This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Anger, M. Articles by MD, J.-L. S. Search for Related Content PubMed PubMed Citation Articles by Anger, M. Articles by MD, J.-L. S.

Cellular Distribution of Ca²⁺ Pumps and Ca²⁺ Release Channels in Rat Cardiac Hypertrophy Induced by Aortic Stenosis

Marielle Anger, PhD; Anne-Marie Lompré, PhD; Olivier Vallot, BSc; Françoise Marotte; Lydie Rappaport, PhD; ; Jane-Lise Samuel MD, PhD

From "Gènes et protéines musculaires," Signalisation Cellulaire, Université Paris-Sud (M.A., A.-M.L., O.V.) and INSERM U127 (F.M., L.R., J.-L.S.), Paris, France.

Correspondence to A.M. Lompré, "Gènes et protéines musculaires" CNRS EP 1088, Bât 432, Université Paris-Sud, 91405 Orsay, France. E-mail anne-marie.lompre{at}egm.u-psud.fr

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background—The response of ventricular myocytes to pressure overload is heterogeneous and not spatially coordinated. We investigated whether or not the alterations in SERCA and RyR gene expression are homogeneous within the myocardium.

Methods and Results—The cellular distribution of mRNAs and proteins encoding the 2 sarco(endo)plasmic reticulum Ca²⁺-ATPase (SERCA) isoforms (SERCA 2a and 2b) and 2 Ca²⁺ release channels (the ryanodine receptor, RyR, and the IP₃ receptor, IP₃R) were analyzed by in situ hybridization and immunofluorescence, respectively. Analyses were performed during early (1 and 5 days) and late (1 month) stages of cardiac hypertrophy induced in rat by thoracic aortic stenosis (AS). The results indicated that 1 and 5 days after AS, the cellular distribution of SERCA 2a and RyR2 mRNAs in right ventricle and atrium was similar to controls but the mRNA levels appeared to decrease in some areas of the left ventricle (LV). One month after AS, the distribution of SERCA 2a mRNA and protein became heterogeneous throughout the LV, whereas RyR2 mRNA and protein levels were decreased in a homogeneous manner. SERCA 2b, poorly expressed in both cardiomyocytes and vessels of controls, was increased 4-fold 1 month after AS in coronary arteries only. In both sham (Sh) and AS, SERCA 3 and IP₃R mRNAs were mainly found in the vessels.

Conclusions—In severe hypertrophy, decreased accumulation of SERCA 2a was heterogeneous and not compensated by an induction of SERCA 2b in the cardiomyocytes. Decrease in RyR2 expression was more homogeneous and not compensated by an increased IP₃R expression.

Key Words: sarcoplasmic reticulum • hypertrophy • calcium channels • remodeling

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
The sarco(endo)plasmic reticulum Ca²⁺-ATPase (SERCA), the main protein involved in restoration of cytosolic Ca²⁺ concentration during relaxation, is encoded by 3 genes. The heart contains 3 SERCA isoforms: SERCA 2a, SERCA 2b, and SERCA 3, 2 of which (SERCA 2a and 2b) are generated by alternative splicing. SERCA 2a is the major isoform in cardiomyocytes, whereas SERCA 2b is ubiquitously expressed.¹ SERCA 3 is specifically found in endothelial cells of coronary arteries.^{1 2}

Two sarcoplasmic reticulum/endoplasmic reticulum (SR/ER) Ca²⁺ release mechanisms have been described in the heart. A Ca²⁺-induced Ca²⁺ release mechanism involving the ryanodine receptor (RyR) is the major pathway, and the alternate is an inositol trisphosphate (IP₃)-induced Ca²⁺ release mechanism that involves the IP₃ receptor (IP₃R). In the heart, RyR2 is found in cardiocytes^{3 4} whereas RyR₃ is found in smooth muscle cells⁵ and conductive cardiocytes.⁴ IP₃ receptor has been detected in small amounts in the heart by immunofluorescence and in situ hybridization.^{6 7} Purkinje myocytes of conductive tissues contain a much higher IP₃ receptor level than atrial or ventricular myocytes.⁶

Cardiac expression of SERCA and RyR is regulated during physiological and pathological cardiac growth.^{8 9} In animal models, severe compensated hypertrophy secondary to pressure overload is accompanied by large decreases in SR Ca²⁺-ATPase mRNA and protein levels.^{10 11 12 13 14 15 16 17 18} A low level of SERCA 2 mRNA is also observed in the ventricular myocardium of rats exhibiting signs of cardiac failure.¹⁹ Furthermore, decrease in SERCA gene expression is associated with decreased SR Ca²⁺ uptake.^{10 15 18} However, in rats with moderate (20% to 30%) cardiac hypertrophy, the level of SERCA 2 mRNA or protein was unaltered or upregulated.^{10 14 18 19 20} Data concerning SR protein gene expression in human myocardium are controversial. In failing versus nonfailing myocardium, SR Ca²⁺ pump activity is either unchanged or reduced, and SERCA 2 mRNA or protein levels are decreased or unchanged.^{21 22 23 24 25}

Changes in RyR expression have also been described during development of cardiac hypertrophy and failure. A decreased number of high-affinity Ryanocline binding sites are observed in compensatory cardiac hypertrophy in the rat, guinea-pig, and ferret,²⁶ and in canine heart failure.^{27 28} In rat cardiac hypertrophy, the decrease in RyR2 mRNA and protein levels and the number of high-affinity binding sites are closely correlated to the length and severity of the pressure overload²⁹ ; however, no significant changes in RyR2 mRNA level or ryanodine binding were observed in other models.^{16 30} In failing human hearts, RyR2 mRNA level is decreased in various types of cardiopathies³¹ but unchanged in dilated cardiopathy.³² Decrease in ryanodine receptor mRNA level is correlated with decreased SERCA 2 and phospholamban mRNA levels, suggesting that these genes are coordinately regulated and that they are inversely correlated to the level of ANF²⁰ and IP₃R mRNAs.³¹ In contrast, RyR2 protein level and the number of high-affinity Ryanocline binding sites were similar in nonfailing and failing human hearts.³² Thus, as for SERCA 2, data concerning the expression of RyR2 in human cardiopathy are conflicting. In animal models, however, severe compensated hypertrophy is generally associated with a decrease in the expression of SERCA 2 and RyR2.

Because previous qualitative analysis³³ has clearly demonstrated that the response of ventricular myocytes to pressure overload is heterogeneous and not spatially coordinated, we investigated the cellular distribution of Ca²⁺ pumps and Ca²⁺ release channels during development of rat cardiac hypertrophy secondary to coarctation of the ascending aorta, a model where SERCA 2 and RyR2 gene expression were undoubtedly reduced.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Animals
Pressure overload of the left ventricle (LV) was produced in 3-week-old rats by coarctation of the ascending thoracic aorta (AS) as described.³³ One day, 5 days, and 1 month later, operated and sham-operated (Sh) animals were killed by pentobarbital injection and the hearts were dissected and weighed. Animals did not have dyspnea, pulmonary edema, or ascites, and the weight of right ventricle was unchanged indicating that they did not develop cardiac failure. Part of the heart was frozen in liquid nitrogen and used for RNA preparation, part was used for in situ studies.

Complementary DNA Probes
SERCA 2a, 2b, and 3 probes were constructed as described previously.¹ The common SERCA 2(a+b) probe corresponds to nucleotides +2616 to 3120.³⁴ IP₃R and RyR probes were prepared by reverse transcriptase–polymerase chain reaction (RT-PCR) amplification using 10 µg of total RNA from rat brain (IP₃R) or rat heart RNA (RyR2). The sequence of the amplified fragments were confirmed using USB sequencing kit (Sequenase, Amersham). They correspond to nucleotide + 4 to 336³⁵ and 8604 to 9144,³ respectively, of the sequences previously published. The sequence of the RyR2 probe is presented below. It corresponds to the rabbit cardiac ryanodine receptor isolated by Otsu et al,³ except for few nucleotide changes (underlined), some of them leading to amino acid substitutions: 8603[ACCATCCTCTG CTGGTACCCTAT]GACACACTGACAGCCAAGGAGAAAGCCAAGGACAGAGAAAAGGCCCAGGAC- ATCTTCAAGTTCCTACAGATCAGTGGTTATGCTGTATCCAGAGGGTTCAAGGACCTGGATCTGGACACACCTTCCATTGAGAAGCGATTTGCCTACAGTTTCCTGCAGCAGCTGATCCGAT- ATGTGGACGAGGCCCATCAGTACATCCTGGAGTTTGACAGTGGCAGCAGAAGCAAAGGAGAGCATTTCCCGTACGAGCAAGAGATCAAGTTCTTCGCCAAAGTTGTTCTTCCTTTAATTG- ATCAGTATTTCAAAAACCATCGCCTGTACTTCTTGTCTGTCGCAAGCAGGCCTCTTTGCACCGGAGGGCATGCGTCCAACA- AGGAGAAGGAGATGGTTACAAGCCTGTTCTGCAAACTTGGAGTTCTTGTCAGGCATAGGATTCCACTGTTTGGGAATGATGCTACCTCAATTGTGAACTGTCTTCATATTTTGGGTCAGACTTTG[GATGCAAGGACTGTGATGAAG]. The primers used in RT-PCR are in brackets.

cRNA Probes
Complementary RNA probes were transcribed in vitro from HindIII (SERCA 2a and 2b) and BamHI (IP₃R) linearized plasmids in the presence of T3 RNA polymerase or from XhoI (RyR2) and HindIII (SERCA 3) linearized plasmids in the presence of T7 RNA polymerase and (³⁵ S)-UTP (1000 Ci/mmol; Amersham). All probes were diluted to a final specific activity of about 60 000 cpm/mL as described.^{1 33}

Immunolabeling
SERCA 2a polyclonal antibodies (gift from Dr F. Wuytack) were as described previously.³⁶ The anti-chicken pectoralis RyR monoclonal antibody (MA3-925) was obtained from ABR, Inc (Golden, Colorado). Consecutive serial ventricular cryosections (5-µm thick, fixed as in next section) were incubated for 90 minutes at room temperature with a-SERCA 2a (1/150) and a-RyR (1/150). After 3 washings, the sections were incubated with a 30-fold dilution of Texas red conjugated anti-rabbit Igs and FITC conjugated anti-mouse Igs (Amersham). The sections were mounted in mounting medium for immunofluorescence (Fluoprep, BioMérieux) and analyzed using an epifluorescence microscope (Leica).

In Situ Hybridization
Rat hearts were divided transversally in 2 fragments, fixed in 2% paraformaldehyde (PFA) diluted in PBS for 2 hours at 4°C, washed in PBS plus 30% sucrose for 4 hours at 4°C, embedded in OCT (RUA), and frozen in liquid nitrogen–precooled isopentane. Serial cryosections (5-µm thick) were fixed in 4% PFA for 5 minutes, dehydrated in ethanol, and stored at -70°C with dessicant until use.

In situ hybridization conditions were as previously described.^{1 33} After prehybridization, 7 µL of hybridization mixture was applied to each section. Alternate serial sections were incubated with SERCA 2a, 2b, and 3; RyR2; and IP₃R probes at 50°C overnight. After washings, RNase A treatment (20 µg/mL at 37°C for 30 minutes), and dehydration, the slides were immersed in Kodak NTB2 Nuclear track emulsion (Eastman Kodak) and autoradiographed. Sections were developed after 15 days in Kodak D19, mounted, and examined by light- and dark-field illumination.

Quantification of In Situ Hybridization Signals
Dark-field images magnified 100-fold were recorded as their light-field equivalent using a CCD videocamera (Hamamatsu C2400) and a computer (Power MacIntosh) equipped with Optilab software (Graphtek). All slides were recorded under identical microscope lighting and camera settings, coded for unbiased blind analysis, and stored on zip disks. After recall, the hybridization signals appeared on the monitor as white grains. The ³⁵ S-sensitized emulsion generated very homogeneous grains with surfaces of 2 to 5 pixels. The computer was instructed to count only perfectly white pixels (level >245 on a black to white scale from 0 to 256). A unit area of 300 pixels, corresponding to 1 myocyte, was arbitrarily selected for quantification of the white grains. The counts were thus recorded as "white pixel per myocyte" (wpm) and are expressed in arbitrary units (AU). Minimums of 50 cells per field and 8 fields were randomly selected to cover most of the myocytes of the LV. A unit area of 150 pixels was selected for quantification of the grain density within the coronary artery media; a minimum of 4 measures per vessel was recorded. Measurements were made in duplicate on serial nonconsecutive sections. Background was obtained by numerous wpm measurements in areas free of either myocytes or smooth muscle cells.

RNase Protection and RT-PCR Analysis
Total RNA from rat LV was extracted by the RNA-quick procedure (Bioprobe). Ten µg of total RNA was used for RNase protection analyses, which were performed according to the Ambion (Clinisciences) protocol and as described previously.¹ Each experiment included a control reaction in which total RNA was replaced by 10 µg of yeast tRNA.

Firststrand cDNA synthesis was performed on 5 µg of total RNA from LV of Sh and AS and 1 µg of RNA from brain using random hexamers at 42°C. Amplification was performed with an initial step of 120 seconds at 95°C and 40 cycles of 20 seconds each at 95°C, 30 seconds at 60°C and 30 seconds at 72°C, and a final step of 7 minutes at 72°C using oligonucleotides common to all IP₃R types as described.³⁷ The PCR products were resolved in triplicates on 8% acrylamide gels, transferred to nylon membranes, and hybridized with ³²P-labeled oligonucleotides specific for each isoform, as in Perez et al.³⁷

Slot-Blot Analysis
Eight, 4, and 2 µg of total RNA were denatured and spotted onto the nylon membrane using a minifold apparatus (Schleicher & Schuell, Inc) After UV cross-linking, the membranes were prehybridized and hybridized with ³²P-labeled SERCA 2(a+b) and RyR2 probes as in De la Bastie et al.¹⁰ After dehybridization, a 24-mer oligonucleotide complementary to the rat 18S ribosomal RNA (³²P-labeled using ³²P-ATP and polynucleotide kinase) was hybridized in the absence of formamide to the same membrane.¹⁰ After hybridization and washing, the membrane was exposed to x-ray film for 1 to 4 days.

Statistical Analysis
For each sample, the densitometric values obtained for the SERCA 2a and 2b and RyR2 probes were divided by the densitometric values obtained with the 18S oligonucleotide. The ratio was determined for various amounts of RNA loaded and the values were expressed as mean±SE. Differences between independent samples were tested for significance by a nonparametric transformation of the unpaired t test: the Mann-Whitney U test.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Specificity of the Probes
The specificity of SERCA 2a, 2b, and 3 cRNA probes has already been described.¹ The specificity of RyR2 and IP₃R probes was determined by RNase protection and RT-PCR (Figure 1). The same 2 bands were observed in all samples by RNase protection analysis, the upper band corresponded to type 1 IP₃R and the second band to another isoform which could be type 2 or 3 (Figure 1A). RT-PCR analysis indicated that IP₃R-1 and -2 (Figure 1B) were both expressed in the heart but type 3 was not (not shown). These data indicated that IP₃R-1 is the major isoform expressed in the heart, as recently described.³⁷ No major change in the relative proportion of each isoform was observed in hypertrophy. The RyR2 probe hybridized to only 1 band of the expected size in cardiac mRNA. High levels of RyR2 mRNA were detected in the heart and only a faint signal was present in aorta (Figure 1C).

View larger version (61K): [in this window] [in a new window]   Figure 1. Specificity of the probes. RNase protection with IP3R (A) and RyR2 probes hybridized to 10 µg of total RNA from various tissues, Sh and AS hearts, and yeast tRNA hybridized. Probe indicates the position of the undigested probe. In A, sequencing reaction (GATC) was used as molecular weight marker. The left part (sequence, probe, brain) was exposed for 24 hours, whereas the right part (heart samples) was exposed for 1 week. C is intentionally overexposed to demonstrate that the RyR2 probe is specific for cardiac tissue. B, Southern-blot analysis of RT-PCR products obtained with oligonucleotides common to all 3 IP3R mRNA isoforms. Blot was hybridized with oligonucleotides specific for IP3R type 1 and 2 isoforms37 and exposed to the screen of a phosphorimager for 72 hours. H-, cardiac RNA without reverse transcriptase.

Quantitative Changes in SERCA 2 and RyR2 Expression in Rat Heart Subjected to a Sudden Pressure Overload
LV hypertrophy was determined as the ratio LV weight:body weight in operated versus Sh animals. As noted previously,^{33 38} coarctation of the ascending aorta in young rat induced a rapid (16.5±3.2% at day 1; 40.4±8.1% at day 5) and severe cardiac hypertrophy (116.3±8.1% after 1 month). One month after surgery, SERCA 2(a+b) and RyR2 mRNA levels were 60% and 40% lower in AS than in Sh animals (AS, n=5; Sh, n=4; P<0.01); this confirmed our previous data.^{10 29} Interestingly, the SERCA 2(a+b) and RyR2 mRNA levels were significantly higher than control values by day 1 (AS, n=4; Sh, n=6; P<0.05), but on day 5, the relative expression of both transcripts in the experimental group were close to the control values (AS, n=4; Sh, n=4; NS) (Figure 2).

View larger version (33K): [in this window] [in a new window]   Figure 2. A, Slot-blot containing 3 different concentrations of total RNA from Sh and AS of 1 day and 1 month and RNA from liver (L) and tensor fascia latae (TFL) hybridized successively with SERCA 2, RyR2, and 18S probes. B, SERCA 2 and RyR2 mRNA levels (derived from the slot-blot analysis) at 1 day (n=4 for AS and n=6 for Sh), 5 days (n=4 for AS and n=4 for Sh), and 1 month (n=5 for AS and n=4 for Sh) after aortic banding. For each of the 3 groups of animals, the values represent the percentage of the mean value obtained for the age-matched Sh animals. Values are expressed as mean±SEM. *P<0.05; **P<0.01 versus Sh.

Qualitative Changes in SERCA 2a and RyR2 mRNA Distribution During Development of Cardiac Hypertrophy
³⁵ S-labeled SERCA 2a and RyR2 probes gave strong hybridization signals in striated ventricular myocytes of controls (Figures 3A: a, b). One (Figure 3A: c, d) and 5 days (Figure 3A: e, f) after surgery, SERCA 2a and RyR2 mRNAs were found in most cardiomyocytes, although the distribution of SERCA 2a was heterogeneous in the LV but not in the right ventricle (not shown) or atrium. One month after surgery, substantial changes in the hybridization pattern were observed in the hypertrophied LV (Figure 3A: g, h; Figure 4). The hybridization signals with SERCA 2a and RyR2 probes were weaker in the hypertrophied LV than in the normal one (Figure 3A: g, h versus a, b). Labeled sense sequences synthesized in vitro from the same plasmids gave only background (Figure 3B). In AS (versus Sh), SERCA 2a mRNA level was markedly decreased in both left atrium and ventricle (Figure 4b versus 4a); it was higher in the right than in the left ventricle of AS (Figure 4).

View larger version (104K): [in this window] [in a new window]   Figure 3. Nonconsecutive serial sections of rat hearts from Sh (a, b), and AS 1 day (c, d), 5 days (e, f), and 1 month (g, h) after operation were hybridized with SERCA 2a (a, c, e, and g), RyR2 (b, d, f, and h) antisense cRNA probes (A) and with sense (B) SERCA 2a (a) and RyR2 (b) probes. The distribution of SERCA 2a and RyR2 mRNAs 1 day and 5 days after surgery is similar to that of Sh animals in atrium (A) but in the left ventricle (LV), the hybridization signals appears lower in some areas. One month after AS, the SERCA 2a and RyR2 mRNA levels are substantially decreased throughout the LV. Magnification x12.

View larger version (157K): [in this window] [in a new window]   Figure 4. Expression of SERCA 2a mRNA in the atria (A), right (RV) and left ventricle (LV) of rat 1 month after AS. Compared with Sh (a, c), the SERCA 2 mRNA level is decreased in AS (b, d). However, hybridization signal is higher in the right than in the left ventricle (d). Note also the decreased SERCA 2a mRNA level in the left atrium (b). Magnification x12.

At higher magnification, SERCA 2a mRNA signal in AS appeared to vary from cell to cell (Figure 5C and 5G), whereas the distribution of RyR2 mRNA appeared as small dots homogeneously distributed in the myocardium (Figure 5D). The RyR2 distribution was similar to that reported by Go et al.³¹

View larger version (137K): [in this window] [in a new window]   Figure 5. Dark-field image of normal (A, B, E, F) and hypertrophied myocardium 1 month after AS (C, D, G, H) hybridized with SERCA 2a (A, C, E, G) and RyR2 (B, D) cRNA probes. F and H, Interferential contrast of E and G, respectively. Note that SERCA 2a hybridization signal varies between myocytes in both longitudinal (C) and transverse (G) sections. In contrast, RyR2 signal is equally decreased throughout the myocyte population. Some myocytes appeared almost free of SERCA 2 mRNA (arrowhead) compared with neighboring myocytes (small arrow) Magnification x100.

The amount of SERCA 2a and RyR2 mRNAs within the myocyte population was precisely analyzed at 1 month after surgery. The frequency histogram shows that in AS and Sh animals, the myocyte population follows a gaussian distribution as a function of mRNA concentration (Figure 6). The histogram of AS myocytes was significantly shifted toward lower values. As a result, myocytes containing high amount of SERCA 2a mRNA (140<wpm<210), which represented 45% of the population, decrease to <5% 1 month after AS. A similar leftward shift of frequency histogram was observed for RyR2 mRNA. Therefore, the mean hybridization signal per cell for SERCA 2a and RyR2 mRNAs decreased, respectively, from 123±22 wpm and 139±12 wpm in Sh animals to 80±8 wpm and 76±10 wpm in the AS myocytes (P<0.05, n=3 animals).

View larger version (31K): [in this window] [in a new window]   Figure 6. Effect of pressure overload on SERCA 2a and RyR2 mRNA content in the cardiomyocyte population. Frequency histograms displaying the percentage of myocytes with various amounts of white pixels per myocyte (wpm) after in situ hybridization with either SERCA 2a or RyR2 35S-cRNA. Values are mean±SEM of 3 to 4 animals in each group. The percentage of myocytes expressing few or no (<80 AU) SERCA 2a and RyR2 mRNA is significantly higher in hypertrophied cardiomyocytes than in controls (P<0.001, 2 test).

SERCA 2a and RyR protein distribution was assessed with specific antibodies (Figure 7): RyR2 (Figure 7a and 7d) and SERCA 2 (Figure 7b and 7e) were found mainly in the cardiomyocytes. SERCA 2a was markedly heterogeneous in AS myocardium, with little signal being detected in some myocytes (Figure 7e). The amount of RyR2 was greatly decreased in AS hearts compared with controls but the distribution remained homogeneous (Figure 7a and d). Only background signal was observed when the first specific antibodies were omitted (Figure 7g and 7h).

View larger version (201K): [in this window] [in a new window]   Figure 7. LV sections of Sh animals (a through c) and rats 1 month after AS (d through f). Double-immunolabelings with anti-RyR2 (a, d) and anti-SERCA 2a (b, e) antibodies and interferential phase contrast (c, f). Note the absence of label in the vessels and the marked decrease in the amount of SERCA 2a and RyR2 protein in AS. Arrows point to 2 consecutive cardiocytes from AS animals with various amounts of SERCA 2a and identical amounts of RyR. In absence of a-SERCA 2a (g) and a-RyR2 (h) antibodies, only low background and elastic lamina brightness was observed. Magnification x400.

Changes in SERCA 2a mRNA and RyR2 mRNA Levels Were Not Associated With Changes in SERCA 2b, SERCA 3, and IP₃R During Development of Cardiac Hypertrophy
Using in situ hybridization, we observed that SERCA 2b mRNA was equally present in cardiocytes from Sh and AS at 1 month after surgery, whereas a 4-fold increase was observed in the coronary arteries from AS (P<0.01 versus Sh) (Figures 8a, 8b, and 9a). IP₃R mRNA was more abundant in vessels (75 AU) than in myocytes (20 AU), as previously described.^{4 6} No change was observed at 1 month after AS in IP₃R mRNA abundance (Figures 8c, 8d, and 9b). In both Sh and AS, SERCA 3 mRNA was only detected in coronary endothelial cells (Figure 8e and 8f).

View larger version (202K): [in this window] [in a new window]   Figure 8. Nonconsecutive serial sections of left ventricles of Sh rats (a, c, e) and rats studied 1 month after AS (b, d, f), hybridized with SERCA 2b (a, b), IP3R (c, d), and SERCA 3 (e, f) cRNA probes. In Sh animals, SERCA 2b and IP3R mRNAs are ubiquitously distributed, whereas SERCA 3 mRNA is detected in the intimal layer of the coronary artery. Note that SERCA 2b level is increased only in the coronary artery. Magnification x150.

View larger version (37K): [in this window] [in a new window]   Figure 9. SERCA 2b and IP3R mRNA levels in coronary arteries and cardiomyocytes from Sh and AS rats, 1 month after surgery. The abundance of specific mRNA was measured as described in Methods. Values are expressed in AU as mean±SE from 3 to 4 animals per group.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The major finding of the present study is that the decrease in SERCA 2a mRNA and protein levels is heterogeneous throughout the hypertrophied LV myocardium. The decrease in SERCA 2a mRNA level was substantial in some myocytes (Figures 5 and 6) and was associated with a disappearance of the protein (Figure 7), whereas in other cells both protein and mRNA were abundant. Differences in SERCA 2a level between myocytes were observed throughout the entire LV, suggesting that not only an increase in transmural pressure but also humoral factors may be involved in the down-regulation of SERCA 2 gene expression. The disparity of neighboring cardiomyocytes either expressing or not expressing SERCA 2a may be deleterious for myocardial function because it could lead to different relaxation properties of myocytes. Indeed, recent data obtained on transgenic animals³⁹ and isolated cardiocytes^{40 41} overexpressing SERCA 2 confirms the key role of this enzyme in cardiac function. SERCA 2 overexpression results in (1) increase in rate of the Ca²⁺ transient decline and of cardiocyte relaxation indicating faster decrease in cytosolic Ca²⁺ concentration, (2) increase in rate of myocyte shortening and of development of left ventricular pressure indicating faster Ca²⁺ release, and (3) shortening of the time to half maximum postrest potentiation, indicating faster rate of SR Ca²⁺ loading. In pressure overload–induced hypertrophy, prolonged myocardial relaxation has been demonstrated at the level of muscle fibers^{18 42} or isolated myocytes¹⁷ and was associated with reduced SERCA expression. On the other hand, SR function has been measured on total hearts and isolated cells in a similar model of hypertrophy.^{18 43} Surprisingly, the Ca²⁺ balance in isolated hypertrophied cells was normal when normalized to cell volume,⁴³ despite significant changes in myocardial relaxation and depressed SERCA 2 gene expression and Ca²⁺ uptake rate measured on muscle.¹⁸ The authors pointed out that isolated cells might be the best survivors of the isolation procedure and represent a population of well-compensated cells with normal Ca²⁺ balance that may not represent the total cell population.⁴³ Reduced contractility, alteration of the Ca²⁺ transient and of the ability of the Ca²⁺ current to trigger Ca²⁺ release, was also reported in strains of genetically hypertensive rats and in rats with heart failure.³⁰ Because the density, or Ca²⁺ sensitivity, of RyR was unaltered in these particular models, the authors proposed that alteration of E-C coupling was due to changes in the relation between the RyR and the plasma membrane Ca²⁺ channel.³⁰ In fact, all these alterations, including cell-to-cell heterogeneity, are likely to reflect different stages of the progression from moderate compensated hypertrophy to heart failure.

In our model of cardiac hypertrophy, we showed that the decrease in expression of SERCA 2a and RyR2 is a late event which is preceded by a transient increase (1 day) in the 2 specific mRNAs when the cardiac hypertrophy had not yet developed (Figure 2). This alteration in gene expression might be a nonspecific response due to global activation of the cardiac genome at the onset of adaptive response to overload as previously suggested for other gene products.⁴⁴ However, such an increase in calcium-handling proteins has also been observed rapidly after an ischemic injury in the rat heart, suggesting that other regulatory processes might be involved.⁴⁵ Five days after surgery, we observed that the level of SERCA 2 and RyR2 mRNAs return to basal level. Interestingly, a transient decrease in transcript level has also been observed for genes such as ANF and ß-MHC 5 to 7 days after surgery.⁴⁴ Afterward, when the upregulation of these genes that are considered as markers of hypertrophy is sustained, the expression of SERCA 2 and RyR2 mRNAs is still repressed. The amplitude of the decrease in SERCA 2 and RyR2 mRNA levels is similar to that previously observed in other models of cardiac hypertrophy in the rat and Syrian hamsters. The reduction in SERCA 2 and RyR2 expression is only relative and probably reflects a nonactivation of the genes which do not follow the global increase in gene expression leading to hypertrophy. In some studies,^{18 19} reduction in SERCA mRNA levels, observed only 4 to 5 months after surgery, was considered a molecular marker for impaired cardiac performance during the transition from compensated hypertrophy to failure. In our study, cardiac hypertrophy developed more rapidly as it reached 116.3% 1 month after surgery, (although the animals did not exhibit evident clinical signs of cardiac failure). The apparent discrepancy may be due to differences in the degree of coarctation and/or duration of the overload.

Another important finding of the present study is that the late downregulation of SERCA 2a mRNA within cardiomyocytes was not compensated by an increased expression of SERCA 2b or SERCA 3. In addition, the IP₃R mRNA level was low and was unchanged in hypertrophy, indicating that the decrease in RyR2 mRNA level was also not compensated by upregulation of IP₃R. These results are in contrast to those of Go et al,³¹ demonstrating that in failing human hearts the 2 intracellular Ca²⁺ release channels are regulated in opposite directions with decrease in RyR mRNAs being accompanied by IP₃R mRNA increase. Moreover, we did not find any difference in the relative levels of the 2 IP₃R isoforms between Sh and AS animals. Therefore, the increase in IP₃R mRNA level previously observed³¹ may be a characteristic of human heart failure.

Finally, the data indicated an increase in SERCA 2b mRNA level in the coronary arteries at 1 month after surgery. The enhanced expression of a ubiquitous SERCA 2 isoform can be related to a shift toward more immature phenotype of smooth muscle cells as previously suggested.⁴⁶ The change in SERCA 2b expression in vessels, however, was not associated with an alteration in IP₃R mRNA level.

In summary, the present study indicates that the pressure overload–induced decrease of SERCA 2a and RyR2 mRNA levels is a late event and a heterogeneous process. The reduction in cardiocytes expression of the main Ca²⁺ pump and Ca²⁺ release channel is not compensated by the induction of the other minor components (SERCA 2b, SERCA 3, IP₃R). This is consistent with the concept that the decrease in SR Ca²⁺ -ATPase and Ca²⁺ release channel levels are involved in the alteration of the excitation-contraction coupling.

	Acknowledgments

 
The authors are grateful to Dr F. Wuytack (Laboratorium Voor Fysiologie, KUL Campus Gasthuisberg, Leuven, Belgium) for the gift of the a-SERCA 2a antibody. Marielle Anger was a recipient of the Groupe de Réflexion sur la Recherche Cardiovasculaire-Bristol Meyer Squibb. The work has been performed with the support of European Union (BIOMED), Fondation de France, Fondation pour la Recherche Médicale, and Association Française contre les Myopathies.

Received January 29, 1998; revision received July 2, 1998; accepted July 11, 1998.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Anger M, Samuel JL, Marotte F, Wuytack F, Rappaport L, Lompré A-M. In situ mRNA distribution of sarco(endo)plasmic reticulum Ca²⁺-ATPase isoforms during ontogeny in the rat. J Mol Cell Cardiol. 1994;26:539–550.[Medline] [Order article via Infotrieve]

2. Anger M, Samuel JL, Marotte F, Wuytack F, Rappaport L, Lompré A-M. The sarco(endo)plasmic reticulum Ca²⁺-ATPase mRNA isoform, SERCA 3, is expressed in endothelial and epithelial cells in various organs. FEBS Lett. 1993;334:45–48.[Medline] [Order article via Infotrieve]

3. Otsu K, Willard HF, Khanna VK, Zorzato F, Green NM, MacLennan DH. Molecular cloning of cDNA encoding the Ca²⁺ release channel (ryanodine receptor) of rabbit cardiac muscle sarcoplasmic reticulum. J Biol Chem. 1990;265:13472–13483.[Abstract/Free Full Text]

4. Gorza L, Vettore S, Volpe P, Sorrentino V, Samuel JL, Anger M, Lompré A-M. Cardiac myocytes differ in mRNA composition for sarcoplasmic reticulum Ca²⁺ channels and Ca²⁺ pumps. In: Cardiac Growth and Regeneration. The Annals of the New-York Academy of Sciences. New York, NY: W.C. Claycomb & P. diNardo; 1995;752:141–148.

5. Hakamata Y, Nakai J, Takeshima H, Imoto K. Primary structure and distribution of a novel ryanodine receptor calcium release channel from rabbit brain. FEBS Lett. 1992;312:229–235.[Medline] [Order article via Infotrieve]

6. Gorza L, Schiaffino S, Volpe P. Inositol 1,4,5-trisphosphate receptor in heart: evidence for its concentration in Purkinje myocytes of the conduction system. J Cell Biol. 1993;121:345–353.[Abstract/Free Full Text]

7. Moschella MC, Marks AR. Inositol 1,4,5-trisphosphate receptor expression in the cardiac myocytes. J Cell Biol. 1993;120:1137–1146.[Abstract/Free Full Text]

8. Arai M, Matsui H, Periasamy M. Sarcoplasmic reticulum gene expression in cardiac hypertrophy and heart failure. Circ Res. 1994;74:555–564.[Free Full Text]

9. Lompré A-M, Anger M, Levitsky D. Sarco(endo)plasmic reticulum calcium pumps in the cardiovascular system: function and gene expression. J Mol Cell Cardiol. 1994;26:1109–1121.[Medline] [Order article via Infotrieve]

10. De la Bastie D, Levitsky D, Rappaport L, Mercadier JJ, Marotte F, Wisnewsky C, Brovkovich V, Schwartz K, Lompré AM. Function of the sarcoplasmic reticulum and expression of its Ca²⁺-ATPase gene in pressure overload-induced cardiac hypertrophy in the rat. Circ Res. 1990;66:554–564.[Abstract/Free Full Text]

11. Buttrick PM, Kaplan M, Leinwand LA, Scheuer J. Alterations in gene-expression in the rat-heart after chronic pathological and physiological loads. J Mol Cell Cardiol. 1994;26:61–67.[Medline] [Order article via Infotrieve]

12. Anger M, Lambert F, Chemla D, Desché P, Scalbert E, Lompré A-M, Lecarpentier Y. Sarcoplasmic reticulum Ca²⁺ pumps in heart and diaphragm of cardiomyopathic hamster: effects of perindopril. Am J Physiol. 1995;268:H1947–H1953.[Abstract/Free Full Text]

13. Kiss E, Ball NA, Kranias G, Walsh RA. Differential changes in cardiac phospholamban and sarcoplasmic reticular Ca²⁺ ATPase protein levels. Effect on Ca²⁺ transport and mechanics in compensated pressure-overload hypertrophy and congestive heart failure. Circ Res. 1995;77:759–764.[Abstract/Free Full Text]

14. Rockman HA, Ono S, Ross RS, Jones LR, Karimi M, Bhargava V, Ross J, Chien KR. Molecular and physiological alterations in murine ventricular dysfunction. Proc Natl Acad Sci U S A. 1994;91:2694–2698.[Abstract/Free Full Text]

15. Matsui H, MacLennan DH, Alpert NR, Periasamy M. Sarcoplasmic reticulum gene expression in pressure overload-induced cardiac hypertrophy in rabbit. Am J Physiol. 1995;268: C252–C258.

16. Assayag P, Charlemagne D, de Leiris J, Boucher F, Valère P-E, Lortet S, Swynghedauw B, Besse S. Senescent heart compared with pressure overload-induced hypertrophy. Hypertension. 1997;29:15–21.[Abstract/Free Full Text]

17. Tsutsui H, Ishibashi Y, Imanaka-Yoshida K, Yamamoto S, Yoshida T, Sugimachi M, Urabe Y, Takeshita A. Alterations in sarcoplasmic reticulum calcium-storing proteins in pressure-overload cardiac hypertrophy. Am J Physiol. 1997;272:H168–H175.[Abstract/Free Full Text]

18. Qi M, Shannon TR, Euler DE, Bers DM, Samarel AM. Downregulation of sarcoplasmic reticulum Ca²⁺ -ATPase during progression of left ventricular hypertrophy. Am J Physiol. 1997;272:H2416–H2424.[Abstract/Free Full Text]

19. Feldman AM, Weinberg EO, Ray PE, Lorell BH. Selective changes in cardiac gene-expression during compensated hypertrophy and the transition to cardiac decompensation in rats with chronic aortic banding. Circ Res. 1993;73:184–192.[Abstract]

20. Arai M, Suzuki T, Nagai R. Sarcoplasmic reticulum genes are upregulated in mild cardiac hypertrophy but downregulated in severe cardiac hypertrophy induced by pressure overload. J Mol Cell Cardiol. 1996;28:1583–1590.[Medline] [Order article via Infotrieve]

21. Hasenfuss G, Reinecke H, Studer R, Meyer M, Pieske B, Holtz J, Holubarsch C, Posival H, Just H, Drexler H. Relation between myocardial function and expression of sarcoplasmic reticulum Ca²⁺-ATPase in failing and nonfailing human myocardium. Circ Res. 1994;75:434–442.[Abstract/Free Full Text]

22. Schwinger RHG, Böhm M, Schmidt U, Karczewski P, Bavendick U, Flesch M, Krause EG, Erdmann E. Unchanged protein levels of SERCA II and phospholamban but reduced Ca²⁺ uptake and Ca²⁺-ATPase activity of cardiac sarcoplasmic reticulum from dilated cardiomyopathy patients compared with patients with nonfailing hearts. Circulation. 1995;92:3220–3228.[Abstract/Free Full Text]

23. Arai M, Alpert NR, MacLennan D, Barton P, Periasamy M. Alterations in sarcoplasmic reticulum gene expression in human heart failure: a possible mechanism for alterations in systolic and diastolic properties of the failing myocardium. Circ Res. 1993;72:463–469.[Abstract/Free Full Text]

24. Mercadier JJ, Lompré AM, Duc P, Boheler KR, Fraysse JB, Wisnewsky C, Allen PD, Schwartz K. Altered sarcoplasmic reticulum Ca²⁺-ATPase gene expression in the human ventricle during end-stage heart failure. J Clin Invest. 1990;85:305–309.

25. Link B, Boknik P, Eschenhagen T, Müller FU, Neumann J, Nose M, Jones LR, Schmitz W, Scholz H. Messenger RNA expression and immunological quantification of phospholamban and SR Ca²⁺-ATPase in failing and nonfailing human hearts. Cardiovasc Res. 1996;31:625–632.[Medline] [Order article via Infotrieve]

26. Rannou F, Sainte Beuve C, Oliviero P, Do E, Trouvé P, Charlemagne D. The effects of compensated cardiac hypertrophy on dihydropyridine and ryanodine receptors in rat, ferret and guinea-pig hearts. J Mol Cell Cardiol. 1995;27:1225–1234.[Medline] [Order article via Infotrieve]

27. Cory CR, McCutcheon LJ, O'Grady M, Pang AW, Geiger JD, O'Brien PJ. Compensatory downregulation of myocardial Ca²⁺ channel in SR from dogs with heart failure. Am J Physiol. 1993;264:H926–H937.[Abstract/Free Full Text]

28. Vatner DE, Sato N, Kiuchi K, Shannon RP, Vatner SR. Decrease in myocardial ryanodine receptors and altered excitation-contraction coupling early in the development of heart failure. Circulation. 1994;90:1423–1430.[Abstract/Free Full Text]

29. Rannou F, Dambrin G, Marty I, Carré F, Trouvé P, Lompré AM, Charlemagne D. Expression of the cardiac ryanodine receptor in the compensated phase of hypertrophy in the rat. Cardiovasc Res. 1996;32:258–265.[Abstract/Free Full Text]

30. Gomez AM, Valdivia HH, Cheng H, Lederer MR, Santana LF, Cannell MB, McCune SA, Altschuld RA, Lederer WJ. Defective excitation-contraction coupling in experimental cardiac hypertrophy and heart failure. Science. 1997;276:800–806.[Abstract/Free Full Text]

31. Go LO, Moschella MC, Watras J, Handa KK, Fyfe BS, Marks A. Differential regulation of two types of intracellular calcium release channels during end-stage heart failure. J Clin Invest. 1995;95:888–894.

32. Brillantes AM, Allen PD, Takahashi T, Izumo S, Marks A. Differences in cardiac calcium release channel (ryanodine receptor) expression in myocardium from patients with end-stage heart failure caused by ischemic versus dilated cardiomyopathy. Circ Res. 1992;71:18–26.[Abstract/Free Full Text]

33. Schiaffino S, Samuel JL, Sassoon D, Lompré A-M, Garner I, Marotte F, Buckingham M, Rappaport L, Schwartz K. Non synchronous accumulation of -skeletal actin and ß-myosin heavy chain during the early stages of pressure-overload-induced cardiac hypertrophy demonstrated by in situ hybridization. Circ Res. 1989;64:937–948.[Abstract/Free Full Text]

34. Lompré AM, De la Bastie D, Boheler KR, Schwartz K. Characterization and expression of the rat heart sarcoplasmic reticulum Ca²⁺-ATPase mRNA. FEBS Lett. 1989;249:35–41.[Medline] [Order article via Infotrieve]

35. Mignery GA, Newton CL, Archer BT III, Südhof TC. Structure and expression of the rat inositol 1, 4, 5-trisphosphate receptor. J Biol Chem. 1990;265:12679–12685.[Abstract/Free Full Text]

36. Eggermont J, Wuytack F, Verbist J, Casteels R. Expression of endoplasmic-reticulum Ca²⁺ pump isoforms and phospholamban in pig smooth muscle tissues. Biochem J. 1990;271:649–653.[Medline] [Order article via Infotrieve]

37. Perez PJ, Ramos-Franco J, Fill M, Mignery GA. Identification and functional reconstitution of the type 2 inositol 1,4,5-trisphosphate receptor from ventricular cardiac myocytes. J Biol Chem. 1997;272:23961–23969.[Abstract/Free Full Text]

38. Samuel JL, Bertier B, Bugaisky L, Marotte F, Swynghedauw B, Schwartz K, Rappaport L. Different distributions of microtubules, desmin filaments, and isomyosins during the onset of cardiac hypertrophy in the rat. Eur J Cell Biol. 1984;34:300–306.[Medline] [Order article via Infotrieve]

39. He H, Giordano FJ, Hilal-Dandan R, Choi D-J, Rockman HA, McDonough PM, Bluhm WF, Meyer M, Sayen MR, Swanson E, Dillmann WH. Overexpression of the rat sarcoplasmic reticulum Ca²⁺ ATPase gene in the heart of transgenic mice accelerates calcium transients and cardiac relaxation. J Clin Invest. 1997;100:380–389.[Medline] [Order article via Infotrieve]

40. Hajjar RJ, Kang JX, Gwathmey JK, Rosenzweig A. Physiological effects of adenoviral gene transfer of sarcoplasmic reticulum calcium ATPase in isolated rat myocytes. Circulation. 1997;95:423–429.[Abstract/Free Full Text]

41. Giordano FJ, He H, McDonough P, Meyer M, Sayen R, Dillmann WH. Adenovirus-mediated gene transfer reconstitutes depressed sarcoplasmic reticulum Ca²⁺ ATPase levels and shortens prolonged cardiac myocyte Ca²⁺ transients. Circulation. 1997;96:400–403.[Abstract/Free Full Text]

42. Pieske B, Kretschmann B, Meyer M, Holubarsch C, Weirich J, Possival H, Minami K, Just H, Hasenfuss G. Alterations in intracellular calcium handling associated with the inverse force-frequency relation in human dilated cardiomyopathy. Circulation. 1995;92:1169–1178.[Abstract/Free Full Text]

43. Delbridge L, Satoh H, Yuan W, Bassani JWM, Qi M, Ginsburg KS, Samarel AM, Bers DM. Cardiac myocyte volume, Ca²⁺ fluxes, and sarcoplasmic reticulum loading in pressure-overload hypertrophy. Am J Physiol. 1997;272:H2425–H2435.[Abstract/Free Full Text]

44. Lompré AM, Mercadier JJ, Schwartz K. Changes in gene expression during cardiac growth. Int Rev Cytol. 1991;124:137–186.[Medline] [Order article via Infotrieve]

45. Assayag P, Charlemagne D, De Leiris J, Boucher F, Lompré AM, Lortet S, Valère PE, Swynghedauw B, Besse S. Low flow ischemia activates calcium-regulating protein gene expression: influence of age. Cardiovasc Res. 1998;38:169–180.[Abstract/Free Full Text]

46. Samuel JL, Barrieux A, Dufour S, Dubus I, Contard F, Koteliansky V, Farhadian F, Marotte F, Thiéry JP, Rappaport L. Accumulation of fetal mRNAs during the development of rat cardiac hypertrophy induced by pressure overload. J Clin Invest. 1991;88:1737–1746.To determine whether or not the alterations in SERCA and RyR gene expression are homogeneous within the myocardium during the development of hypertrophy, the cellular distribution of mRNAs and proteins encoding the 2 sarco(endo)plasmic reticulum Ca²⁺-ATPase isoforms (SERCA 2a and 2b) and 2 Ca²⁺ release channels (RyR, IP₃R) mRNAs and proteins were analyzed by in situ hybridization and immunofluorescence. The results indicated that in a model of compensated left ventricular hypertrophy, the decrease in accumulation of SERCA 2a in the cardiomyocytes was heterogeneous and was not compensated by a SERCA 2b induction. Decrease in RyR2 expression was more homogeneous and not compensated by increase in IP₃R expression.

This article has been cited by other articles:

				X. Loyer, P. Oliviero, T. Damy, E. Robidel, F. Marotte, C. Heymes, and J.-L. Samuel Effects of sex differences on constitutive nitric oxide synthase expression and activity in response to pressure overload in rats Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H2650 - H2658. [Abstract] [Full Text] [PDF]

				X. Loyer, T. Damy, Z. Chvojkova, E. Robidel, F. Marotte, P. Oliviero, C. Heymes, and J.-L. Samuel 17{beta}-Estradiol Regulates Constitutive Nitric Oxide Synthase Expression Differentially in the Myocardium in Response to Pressure Overload Endocrinology, October 1, 2007; 148(10): 4579 - 4584. [Abstract] [Full Text] [PDF]

				B. M. R. Carvalho, R. A. Bassani, K. G. Franchini, and J. W. M. Bassani Enhanced calcium mobilization in rat ventricular myocytes during the onset of pressure overload-induced hypertrophy Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1803 - H1813. [Abstract] [Full Text] [PDF]

				Y. D. Barac, N. Zeevi-Levin, G. Yaniv, I. Reiter, F. Milman, M. Shilkrut, R. Coleman, Z. Abassi, and O. Binah The 1,4,5-inositol trisphosphate pathway is a key component in Fas-mediated hypertrophy in neonatal rat ventricular myocytes Cardiovasc Res, October 1, 2005; 68(1): 75 - 86. [Abstract] [Full Text] [PDF]

				J. BORLAK and T. THUM Hallmarks of ion channel gene expression in end-stage heart failure FASEB J, September 1, 2003; 17(12): 1592 - 1608. [Abstract] [Full Text] [PDF]

				C. H. George, G. V. Higgs, J. J. Mackrill, and F. A. Lai Dysregulated Ryanodine Receptors Mediate Cellular Toxicity: RESTORATION OF NORMAL PHENOTYPE BY FKBP12.6 J. Biol. Chem., August 1, 2003; 278(31): 28856 - 28864. [Abstract] [Full Text] [PDF]

				S. Bonnet, A. Belus, J.-M. Hyvelin, E. Roux, R. Marthan, and J.-P. Savineau Effect of chronic hypoxia on agonist-induced tone and calcium signaling in rat pulmonary artery Am J Physiol Lung Cell Mol Physiol, July 1, 2001; 281(1): L193 - L201. [Abstract] [Full Text] [PDF]

				L. Zhao, A. Sebkhi, D. J. R. Nunez, L. Long, C. S. Haley, J. Szpirer, C. Szpirer, A. J. Williams, and M. R. Wilkins Right Ventricular Hypertrophy Secondary to Pulmonary Hypertension Is Linked to Rat Chromosome 17 : Evaluation of Cardiac Ryanodine Ryr2 Receptor as a Candidate Circulation, January 23, 2001; 103(3): 442 - 447. [Abstract] [Full Text] [PDF]

				J.-M. HYVELIN, C. MARTIN, E. ROUX, R. MARTHAN, and J.-P. SAVINEAU Human Isolated Bronchial Smooth Muscle Contains Functional Ryanodine/Caffeine-sensitive Ca-Release Channels Am. J. Respir. Crit. Care Med., August 1, 2000; 162(2): 687 - 694. [Abstract] [Full Text] [PDF]

				C. Ruwhof and A. van der Laarse Mechanical stress-induced cardiac hypertrophy: mechanisms and signal transduction pathways Cardiovasc Res, July 1, 2000; 47(1): 23 - 37. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Anger, M. Articles by MD, J.-L. S. Search for Related Content PubMed PubMed Citation Articles by Anger, M. Articles by MD, J.-L. S.