From the Vascular Research Division (J.N.T., G.S., K.R.A., M.A.G.), the Department of Pathology (B.A.S., F.J.S.), and the Cardiovascular Division (J.N.T.), Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, Mass; and from Millennium Pharmaceuticals Inc, Cambridge, Mass (J.C., E.A.W., D.F.). Dr Topper is now in the Cardiovascular Division, Department of Medicine, Stanford University School of Medicine, Stanford, Calif.
Correspondence to James N. Topper MD, PhD, Cardiovascular Division, Department of Medicine, Stanford University School of Medicine, Falk Cardiovascular Research Center, 300 Pasteur Dr, Stanford, CA 94305-5406. E-mail jtopper{at}leland.stanford.edu
| Abstract |
|---|
|
|
|---|
Methods and ResultsWe demonstrate sustained upregulation of a
recently identified gene encoding a human prostaglandin
transporter (hPGT) in cultured human vascular
endothelium exposed to a
physiological fluid mechanical stimulus in vitro.
This biomechanical induction is selective in that steady laminar shear
stress is sufficient to upregulate the hPGT gene at the
level of transcriptional activation, whereas a comparable level of
turbulent shear stress (a nonphysiological
stimulus) is not. Various biochemical stimuli, such as bacterial
endotoxin and the inflammatory cytokines recombinant human interleukin
1ß cytokines (rhIL-1ß) and tumor necrosis factor-
(TNF-
), did not significantly induce hPGT. Using a
specific antiserum to hPGT, we demonstrate endothelial
expression within the arterial vasculature and the
microcirculation of highly vascularized tissues such as the heart.
ConclusionsOur results identify hPGT as an inducible gene in vascular endothelium and suggest that biomechanical stimuli generated by blood flow in vivo may be important determinants of hPGT expression. Furthermore, this demonstration of regulated endothelial expression of hPGT implicates this molecule in the regional metabolism of prostanoids within the cardiovascular system.
Key Words: prostaglandins cardiovascular system stress endothelium gene expression carrier proteins
| Introduction |
|---|
|
|
|---|
Eicosanoids are important mediators of both
physiological and
pathophysiological processes within the
cardiovascular system.5 6
Recently, a cDNA encoding a molecule capable of mediating the transport
of prostanoids in rat and humans has been
identified.7 8 This molecule, human
prostaglandin transporter (hPGT), is a member of
the 12-membrane-spanning superfamily of transporters and has been
demonstrated to mediate the transport of prostaglandins
across cell membranes in vitro. In particular, hPGT expressed in HeLa
cells is capable of mediating the uptake of prostaglandins
E2, E1,
F2
,
D2, and thromboxane
B2, but not the PGI2
analogue iloprost. Although the cell types capable of expressing hPGT
in vivo have not been identified, based on this in vitro transport data
and the relatively broad tissue distribution of the hPGT mRNA by
Northern analysis,7 8 Kanai, Lu, and
colleagues have postulated a role for hPGT in the transport or
clearance of prostaglandins in diverse tissues.
Here, we report the isolation from an endothelial cell library of a cDNA encoding hPGT and demonstrate that this gene is selectively induced in a sustained fashion in response to physiological levels of a uniform, laminar fluid shear stress in vitro. Furthermore, hPGT protein is expressed in the endothelium of tissues such as the heart, lung, and kidney, as well as in the endothelial lining of the arterial vasculature in humans. These results thus identify hPGT as a regulated gene in vascular endothelium, and support a role for hPGT in regional endothelial prostanoid metabolism in vivo.
| Methods |
|---|
|
|
|---|
Shear Stress Apparatus
Confluent HUVEC monolayers grown on 17.8-cm-diameter maxiplates
(
107 cells per plate) were introduced into a
cone-plate flow apparatus9 consisting
of a stainless steel cone rotating over a stationary baseplate. The
culture medium present between the cone and the plate was
constantly replenished at a rate of 0.5 mL/min during experiments, and
the entire apparatus was maintained in a humidified 5%
CO2-95% air atmosphere. The equations and
calculations for describing the shear stresses generated in this
cone-plate apparatus have been reported in detail
previously.9 10 For laminar shear stress (LSS) at
10 dyne/cm2, we used a 0.5° cone at a
rotational velocity of 100 rpm; for 4 dyne/cm2 or
12 dyne/cm2, the rotational velocity of the cone
was 40 or 120 rpm, respectively. As described by Sdougos et
al,10 the parameter
is
a function of the local radius from the center of the cone, the angular
velocity of the cone, the angle of the cone itself, and the fluid
kinematic viscosity of the media; at values <1,
predicts
laminar flow conditions. Turbulent shear stresses (TSS) can be
generated by manipulating these variables to achieve
values
of >4. At a 3.0° cone angle, a rotational velocity of 135 rpm, and a
radius of
3.5 cm, the
values are >5 and turbulence is
predicted and observed experimentally. For the nuclear runoff
analysis, 2 maxiplates (
107 cells per
plate) were simultaneously prepared as above. One served as
a static control, and one was exposed to 6 hours of steady LSS at 10
dyne/cm2 as above. The transcriptional rates of
the hPGT and GAPDH genes were assayed as described
previously,11 and the PUC-19 plasmid that
contains no endothelial genes served as a negative
control.
Northern and Reverse-TranscriptionPolymerase Chain Reaction
Analysis
RNA was isolated by guanidinium/phenol extraction, resolved on
1.2% agarose/formaldehyde gels and transferred to nylon membranes by
capillary blot for Northern analysis. Differential display and
semi- quantitative reverse-transcriptionpolymerase chain reaction
(RT-PCR) was performed as previously described.11
For the Northern blots, the probe used consisted of the hPGT
cDNA (isolated from a human endothelial library)
labeled with random hexamers. The primers used in the RT-PCR
analysis of hPGT were 5' AGCCTTGGGGATGCTGTTTG3' and
5'CATGGCAAGGGGAGAGGTAC3'. Primers for human GAPDH were purchased from
Stratagene.
Antibody Preparation, Western Blot, and Immunostaining
A rabbit polyclonal anti-hPGT antiserum was raised against a
synthetic peptide consisting of amino acids 627 to 639 of hPGT
(RVKKNKEYNVQKAA) and affinity-purified on the immobilized
peptide (Research Genetics). For the Western blot analysis, the
HUVEC were exposed to the appropriate stimuli and then lysed in 20
mmol/L Tris-HCl pH 7.0, 1% SDS, 0.5% ß-mercaptoethanol, 30%
glycerol, and 1 mmol/L PMSF and immediately boiled for 5 minutes.
Proteins were resolved on 10% acrylamide gels under
denaturing conditions, blotted to nitrocellulose, and probed with the
hPGT antisera at a concentration of 1/1000. Human tissue samples were
collected at the time of surgery or autopsy, according to established
institutional protocols. Frozen sections (4 to 5 µm) were used
for immunostaining, with anti-hPGT serum applied at a
concentration of 1/800 to 1/1000. As a control for the specificity of
this antiserum, excess purified hPGT peptide was preincubated with the
antiserum overnight before its use for tissue staining. In addition,
preimmune serum was routinely included as a negative control (data not
shown). The monoclonal antibody to human PECAM-1 (CD-31) was obtained
from DAKO Corp. Immunostaining was detected with a
secondary antibody conjugated to HRP by use of AEC as substrate, and
the slides were counterstained with hematoxylin. For the
immunofluorescence, individual sections were
stained simultaneously with the human anti-CD31 antibody,
and the rabbit anti-hPGT antiserum and the sections were developed with
a goat anti-mouse secondary antibody conjugated to Texas Red (NEN Life
Science Products) and a goat anti-rabbit antibody conjugated
to FITC (Jackson Immuno Research Inc). The sections were visualized
with a Nikon Microphot-FXA fluorescence microscope and imaged
with a Power Macintoshbased image analysis system
(Oncor).
| Results |
|---|
|
|
|---|
4.5 kb that reproducibly demonstrated a
selective upregulation in response to sustained steady LSS in vitro
(data not shown). Sequence analysis of a corresponding cDNA
derived from a HUVEC library initially revealed a novel gene that was
homologous to a gene encoding the rat matrin
F/G.12 13 Subsequently, Kanai and
colleagues7 reported a longer reading frame
within the rat matrin F/G cDNA and demonstrated that this
longer form of the protein encoded a member of the family of
12-membrane-spanning transporters that was capable of specifically
transporting prostaglandins. This group then identified the
human homolog of this molecule and named it hPGT (for human
prostaglandin transporter).8 The
sequence of our HUVEC-derived cDNA contains all of the predicted
reading frame of hPGT and is identical to that reported by
Lu et al.8
As demonstrated in Figure 1
by
semiquantitative RT-PCR, the transcript encoding hPGT
exhibits a selective upregulation in response to steady LSS in vitro.
By 6 hours, the level of hPGT message is significantly
increased over static controls, whereas a comparable time-averaged
magnitude of TSS, or 20 U/mL of the cytokine rhIL-1ß,
does not significantly alter the level of this mRNA (Figure 1A
). Other
biochemical stimuli such as lipopolysaccharide (LPS),
interferon-
, and TNF-
have been examined, and none of these
altered the level of steady-state hPGT mRNA significantly
(data not shown). After 24 hours of shear or cytokine stimuli,
the selective upregulation of the hPGT gene by the steady
laminar shear stimulus is even more evident (Figure 1B
). Figure 1C
is a
Northern analysis of total RNA isolated from HUVEC cultured
under static conditions, or exposed to 24 hours of LSS, and probed with
the hPGT cDNA. A major transcript of
4.5 kb is
significantly upregulated, while less abundant species of
7.5 and
2.5 kb are also seen. This pattern is consistent with the
Northern results reported by Lu et al.8
Conditioned media from shear stress-treated HUVEC was unable to
upregulate hPGT expression in static HUVEC cultures (data
not shown).
|
hPGT Gene Is Sensitive to Applied Shear Stress and
Upregulation Results in Increased Protein Levels
To explore the laminar shear regulation of the hPGT
gene in more detail, a series of shear preconditioning experiments were
performed. As demonstrated in Figure 2
, when HUVEC are cultured under static conditions they express a low but
detectable level of hPGT mRNA, which is significantly
upregulated by 24 hours of steady LSS at 12
dyne/cm2. However, if the cells are
preconditioned for 18 hours of steady LSS at 12
dyne/cm2 and then the applied shear stress is
reduced to 4 dyne/cm2, the level of
hPGT mRNA decays back to static levels (compare lanes 2 and
3). Lanes 4 and 5 demonstrate that steady LSS at 4
dyne/cm2 is not a sufficient stimulus to
significantly induce hPGT message levels above static
levels, but if the cells are preconditioned under this lower level of
laminar shear for 18 hours and then LSS is stepped up to 12
dyne/cm2, the hPGT message is promptly
induced. These results, together with those of Figure 1
, suggest that
the hPGT gene is responding to both the nature of the
applied fluid mechanical stimulus (eg, laminar versus turbulent shear
stress) as well as the magnitude of the effective stimulus. In
particular, it appears that a threshold of LSS between 4 and 10
dyne/cm2 is both necessary and sufficient for the
induction and maintenance of hPGT expression in
these cultured endothelial cells. The hPGT
gene demonstrates a similar LSS-induced upregulation in cultured
endothelial cells from bovine aortae, whereas no
significant upregulation was observed in Cos-7 cells, a
nonendothelial cell type exposed to the same
biomechanical stimulus (data not shown).
|
Figure 3
is a nuclear runoff
analysis, demonstrating that the upregulation of
hPGT message in HUVEC in response to the LSS stimulus is
occurring at least in part at the level of transcriptional activation.
These results suggest that the promoter of the hPGT gene is
directly responsive to the LSS stimulus in vitro.
|
To confirm that the observed upregulation of hPGT message is
in fact resulting in an increase in hPGT protein levels, a polyclonal
antiserum was raised against a synthetic peptide derived from the
predicted amino acid sequence of hPGT. As demonstrated in Figure 4
, this antisera recognizes a protein of
80 to 85 kd in HUVEC total-cell lysates. This species is markedly
induced by the LSS stimulus, whereas the TSS and cytokine
stimuli result in little if any significant upregulation,
consistent with the data for hPGT message
presented above (Figure 4A
). The selective upregulation of hPGT
protein appears sustained, such that after 48 hours of steady LSS, the
level of hPGT protein remains significantly elevated above static
levels (Figure 4B
). The predicted molecular weight of the hPGT protein
based on the cDNA sequence is
79 kDa; thus, these results are
consistent with the expression of hPGT protein from the open
reading frame present within the hPGT cDNA
identified8 and suggest that the hPGT protein may
undergo some posttranslational modification.
|
hPGT Is Expressed in Vascular
Endothelium in Vivo
To explore the tissue distribution of hPGT expression
in vivo, we used the cDNA as a probe in a Northern analysis of
RNA derived from various normal human tissues. A predominant transcript
of
4.5 kb was easily detected, and less abundant species of
2.5
and 7.5 kb also were evident (data not shown). Although detectable
amounts of hPGT mRNA were found in several tissues,
including heart, placenta, and kidney, relatively high levels of
hPGT transcripts were present in the pancreas, prostate,
small intestine, and lung. These findings are in agreement with
previously published results8 and suggest that
the pattern (ie, size and complexity) of transcripts induced in
cultured human endothelial cells in the current study
is similar to that observed in intact normal human tissues in vivo.
To directly address the question of whether hPGT was expressed in
vascular endothelium in vivo, a polyclonal anti-peptide
antisera was used to examine the expression of hPGT immunoreactive
protein in human vessels and myocardial tissues obtained at autopsy. As
assessed by immunohistochemistry, hPGT is expressed within the
microvascular endothelium present in normal
myocardial tissue (Figure 5A
) and is
present within the endothelial lining of all of the
undiseased human arterial specimens we have examined to
date, such as the epicardial coronary artery (Figure 5B
) or
internal mammary artery (Figure 5C
). The specificity of the
immunostaining was confirmed by the ability of excess
peptide antigen to specifically inhibit tissue staining (Figure 5D
). To
confirm that the hPGT protein detected in the myocardial and
arterial tissues used was in fact expressed within the
endothelium itself, we performed double-label
immunofluorescence staining with the anti-hPGT
serum and a monoclonal antibody directed against CD31 (PECAM-1), a
specific marker of vascular endothelium in these
tissues. As shown in Figure 6
, the
immunofluorescent pattern produced by these antibodies was
virtually identical. Colocalization of CD31 and hPGT was observed in
vessels of all sizes, such as intramyocardial arterioles (Figure 6A
through 6C
), larger epicardial arteries (Figure 6D
through 6F
), or
microvessels within the myocardium (Figure 6G
through 6I
).
Immunoreactive hPGT in a vascular pattern suggesting
endothelial expression was also observed in other human
tissues examined, such as the lung and kidney (Figure 7
).
|
|
|
The observation that cultured HUVEC that express very little hPGT under
static conditions can be induced to express this protein by
physiological levels of shear stress in vitro,
together with the observation that hPGT is expressed in vascular
endothelium in vivo, suggest that signals derived from
blood flow may play a role as a regulator of hPGT expression in
endothelium. A prediction of this hypothesis is that
umbilical vessels (the source of the HUVEC used for the in vitro
studies) would express this molecule. As shown in Figure 8
by 2-color
immunofluorescence, hPGT expression is readily
detected in the luminal endothelium of both human
umbilical veins and arteries.
|
| Discussion |
|---|
|
|
|---|
The functional roles of hPGT expression within the vasculature are unknown. It has been postulated that hPGT may play a variety of roles in prostaglandin metabolism in vivo, including mediating the efflux of newly synthesized prostanoids from intracellular pools, the transepithelial transport of prostanoids, or the clearance of circulating prostaglandins from blood or other extracellular fluids.7 8 These suggestions are based on 2 observations: (1) that hPGT message is detectable at some level in most tissues but seems to be enriched in certain tissues, such as the pancreas and small intestine, that are rich in epithelium; and (2) that hPGT transiently overexpressed in HeLa cells in vitro mediates the uptake of a variety of prostanoids but does not appear capable of mediating the efflux of prostaglandins when expressed in Xenopus oocytes.
Our results demonstrating a predominantly
endothelial-selective pattern of expression in tissues
such as the heart and vasculature point to a previously unsuspected
role for hPGT in the trafficking of prostanoids within the
cardiovascular system. It has long been recognized that
certain prostaglandins, such as PGE2
and PGF2
, are rapidly
cleared by a single passage through the pulmonary or other
vascular beds in vivo.14 15 16 17 This clearance
occurs in the absence of any detectable enzymatic activity in blood
capable of metabolizing these molecules, indicating that clearance by
vascular cells may be playing a primary role. The expression of hPGT in
the endothelium of vessels in the heart (as well as the
lung and kidney), as demonstrated here, presents a possible
mechanism for this phenomenon. A role for
endothelial-expressed hPGT in the clearance of
blood-borne prostanoids would be consistent with the
observation of saturable, energy-dependent transmembrane transport of
prostaglandins18 and the more recent
observations that transport inhibitors such as probenecid
or furosemide, which are capable of binding to and inhibiting diverse
members of the family of 12-membrane transporters, including hPGT
expressed in vitro, are capable of altering prostanoid uptake in
vivo.7 8 19 20 A recent report examining the
direct vascular effects of furosemide in humans demonstrated a
prostaglandin-dependent venodilation that the authors
hypothesized was caused by a stimulation of local
prostaglandin synthesis.21 Our data
suggest an alternative hypothesis, namely that the systemic
administration of furosemide results in decreased vascular clearance of
vasodilatory prostanoids mediated by
endothelial-expressed hPGT, resulting in venodilation.
It will be interesting to test these hypotheses directly via targeted
over- and under-expression strategies of hPGT in vivo.
Interestingly, hPGT is the second example of a gene encoding a member of the 12-membrane-spanning transporters that demonstrates selective responsiveness to fluid mechanical stimuli in cultured vascular endothelial cells. We have recently reported that the gene encoding one of the isoforms of the bumetanide sensitive Na-K-2Cl cotransporter in humans (BSC2) exhibits a selective upregulation in response to sustained LSS, but not TSS, in HUVEC.22 Although the BSC2 gene also is regulated by inflammatory cytokines, its response to defined fluid mechanical stimuli in vitro is strikingly similar to that of the hPGT gene reported here. In both cases, the genes encoding these cell surface transporters are transcriptionally regulated by the LSS stimulus and demonstrate a selective response to a threshold magnitude of steady LSS between 4 and 10 dyne/cm2. These results suggest that these genes are not responding to the acute onset of applied shear stress and that a sustained magnitude of shear stress within the physiological range is both necessary and sufficient for expression of these genes in vitro. hPGT and BSC2 may represent the first examples of a larger class of molecules (ie, the superfamily of cell-surface transporters) that, in addition to other well-characterized classes of endothelial genes, such as the leukocyte adhesion molecules,2 are important functional components of endothelial phenotype that are modulated by biomechanical stimuli in vivo. In addition, the ability of endothelium to respond distinctly to differing fluid mechanical stimuli (eg, LSS versus TSS), suggests that fluid mechanical forces, which by their very nature demonstrate regional variations in amplitude and pattern with the cardiovascular system, may play a critical role in determining regional endothelial structure and function.
In summary, we have demonstrated that the gene encoding hPGT is expressed in human vascular endothelium in vivo, and manifests a selective upregulation in response to a physiologically relevant fluid mechanical stimulus in vitro. This is the first report of cell-type specific expression of hPGT in vivo and identifies the hPGT gene as a regulated species. Although the function of hPGT in endothelium is unknown, these results suggest that hPGT may be involved in the trafficking of prostanoids within the cardiovascular system and raise the testable hypothesis that alterations in the expression or functional status of hPGT may be involved in certain cardiovascular disease states.
| Acknowledgments |
|---|
Received June 22, 1998; accepted July 27, 1998.
| References |
|---|
|
|
|---|
2. Gimbrone MA Jr, Nagel T, Topper JN. Biomechanical activation: an emerging paradigm in endothelial activation. J Clin Invest. 1997;99:18091813.[Medline] [Order article via Infotrieve]
3.
Davies PF. Flow-mediated endothelial
mechanotransduction. Physiol Rev. 1995;75:519560.
4. Resnick N, Gimbrone MA Jr. Hemodynamic forces are complex regulators of endothelial gene expression. FASEB J. 1995;9:874882.[Abstract]
5. Gerritsen ME. Physiological and pathophysiological roles of eicosanoids in the microcirculation. Cardiovasc Res. 1996;32:720732.[Medline] [Order article via Infotrieve]
6. McGiff JC. Prostaglandins, prostacyclin, and thromboxanes. Annu Rev Pharmacol Toxicol. 1981;21:479509.[Medline] [Order article via Infotrieve]
7.
Kanai N, Lu R, Satriano JA, Bao Y, Wolkoff AW,
Schuster VL. Identification and characterization of a
prostaglandin transporter. Science. 1995;268:866869.
8. Lu R, Kanai N, Bao Y, Schuster VL. Cloning, in vitro expression, and tissue distribution of a human prostaglandin transporter. J Clin Invest. 1996;98:11421149.[Medline] [Order article via Infotrieve]
9. Bussolari SR, Dewey CF Jr, Gimbrone MA Jr. Apparatus for subjecting living cells to fluid shear stress. Rev Sci Instrum. 1982;53:18511854.[Medline] [Order article via Infotrieve]
10. Sdougos HP, Bussolari SR, Dewey CF. Secondary flow and turbulence in a cone-and-plate device. J Fluid Mech. 1984;138:379404.
11.
Topper JN, Cai J, Falb D, Gimbrone MA Jr.
Identification of vascular endothelial genes
differentially responsive to fluid mechanical stimuli:
cyclooxygenase-2, manganese superoxide dismutase,
and endothelial cell nitric oxide synthase are
selectively up-regulated by steady laminar shear stress. Proc
Natl Acad Sci U S A. 1996;93:1041710422.
12.
Hakes DJ, Berezney R. Molecular cloning of matrin F/G:
a DNA binding protein of the nuclear matrix that contains putative zinc
finger motifs. Proc Natl Acad Sci U S A. 1991;88:61866190.
13.
Nakayasu H, Berezney R. Nuclear matrins:
identification of the major nuclear matrix proteins. Proc Natl
Acad Sci U S A. 1991;88:1031210316.
14. Eling TE, Anderson MW. Studies on the biosynthesis, metabolism and transport of prostaglandins. Agents Actions. 1976;6:543546.[Medline] [Order article via Infotrieve]
15. Ferreira SH, Vane JR. Prostaglandins: their disappearance from and release into the circulation. Nature. 1967;216:868873.[Medline] [Order article via Infotrieve]
16. Anderson MW, Eling TE. Prostaglandin removal and metabolism by isolated perfused rat lung. Prostaglandins. 1976;11:645677.[Medline] [Order article via Infotrieve]
17.
Hagen AA, Gerber JN, Sweeley CC, White RP, Robertson
JT. Levels and disappearance of prostaglandin F2
in
cerebral spinal fluid: a clinical and experimental study.
Stroke. 1977;8:672675.
18. Bito LZ. Saturable, energy-dependent, transmembrane transport of prostaglandins against concentration gradients. Nature. 1975;256:134136.[Medline] [Order article via Infotrieve]
19.
Bito LZ, Salvador EV. Effects of anti-inflammatory
agents and some other drugs on prostaglandin biotransport.
J Pharmacol Exp Ther. 1976;198:481488.
20.
Bito LZ, Davson H, Salvador EV. Inhibition of in
vitro concentrative prostaglandin accumulation by
prostaglandins, prostaglandin analogues and by
some inhibitors of organic anion transport. J
Physiol. 1976;256:257271.
21.
Pickkers P, Dormans TP, Russel FG, Hughes AD, Thien T,
Schaper N, Smits P. Direct vascular effects of furosemide in humans.
Circulation. 1997;96:18471852.
22. Topper JN, Wasserman SM, Anderson KR, Cai J, Falb D, Gimbrone MA Jr. Expression of the bumetanide-sensitive Na-K-Cl cotransporter BSC2 is differentially regulated by fluid mechanical and inflammatory cytokine stimuli in vascular endothelium. J Clin Invest. 1997;99:29412949.The gene encoding a human prostaglandin transporter (hPGT) is induced in cultured human vascular endothelium exposed to a physiological fluid mechanical stimulus in vitro. This biomechanical induction is selective in that other stimuli failed to induce hPGT. hPGT protein is expressed in human vascular endothelium in vivo. These results identify hPGT as an inducible gene in vascular endothelium and suggest that biomechanical stimuli generated by blood flow in vivo may be important determinants of hPGT expression. This demonstration of regulated endothelial expression of hPGT implicates this molecule in the regional metabolism of prostanoids within the cardiovascular system.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
L. Di Francesco, L. Totani, M. Dovizio, A. Piccoli, A. Di Francesco, T. Salvatore, A. Pandolfi, V. Evangelista, R. A. Dercho, F. Seta, et al. Induction of Prostacyclin by Steady Laminar Shear Stress Suppresses Tumor Necrosis Factor-{alpha} Biosynthesis via Heme Oxygenase-1 in Human Endothelial Cells Circ. Res., February 27, 2009; 104(4): 506 - 513. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Dekker, R. A. Boon, M. G. Rondaij, A. Kragt, O. L. Volger, Y. W. Elderkamp, J. C. M. Meijers, J. Voorberg, H. Pannekoek, and A. J. G. Horrevoets KLF2 provokes a gene expression pattern that establishes functional quiescent differentiation of the endothelium Blood, June 1, 2006; 107(11): 4354 - 4363. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Kis, T. Isse, J. A. Snipes, L. Chen, H. Yamashita, Y. Ueta, and D. W. Busija Effects of LPS stimulation on the expression of prostaglandin carriers in the cells of the blood-brain and blood-cerebrospinal fluid barriers J Appl Physiol, April 1, 2006; 100(4): 1392 - 1399. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Pucci, S. Endo, T. Nomura, R. Lu, C. Khine, B. S. Chan, Y. Bao, and V. L. Schuster Coordinate control of prostaglandin E2 synthesis and uptake by hyperosmolarity in renal medullary interstitial cells Am J Physiol Renal Physiol, March 1, 2006; 290(3): F641 - F649. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nomura, H. Y. Chang, R. Lu, J. Hankin, R. C. Murphy, and V. L. Schuster Prostaglandin Signaling in the Renal Collecting Duct: RELEASE, REUPTAKE, AND OXIDATION IN THE SAME CELL J. Biol. Chem., August 5, 2005; 280(31): 28424 - 28429. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. P. Cherian, A. J. Siller-Jackson, S. Gu, X. Wang, L. F. Bonewald, E. Sprague, and J. X. Jiang Mechanical Strain Opens Connexin 43 Hemichannels in Osteocytes: A Novel Mechanism for the Release of Prostaglandin Mol. Biol. Cell, July 1, 2005; 16(7): 3100 - 3106. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kang, P. Chapdelaine, J. Parent, E. Madore, P. Y. Laberge, and M. A. Fortier Expression of Human Prostaglandin Transporter in the Human Endometrium across the Menstrual Cycle J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2308 - 2313. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M Wasserman and J. N Topper Adaptation of the endothelium to fluid flow: in vitro analyses of gene expression and in vivo implications Vascular Medicine, February 1, 2004; 9(1): 35 - 45. [Abstract] [PDF] |
||||
![]() |
S. K. Banu, J. A. Arosh, P. Chapdelaine, and M. A. Fortier Molecular cloning and spatio-temporal expression of the prostaglandin transporter: A basis for the action of prostaglandins in the bovine reproductive system PNAS, September 30, 2003; 100(20): 11747 - 11752. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. I. Ivanov, A. C. Scheck, and A. A. Romanovsky Expression of genes controlling transport and catabolism of prostaglandin E2 in lipopolysaccharide fever Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2003; 284(3): R698 - R706. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Bao, M. L. Pucci, B. S. Chan, R. Lu, S. Ito, and V. L. Schuster Prostaglandin transporter PGT is expressed in cell types that synthesize and release prostanoids Am J Physiol Renal Physiol, June 1, 2002; 282(6): F1103 - F1110. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Gobeil Jr, I. Dumont, A. M. Marrache, A. Vazquez-Tello, S. G. Bernier, D. Abran, X. Hou, M. H. Beauchamp, C. Quiniou, A. Bouayad, et al. Regulation of eNOS Expression in Brain Endothelial Cells by Perinuclear EP3 Receptors Circ. Res., April 5, 2002; 90(6): 682 - 689. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Vezza, J. Rokach, and G. A. FitzGerald Prostaglandin F2alpha Receptor-Dependent Regulation of Prostaglandin Transport Mol. Pharmacol., June 1, 2001; 59(6): 1506 - 1513. [Abstract] [Full Text] |
||||
![]() |
J. D. Brown, M. R. DiChiara, K. R. Anderson, M. A. Gimbrone Jr., and J. N. Topper MEKK-1, a Component of the Stress (Stress-activated Protein Kinase/c-Jun N-terminal Kinase) Pathway, Can Selectively Activate Smad2-mediated Transcriptional Activation in Endothelial Cells J. Biol. Chem., March 26, 1999; 274(13): 8797 - 8805. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Gobeil Jr, I. Dumont, A. M. Marrache, A. Vazquez-Tello, S. G. Bernier, D. Abran, X. Hou, M. H. Beauchamp, C. Quiniou, A. Bouayad, et al. Regulation of eNOS Expression in Brain Endothelial Cells by Perinuclear EP3 Receptors Circ. Res., April 5, 2002; 90(6): 682 - 689. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |