Atherogenesis and Fatty Liver Formation in LDL Receptor Knockout Mice J. Nutr., October 1, 2008; 138(10): 1923 - 1930. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Orasanu, O. Ziouzenkova, P. R. Devchand, V. Nehra, O. Hamdy, E. S. Horton, and J. Plutzky The Peroxisome Proliferator-Activated Receptor-{gamma} Agonist Pioglitazone Represses Inflammation in a Peroxisome Proliferator-Activated Receptor-{alpha}-Dependent Manner In Vitro and In Vivo in Mice J. Am. Coll. Cardiol., September 2, 2008; 52(10): 869 - 881. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Mansouri, E. Bauge, B. Staels, and P. Gervois Systemic and Distal Repercussions of Liver-Specific Peroxisome Proliferator-Activated Receptor-{alpha} Control of the Acute-Phase Response Endocrinology, June 1, 2008; 149(6): 3215 - 3223. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Ruan, F. Zheng, and Y. Guan PPARs and the kidney in metabolic syndrome Am J Physiol Renal Physiol, May 1, 2008; 294(5): F1032 - F1047. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Panigrahy, A. Kaipainen, S. Huang, C. E. Butterfield, C. M. Barnes, M. Fannon, A. M. Laforme, D. M. Chaponis, J. Folkman, and M. W. Kieran PPAR{alpha} agonist fenofibrate suppresses tumor growth through direct and indirect angiogenesis inhibition PNAS, January 22, 2008; 105(3): 985 - 990. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Pedro-Botet Review: The role of fenofibrate in reducing cardiovascular risk in type 2 diabetes The British Journal of Diabetes & Vascular Disease, January 1, 2008; 8(1): 22 - 27. [Abstract] [PDF]
|
|
|
|
 |
|
 J. Wray and D. Bishop-Bailey Epoxygenases and peroxisome proliferator-activated receptors in mammalian vascular biology Exp Physiol, January 1, 2008; 93(1): 148 - 154. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Steiner Atherosclerosis in type 2 diabetes: a role for fibrate therapy? Diabetes and Vascular Disease Research, December 1, 2007; 4(4): 368 - 374. [Abstract] [PDF]
|
|
|
|
 |
|
 V. Mallika, B. Goswami, and M. Rajappa Atherosclerosis Pathophysiology and the Role of Novel Risk Factors: A Clinicobiochemical Perspective Angiology, November 1, 2007; 58(5): 513 - 522. [Abstract] [PDF]
|
|
|
|
 |
|
 N. K. LeBrasseur, T.-A. S. Duhaney, D. S. De Silva, L. Cui, P. C. Ip, L. Joseph, and F. Sam Effects of Fenofibrate on Cardiac Remodeling in Aldosterone-Induced Hypertension Hypertension, September 1, 2007; 50(3): 489 - 496. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Kronke, A. Kadl, E. Ikonomu, S. Bluml, A. Furnkranz, I. J. Sarembock, V. N. Bochkov, M. Exner, B. R. Binder, and N. Leitinger Expression of Heme Oxygenase-1 in Human Vascular Cells Is Regulated by Peroxisome Proliferator-Activated Receptors Arterioscler Thromb Vasc Biol, June 1, 2007; 27(6): 1276 - 1282. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T.-A. S. Duhaney, L. Cui, M. K. Rude, N. K. Lebrasseur, S. Ngoy, D. S. De Silva, D. A. Siwik, R. Liao, and F. Sam Peroxisome Proliferator-Activated Receptor {alpha}-Independent Actions of Fenofibrate Exacerbates Left Ventricular Dilation and Fibrosis in Chronic Pressure Overload Hypertension, May 1, 2007; 49(5): 1084 - 1094. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Brown and J. Plutzky Peroxisome Proliferator Activated Receptors as Transcriptional Nodal Points and Therapeutic Targets Circulation, January 30, 2007; 115(4): 518 - 533. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Y. Ng, C. Morisseau, J. R. Falck, B. D. Hammock, and D. L. Kroetz Inhibition of Smooth Muscle Proliferation by Urea-Based Alkanoic Acids via Peroxisome Proliferator-Activated Receptor {alpha}-Dependent Repression of Cyclin D1 Arterioscler Thromb Vasc Biol, November 1, 2006; 26(11): 2462 - 2468. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S. Lee, S. J. Park, S. R. Kim, K. H. Min, S. M. Jin, H. K. Lee, and Y. C. Lee Modulation of Airway Remodeling and Airway Inflammation by Peroxisome Proliferator-Activated Receptor {gamma} in a Murine Model of Toluene Diisocyanate-Induced Asthma J. Immunol., October 15, 2006; 177(8): 5248 - 5257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M J. Chapman The effects of fibrates on lipid metabolism and inflammation in type 2 diabetes Diabetes and Vascular Disease Research, September 1, 2006; 3(1_suppl): S6 - S9. [Abstract] [PDF]
|
|
|
|
|
|
C. Y. Han, T. Chiba, J. S. Campbell, N. Fausto, M. Chaisson, G. Orasanu, J. Plutzky, and A. Chait Reciprocal and Coordinate Regulation of Serum Amyloid A Versus Apolipoprotein A-I and Paraoxonase-1 by Inflammation in Murine Hepatocytes Arterioscler Thromb Vasc Biol, August 1, 2006; 26(8): 1806 - 1813. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Huber, A. Furnkranz, V. N. Bochkov, M. K. Patricia, H. Lee, C. C. Hedrick, J. A. Berliner, B. R. Binder, and N. Leitinger Specific monocyte adhesion to endothelial cells induced by oxidized phospholipids involves activation of cPLA2 and lipoxygenase J. Lipid Res., May 1, 2006; 47(5): 1054 - 1062. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Cuzzocrea, E. Mazzon, R. Di Paola, A. Peli, A. Bonato, D. Britti, T. Genovese, C. Muia, C. Crisafulli, and A. P. Caputi The role of the peroxisome proliferator-activated receptor-{alpha} (PPAR-{alpha}) in the regulation of acute inflammation J. Leukoc. Biol., May 1, 2006; 79(5): 999 - 1010. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Zambon, P. Gervois, P. Pauletto, J.-C. Fruchart, and B. Staels Modulation of Hepatic Inflammatory Risk Markers of Cardiovascular Diseases by PPAR-{alpha} Activators: Clinical and Experimental Evidence Arterioscler Thromb Vasc Biol, May 1, 2006; 26(5): 977 - 986. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Ahmed, G. Orasanu, V. Nehra, L. Asatryan, D. J. Rader, O. Ziouzenkova, and J. Plutzky High-Density Lipoprotein Hydrolysis by Endothelial Lipase Activates PPAR{alpha}: A Candidate Mechanism for High-Density Lipoprotein-Mediated Repression of Leukocyte Adhesion Circ. Res., March 3, 2006; 98(4): 490 - 498. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Ferrucci, A. Cherubini, S. Bandinelli, B. Bartali, A. Corsi, F. Lauretani, A. Martin, C. Andres-Lacueva, U. Senin, and J. M. Guralnik Relationship of Plasma Polyunsaturated Fatty Acids to Circulating Inflammatory Markers J. Clin. Endocrinol. Metab., February 1, 2006; 91(2): 439 - 446. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M J. Chapman Review: Fibrates: therapeutic review The British Journal of Diabetes & Vascular Disease, January 1, 2006; 6(1): 11 - 19. [Abstract] [PDF]
|
|
|
|
|
|
F. Blaschke, Y. Takata, E. Caglayan, R. E. Law, and W. A. Hsueh Obesity, Peroxisome Proliferator-Activated Receptor, and Atherosclerosis in Type 2 Diabetes Arterioscler Thromb Vasc Biol, January 1, 2006; 26(1): 28 - 40. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Chen, W. J. Esselman, D. B. Jump, and J. V. Busik Anti-inflammatory Effect of Docosahexaenoic Acid on Cytokine-Induced Adhesion Molecule Expression in Human Retinal Vascular Endothelial Cells Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 4342 - 4347. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 2nd International Symposium on Triglycerides and HDL: Lipid abnormalities and their treatment Diabetes Care, November 1, 2005; 28(11): 2795 - 2802. [Full Text] [PDF]
|
|
|
|
|
|
S. H. Han, M. J. Quon, and K. K. Koh Beneficial Vascular and Metabolic Effects of Peroxisome Proliferator-Activated Receptor-{alpha} Activators Hypertension, November 1, 2005; 46(5): 1086 - 1092. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Hennuyer, A. Tailleux, G. Torpier, H. Mezdour, J.-C. Fruchart, B. Staels, and C. Fievet PPAR{alpha}, but not PPAR{gamma}, Activators Decrease Macrophage-Laden Atherosclerotic Lesions in a Nondiabetic Mouse Model of Mixed Dyslipidemia Arterioscler Thromb Vasc Biol, September 1, 2005; 25(9): 1897 - 1902. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Dyroy, A. Yndestad, T. Ueland, B. Halvorsen, J. K. Damas, P. Aukrust, and R. K. Berge Antiinflammatory Effects of Tetradecylthioacetic Acid Involve Both Peroxisome Proliferator-Activated Receptor {alpha}-Dependent and -Independent Pathways Arterioscler Thromb Vasc Biol, July 1, 2005; 25(7): 1364 - 1369. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Cariou, J.-C. Fruchart, and B. Staels Review: Vascular protective effects of peroxisome proliferator-activated receptor agonists The British Journal of Diabetes & Vascular Disease, May 1, 2005; 5(3): 126 - 132. [Abstract] [PDF]
|
|
|
|
|
|
M. P.J. de Winther, E. Kanters, G. Kraal, and M. H. Hofker Nuclear Factor {kappa}B Signaling in Atherogenesis Arterioscler Thromb Vasc Biol, May 1, 2005; 25(5): 904 - 914. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Migita and J. Morser 15-Deoxy-{Delta}12,14-Prostaglandin J2 (15d-PGJ2) Signals Through Retinoic Acid Receptor-Related Orphan Receptor-{alpha} but Not Peroxisome Proliferator-Activated Receptor-{gamma} in Human Vascular Endothelial Cells: The Effect of 15d-PGJ2 on Tumor Necrosis Factor-{alpha}-Induced Gene Expression Arterioscler Thromb Vasc Biol, April 1, 2005; 25(4): 710 - 716. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. L. Schiffrin Peroxisome proliferator-activated receptors and cardiovascular remodeling Am J Physiol Heart Circ Physiol, March 1, 2005; 288(3): H1037 - H1043. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Li and C. K. Glass PPAR- and LXR-dependent pathways controlling lipid metabolism and the development of atherosclerosis J. Lipid Res., December 1, 2004; 45(12): 2161 - 2173. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Okapcova and D. Gabor The Levels of Soluble Adhesion Molecules in Diabetic and Nondiabetic Patients with Combined Hyperlipoproteinemia and the Effect of Ciprofibrate Therapy Angiology, November 1, 2004; 55(6): 629 - 639. [Abstract] [PDF]
|
|
|
|
 |
|
 Y. Guan Peroxisome Proliferator-Activated Receptor Family and Its Relationship to Renal Complications of the Metabolic Syndrome J. Am. Soc. Nephrol., November 1, 2004; 15(11): 2801 - 2815. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Marx, D. Walcher, N. Ivanova, K. Rautzenberg, A. Jung, R. Friedl, V. Hombach, R. de Caterina, G. Basta, M.-P. Wautier, et al. Thiazolidinediones Reduce Endothelial Expression of Receptors for Advanced Glycation End Products Diabetes, October 1, 2004; 53(10): 2662 - 2668. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Marx, H. Duez, J.-C. Fruchart, and B. Staels Peroxisome Proliferator-Activated Receptors and Atherogenesis: Regulators of Gene Expression in Vascular Cells Circ. Res., May 14, 2004; 94(9): 1168 - 1178. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Srinivasan, M. E. Hatley, K. B. Reilly, E. C. Danziger, and C. C. Hedrick Modulation of PPAR{alpha} Expression and Inflammatory Interleukin-6 Production by Chronic Glucose Increases Monocyte/Endothelial Adhesion Arterioscler Thromb Vasc Biol, May 1, 2004; 24(5): 851 - 857. [Abstract] [Full Text]
|
|
|
|
|
|
T. Ogata, T. Miyauchi, S. Sakai, M. Takanashi, Y. Irukayama-Tomobe, and I. Yamaguchi Myocardial fibrosis and diastolic dysfunction in deoxycorticosterone acetate-salt hypertensive rats is ameliorated by the peroxisome proliferator-activated receptor-alpha activator fenofibrate, partly by suppressing inflammatory responses associated with the nuclear factor-kappa-b pathway J. Am. Coll. Cardiol., April 21, 2004; 43(8): 1481 - 1488. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Gervois, R. Kleemann, A. Pilon, F. Percevault, W. Koenig, B. Staels, and T. Kooistra Global Suppression of IL-6-induced Acute Phase Response Gene Expression after Chronic in Vivo Treatment with the Peroxisome Proliferator-activated Receptor-{alpha} Activator Fenofibrate J. Biol. Chem., April 16, 2004; 279(16): 16154 - 16160. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Reiterer, M. Toborek, and B. Hennig Quercetin Protects Against Linoleic Acid-Induced Porcine Endothelial Cell Dysfunction J. Nutr., April 1, 2004; 134(4): 771 - 775. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Goya, S. Sumitani, X. Xu, T. Kitamura, H. Yamamoto, S. Kurebayashi, H. Saito, H. Kouhara, S. Kasayama, and I. Kawase Peroxisome Proliferator-Activated Receptor {alpha} Agonists Increase Nitric Oxide Synthase Expression in Vascular Endothelial Cells Arterioscler Thromb Vasc Biol, April 1, 2004; 24(4): 658 - 663. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Meissner, M. Stein, C. Urbich, K. Reisinger, G. Suske, B. Staels, R. Kaufmann, and J. Gille PPAR{alpha} Activators Inhibit Vascular Endothelial Growth Factor Receptor-2 Expression by Repressing Sp1-Dependent DNA Binding and Transactivation Circ. Res., February 20, 2004; 94(3): 324 - 332. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. V. Desouza, S. N. Murthy, J. Diez, B. Dunne, A. S. Matta, V. A. Fonseca, and D. B. McNamara Differential Effects of Peroxisome Proliferator Activator Receptor-{alpha} and {gamma} Ligands on Intimal Hyperplasia After Balloon Catheter-Induced Vascular Injury in Zucker Rats Journal of Cardiovascular Pharmacology and Therapeutics, December 1, 2003; 8(4): 297 - 305. [Abstract] [PDF]
|
|
|
|
|
|
J. S. Sidhu, D. Cowan, and J.-C. Kaski The effects of rosiglitazone, a peroxisome proliferator-activated receptor-gamma agonist, on markers of endothelial cell activation, C-reactive protein, and fibrinogen levels in non-diabetic coronary artery disease patients J. Am. Coll. Cardiol., November 19, 2003; 42(10): 1757 - 1763. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Ziouzenkova, L. Asatryan, D. Sahady, G. Orasanu, S. Perrey, B. Cutak, T. Hassell, T. E. Akiyama, J. P. Berger, A. Sevanian, et al. Dual Roles for Lipolysis and Oxidation in Peroxisome Proliferation-Activator Receptor Responses to Electronegative Low Density Lipoprotein J. Biol. Chem., October 10, 2003; 278(41): 39874 - 39881. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. L. Schiffrin, F. Amiri, K. Benkirane, M. Iglarz, and Q. N. Diep Peroxisome Proliferator-Activated Receptors: Vascular and Cardiac Effects in Hypertension Hypertension, October 1, 2003; 42(4): 664 - 668. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. K. Plante and J. L. Nadler Diabetes and Vascular Disease Seminars in Cardiothoracic and Vascular Anesthesia, September 1, 2003; 7(3): 295 - 310. [Abstract] [PDF]
|
|
|
|
|
|
B. Martin-McNulty, D. M. Tham, V. da Cunha, J. J. Ho, D. W. Wilson, J. C. Rutledge, G. G. Deng, R. Vergona, M. E. Sullivan, and Y.-X. Wang 17{beta}-Estradiol Attenuates Development of Angiotensin II-Induced Aortic Abdominal Aneurysm in Apolipoprotein E-Deficient Mice Arterioscler Thromb Vasc Biol, September 1, 2003; 23(9): 1627 - 1632. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-W. Chen, Y.-H. Chen, F.-Y. Lin, Y.-L. Chen, and S.-J. Lin Ginkgo biloba Extract Inhibits Tumor Necrosis Factor-{alpha}-Induced Reactive Oxygen Species Generation, Transcription Factor Activation, and Cell Adhesion Molecule Expression in Human Aortic Endothelial Cells Arterioscler Thromb Vasc Biol, September 1, 2003; 23(9): 1559 - 1566. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Ruan, H. J. Pownall, and H. F. Lodish Troglitazone Antagonizes Tumor Necrosis Factor-{alpha}-induced Reprogramming of Adipocyte Gene Expression by Inhibiting the Transcriptional Regulatory Functions of NF-{kappa}B J. Biol. Chem., July 18, 2003; 278(30): 28181 - 28192. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Deplanque, P. Gele, O. Petrault, I. Six, C. Furman, M. Bouly, S. Nion, B. Dupuis, D. Leys, J.-C. Fruchart, et al. Peroxisome Proliferator-Activated Receptor-{alpha} Activation as a Mechanism of Preventive Neuroprotection Induced by Chronic Fenofibrate Treatment J. Neurosci., July 16, 2003; 23(15): 6264 - 6271. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. A. Francis, J.-S. Annicotte, and J. Auwerx PPAR-{alpha} effects on the heart and other vascular tissues Am J Physiol Heart Circ Physiol, June 5, 2003; 285(1): H1 - H9. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Jin, G.-S. Sun, D. Marchadier, E. Octtaviani, J. M. Glick, and D. J. Rader Endothelial Cells Secrete Triglyceride Lipase and Phospholipase Activities in Response to Cytokines as a Result of Endothelial Lipase Circ. Res., April 4, 2003; 92(6): 644 - 650. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. G. L. Biondi-Zoccai, A. Abbate, G. Liuzzo, and L. M. Biasucci Atherothrombosis, inflammation, and diabetes J. Am. Coll. Cardiol., April 2, 2003; 41(7): 1071 - 1077. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Hattori, M. Matsumura, and K. Kasai Vascular smooth muscle cell activation by C-reactive protein Cardiovasc Res, April 1, 2003; 58(1): 186 - 195. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-C. Corvol, A. Bouzamondo, M. Sirol, J.-S. Hulot, P. Sanchez, and P. Lechat Differential Effects of Lipid-Lowering Therapies on Stroke Prevention: A Meta-analysis of Randomized Trials Arch Intern Med, March 24, 2003; 163(6): 669 - 676. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Ziouzenkova, S. Perrey, L. Asatryan, J. Hwang, K. L. MacNaul, D. E. Moller, D. J. Rader, A. Sevanian, R. Zechner, G. Hoefler, et al. Lipolysis of triglyceride-rich lipoproteins generates PPAR ligands: Evidence for an antiinflammatory role for lipoprotein lipase PNAS, March 4, 2003; 100(5): 2730 - 2735. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. J. Patel, M. G. Belvisi, D. Bishop-Bailey, M. H. Yacoub, and J. A. Mitchell Activation of Peroxisome Proliferator-Activated Receptors in Human Airway Smooth Muscle Cells Has a Superior Anti-inflammatory Profile to Corticosteroids: Relevance for Chronic Obstructive Pulmonary Disease Therapy J. Immunol., March 1, 2003; 170(5): 2663 - 2669. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. D. Feher, A. L. Hepburn, M. B. Hogarth, S. G. Ball, and S. A. Kaye Fenofibrate enhances urate reduction in men treated with allopurinol for hyperuricaemia and gout Rheumatology, February 1, 2003; 42(2): 321 - 325. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Duez, Y.-S. Chao, M. Hernandez, G. Torpier, P. Poulain, S. Mundt, Z. Mallat, E. Teissier, C. A. Burton, A. Tedgui, et al. Reduction of Atherosclerosis by the Peroxisome Proliferator-activated Receptor alpha Agonist Fenofibrate in Mice J. Biol. Chem., December 6, 2002; 277(50): 48051 - 48057. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. N. Diep, F. Amiri, R. M. Touyz, J. S. Cohn, D. Endemann, M. F. Neves, and E. L. Schiffrin PPAR{alpha} Activator Effects on Ang II-Induced Vascular Oxidative Stress and Inflammation Hypertension, December 1, 2002; 40(6): 866 - 871. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Kluft, R. Kleemann, and M.P.M. de Maat How best to counteract the enemies? By controlling inflammation in the coronary circulation Eur. Heart J. Suppl., November 1, 2002; 4(suppl_G): G53 - G65. [Abstract] [PDF]
|
|
|
|
 |
|
 D. M. Tham, B. Martin-McNulty, Y.-x. Wang, D. W. Wilson, R. Vergona, M. E. Sullivan, W. Dole, and J. C. Rutledge Angiotensin II is associated with activation of NF-{kappa}B-mediated genes and downregulation of PPARs Physiol Genomics, October 2, 2002; 11(1): 21 - 30. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Cernuda-Morollon, F. Rodriguez-Pascual, P. Klatt, S. Lamas, and D. Perez-Sala PPAR Agonists Amplify iNOS Expression While Inhibiting NF-{kappa}B: Implications for Mesangial Cell Activation by Cytokines J. Am. Soc. Nephrol., September 1, 2002; 13(9): 2223 - 2231. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Sethi, O. Ziouzenkova, H. Ni, D. D. Wagner, J. Plutzky, and T. N. Mayadas Oxidized omega-3 fatty acids in fish oil inhibit leukocyte-endothelial interactions through activation of PPARalpha Blood, July 30, 2002; 100(4): 1340 - 1346. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Beckman, M. A. Creager, and P. Libby Diabetes and Atherosclerosis: Epidemiology, Pathophysiology, and Management JAMA, May 15, 2002; 287(19): 2570 - 2581. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Delerive, K. De Bosscher, W. Vanden Berghe, J.-C. Fruchart, G. Haegeman, and B. Staels DNA Binding-Independent Induction of I{kappa}B{alpha} Gene Transcription by PPAR{alpha} Mol. Endocrinol., May 1, 2002; 16(5): 1029 - 1039. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Barbier, I. P. Torra, Y. Duguay, C. Blanquart, J.-C. Fruchart, C. Glineur, and B. Staels Pleiotropic Actions of Peroxisome Proliferator-Activated Receptors in Lipid Metabolism and Atherosclerosis Arterioscler Thromb Vasc Biol, May 1, 2002; 22(5): 717 - 726. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Marx, B. Kehrle, K. Kohlhammer, M. Grub, W. Koenig, V. Hombach, P. Libby, and J. Plutzky PPAR Activators as Antiinflammatory Mediators in Human T Lymphocytes: Implications for Atherosclerosis and Transplantation-Associated Arteriosclerosis Circ. Res., April 5, 2002; 90(6): 703 - 710. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. J. Etgen, B. A. Oldham, W. T. Johnson, C. L. Broderick, C. R. Montrose, J. T. Brozinick, E. A. Misener, J. S. Bean, W. R. Bensch, D. A. Brooks, et al. A Tailored Therapy for the Metabolic Syndrome : The Dual Peroxisome Proliferator-Activated Receptor-{alpha}/{gamma} Agonist LY465608 Ameliorates Insulin Resistance and Diabetic Hyperglycemia While Improving Cardiovascular Risk Factors in Preclinical Models Diabetes, April 1, 2002; 51(4): 1083 - 1087. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Cunard, M. Ricote, D. DiCampli, D. C. Archer, D. A. Kahn, C. K. Glass, and C. J. Kelly Regulation of Cytokine Expression by Ligands of Peroxisome Proliferator Activated Receptors J. Immunol., March 15, 2002; 168(6): 2795 - 2802. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. B. Clark The role of PPARs in inflammation and immunity J. Leukoc. Biol., March 1, 2002; 71(3): 388 - 400. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Kelly The Pleiotropic Nature of the Vascular PPAR Gene Regulatory Pathway Circ. Res., November 23, 2001; 89(11): 935 - 937. [Full Text] [PDF]
|
|
|
|
 |
|
 P. Amarenco Hypercholesterolemia, lipid-lowering agents, and the risk for brain infarction Neurology, September 1, 2001; 57(90002): S35 - 44. [Abstract] [Full Text]
|
|
|
|
 |
|
 K. Fujimoto, T. Imaizumi, H. Yoshida, S. Takanashi, K. Okumura, and K. Satoh Interferon-gamma Stimulates Fractalkine Expression in Human Bronchial Epithelial Cells and Regulates Mononuclear Cell Adherence Am. J. Respir. Cell Mol. Biol., August 1, 2001; 25(2): 233 - 238. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Xu, M. Otsuki, H. Saito, S. Sumitani, H. Yamamoto, N. Asanuma, H. Kouhara, and S. Kasayama PPAR{alpha} and GR Differentially Down-Regulate the Expression of Nuclear Factor-{kappa}B-Responsive Genes in Vascular Endothelial Cells Endocrinology, August 1, 2001; 142(8): 3332 - 3339. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Libby Current Concepts of the Pathogenesis of the Acute Coronary Syndromes Circulation, July 17, 2001; 104(3): 365 - 372. [Full Text] [PDF]
|
|
|
|
|
|
H. Bloomfield Rubins, J. Davenport, V. Babikian, L. M. Brass, D. Collins, L. Wexler, S. Wagner, V. Papademetriou, G. Rutan, and S. J. Robins Reduction in Stroke With Gemfibrozil in Men With Coronary Heart Disease and Low HDL Cholesterol : The Veterans Affairs HDL Intervention Trial (VA-HIT) Circulation, June 12, 2001; 103(23): 2828 - 2833. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Pasceri, J. Chang, J. T. Willerson, and E. T. H. Yeh Modulation of C-Reactive Protein-Mediated Monocyte Chemoattractant Protein-1 Induction in Human Endothelial Cells by Anti-Atherosclerosis Drugs Circulation, May 29, 2001; 103(21): 2531 - 2534. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Tedgui and Z. Mallat Anti-Inflammatory Mechanisms in the Vascular Wall Circ. Res., May 11, 2001; 88(9): 877 - 887. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. S. Elangbam, R. D. Tyler, and R. M. Lightfoot Peroxisome Proliferator-activated Receptors in Atherosclerosis and Inflammation--An Update Toxicol Pathol, February 1, 2001; 29(2): 224 - 231. [Abstract] [PDF]
|
|
|
|
|
|
M. Otsuki, H. Saito, X. Xu, S. Sumitani, H. Kouhara, T. Kishimoto, and S. Kasayama Progesterone, but Not Medroxyprogesterone, Inhibits Vascular Cell Adhesion Molecule-1 Expression in Human Vascular Endothelial Cells Arterioscler Thromb Vasc Biol, February 1, 2001; 21(2): 243 - 248. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Plutzky and P. M. Ridker Statins for Stroke: The Second Story? Circulation, January 23, 2001; 103(3): 348 - 350. [Full Text] [PDF]
|
|
|
|
|
|
B. P. Neve, D. Corseaux, G. Chinetti, C. Zawadzki, J.-C. Fruchart, P. Duriez, B. Staels, and B. Jude PPAR{{alpha}} Agonists Inhibit Tissue Factor Expression in Human Monocytes and Macrophages Circulation, January 16, 2001; 103(2): 207 - 212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Marx, N. Mackman, U. Schonbeck, N. Yilmaz, V. Hombach, P. Libby, and J. Plutzky PPAR{{alpha}} Activators Inhibit Tissue Factor Expression and Activity in Human Monocytes Circulation, January 16, 2001; 103(2): 213 - 219. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Rainer de Martin, M. Hoeth, R. Hofer-Warbinek, and J. A. Schmid The Transcription Factor NF-{kappa}B and the Regulation of Vascular Cell Function Arterioscler Thromb Vasc Biol, November 1, 2000; 20 (11): e83 - e88. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Takano, T. Nagai, M. Asakawa, T. Toyozaki, T. Oka, I. Komuro, T. Saito, and Y. Masuda Peroxisome Proliferator-Activated Receptor Activators Inhibit Lipopolysaccharide-Induced Tumor Necrosis Factor-{alpha} Expression in Neonatal Rat Cardiac Myocytes Circ. Res., September 29, 2000; 87(7): 596 - 602. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Marx, F. Mach, A. Sauty, J. H. Leung, M. N. Sarafi, R. M. Ransohoff, P. Libby, J. Plutzky, and A. D. Luster Peroxisome Proliferator-Activated Receptor-{gamma} Activators Inhibit IFN-{gamma}-Induced Expression of the T Cell-Active CXC Chemokines IP-10, Mig, and I-TAC in Human Endothelial Cells J. Immunol., June 15, 2000; 164(12): 6503 - 6508. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Pasceri, H. D. Wu, J. T. Willerson, and E. T. H. Yeh Modulation of Vascular Inflammation In Vitro and In Vivo by Peroxisome Proliferator-Activated Receptor-{gamma} Activators Circulation, January 25, 2000; 101(3): 235 - 238. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Delerive, K. De Bosscher, S. Besnard, W. Vanden Berghe, J. M. Peters, F. J. Gonzalez, J.-C. Fruchart, A. Tedgui, G. Haegeman, and B. Staels Peroxisome Proliferator-activated Receptor alpha Negatively Regulates the Vascular Inflammatory Gene Response by Negative Cross-talk with Transcription Factors NF-kappa B and AP-1 J. Biol. Chem., November 5, 1999; 274(45): 32048 - 32054. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Delerive, P. Gervois, J.-C. Fruchart, and B. Staels Induction of Ikappa Balpha Expression as a Mechanism Contributing to the Anti-inflammatory Activities of Peroxisome Proliferator-activated Receptor-alpha Activators J. Biol. Chem., November 17, 2000; 275(47): 36703 - 36707. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Gervois, N. Vu-Dac, R. Kleemann, M. Kockx, G. Dubois, B. Laine, V. Kosykh, J.-C. Fruchart, T. Kooistra, and B. Staels Negative Regulation of Human Fibrinogen Gene Expression by Peroxisome Proliferator-activated Receptor alpha Agonists via Inhibition of CCAAT Box/Enhancer-binding Protein beta J. Biol. Chem., August 31, 2001; 276(36): 33471 - 33477. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Marx, B. Kehrle, K. Kohlhammer, M. Grub, W. Koenig, V. Hombach, P. Libby, and J. Plutzky PPAR Activators as Antiinflammatory Mediators in Human T Lymphocytes: Implications for Atherosclerosis and Transplantation-Associated Arteriosclerosis Circ. Res., April 5, 2002; 90(6): 703 - 710. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Flavell, Y. Jamshidi, E. Hawe, I. Pineda Torra, M.-R. Taskinen, M. H. Frick, M. S. Nieminen, Y. A. Kesaniemi, A. Pasternack, B. Staels, et al. Peroxisome Proliferator-Activated Receptor {alpha} Gene Variants Influence Progression of Coronary Atherosclerosis and Risk of Coronary Artery Disease Circulation, March 26, 2002; 105(12): 1440 - 1445. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||