Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 1998;98:149-156

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ono, K.
Right arrow Articles by Sasayama, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ono, K.
Right arrow Articles by Sasayama, S.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Heart Attack

(Circulation. 1998;98:149-156.)
© 1998 American Heart Association, Inc.


Basic Science Reports

Cytokine Gene Expression After Myocardial Infarction in Rat Hearts

Possible Implication in Left Ventricular Remodeling

Koh Ono, MD; Akira Matsumori, MD, PhD; Tetsuo Shioi, MD, PhD; Yutaka Furukawa, MD, PhD; ; Shigetake Sasayama, MD, PhD

From the Department of Cardiovascular Medicine, Kyoto University, Graduate School of Medicine, Kyoto, Japan.

Correspondence to Akira Matsumori, MD, PhD, Department of Cardiovascular Medicine, Kyoto University, 54 Kawara-cho, Shogoin, Sakyo-Ku, Kyoto 606, Japan.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background—A large transmural myocardial infarction may initiate structural and geometric changes in the left ventricle that are commonly referred to as remodeling. Progressive, adverse remodeling of the myocardium may lead to ventricular dilatation and congestive heart failure. Recent studies have highlighted the effects of some cytokines on immune-mediated myocyte injury, postischemic myocardial inflammation, and cardiac function. However, studies of the involvement of cytokines in remodeling of the heart are few.

Methods and Results—In a rat model of myocardial infarction, progressive dilatation of the left ventricular cavity and lack of appropriate hypertrophy of the surviving myocardium were confirmed by transthoracic echocardiography. The relative expression of mRNA for tumor necrosis factor (TNF)-{alpha}, interleukin (IL)-1ß, and IL-6 in the infarcted and noninfarcted myocardium of these rats, as well as in a group of sham-operated animals, was assessed by the technique of quantitative polymerase chain reaction amplification. In the infarcted region, TNF-{alpha}, IL-1ß, and IL-6 gene expression peaked at 1 week after infarction and decreased rapidly thereafter. In contrast, at 20 weeks after infarction, the gene expression levels of these cytokines remained significantly higher in the noninfarcted than in the infarcted zone or in the myocardium of sham-operated animals. Furthermore, the levels of these cytokines in the noninfarcted region correlated with the left ventricular end-diastolic diameter measured at 8 and 20 weeks after infarction. Among these cytokines, IL-1ß expression was highest, and its level correlated well with collagen deposition in the noninfarcted myocardium at 8 and 20 weeks after surgery. At 20 weeks after infarction, immunohistochemical analysis revealed the presence of IL-1ß in macrophages, endothelial cells, and vascular smooth muscle cells in the noninfarcted region, whereas no such immunoreactivity was found in the myocardium of sham-operated animals.

Conclusions—These findings suggest the possible involvement of cytokines during the remodeling process of the noninfarcted left ventricular myocardium.


Key Words: cytokines • remodeling • myocardial infarction • immunohistochemistry


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Ischemic heart disease is the leading cause of CHF in most Western countries.1 2 A large transmural MI may initiate a cascade of progressive structural and geometric changes in the LV that is commonly referred to as remodeling. The remodeling process is believed to serve initially as a compensatory mechanism to maintain cardiac output. However, these architectural changes may eventually contribute to the development of congestive symptoms from afterload mismatch and exacerbation of LV dysfunction.3 The effects of cytokines on immune-mediated myocyte injury and myocardial function have been studied in depth recently. Cytokines such as IL-1ß or TNF-{alpha} have negative inotropic effects in the isolated perfused heart,4 papillary muscle preparation,5 and cultured myocytes.6 IL-1ß activates fibroblasts,7 which might affect the remodeling process of the heart.8 In addition to these humoral effects, these cytokines may cause direct myocyte injury by activating cytotoxic T cells.9 In the present study, the remodeling of the LV in a rat model of MI was monitored with transthoracic echocardiography, whereas the expression of cytokines in the infarcted and noninfarcted myocardium and in the hearts of sham-operated animals was examined by use of quantitative reverse transcriptase PCR and immunohistochemical analysis.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Experimental MI
Male Wistar rats weighing 250 to 300 g were anesthetized by intraperitoneal injection of sodium pentobarbital (50 mg/kg) intubated, and ventilated with a volume-cycled small-animal respirator. After the heart was exposed via a left anterior thoracotomy, the left anterior descending coronary artery was ligated proximally with a 7–0 silk suture. Positive end-expiratory pressure was applied to fully inflate the lungs, and the chest was closed in layers. Another group of rats underwent the identical procedure without ligation of the coronary artery. Four animals from each group were killed by excision of the heart under pentobarbital anesthesia at 1, 8, and 20 weeks after surgery, respectively.

Determination of Infarct Size and Histological Analysis
The LV and septum were separated from the right ventricle and weighed. The LV was cut into six transverse slices from apex to base. The first, third, and fifth slices were fixed in 10% formalin, and the remaining three were used for RNA preparation. The former three slices were embedded in paraffin and cut into 4-µm sections that were mounted onto slides and stained with Sirius red F3BA (0.1% solution in saturated aqueous picric acid) to allow a clear discrimination between cardiomyocytes and collagen matrix.10 The endocardial and epicardial circumferences of the infarcted and noninfarcted LV were outlined with a digital image analyzer (LUSEX3, Nikon). The infarcted mean circumference (mean of endocardial and epicardial circumferences) of the three slices was summed and expressed as the ratio of summed mean circumference of the LV, as described by Pfeffer et al.11 12

For the determination of cardiac collagen density, slide images were obtained of the noninfarcted interventricular septum at a x400 magnification. Three sections per animal and 20 fields per section were scanned and computerized with a LUSEX3 digital image analyzer on the basis of the red staining of the collagen. Volume collagen fraction was calculated as the sum of all connective tissue areas divided by the total area of the image. Perivascular collagen was excluded from this measurement. It has been shown that the total volume fraction determined by this morphometric approach is closely related to hydroxyproline concentration of the ventricle.13 14

Echocardiographic Studies
The evolution of the LV dimensions and function in vivo was followed by transthoracic echocardiography performed at 0, 1, 4, 8, and 20 weeks after surgery (Hewlett-Packard) with a 7.5-MHz sector scan probe. Under light anesthesia with sodium pentobarbital (15 mg/kg IM), the animal was placed in the supine position and the chest was shaved. The ultrasound probe was placed in gentle contact with the mid precordial area through a transmission medium. M-mode echocardiograms, guided by two-dimensional long-axis images, were obtained through the anterior and posterior LV walls at the level of the papillary muscles and recorded at a paper speed of 100 mm/s. The LV EDD and ESD were measured from the M-mode tracings according to the American Society for Echocardiology leading-edge method.15 The LV posterior wall thickness (PWT) was measured at end diastole. For each measurement, data from at least three consecutive cardiac cycles were averaged. LV fractional shortening (FS) and RWT were calculated according to the following formulas:

LV FS (%) = [(EDD-ESD) / EDD] x 100

RWT = 2 x PWT / EDD

RNA Preparation and First-Strand cDNA Synthesis
Infarcted hearts at 1, 8, and 20 weeks after surgery were sectioned into noninfarcted and infarcted areas by visual inspections; beginning 1 week after coronary ligation, the infarcted area becomes pale and can be easily distinguished from normal myocardium. The border zone was included in the infarcted area. Total RNA was isolated by use of the guanidinium thiocyanate/phenol/chloroform/isoamyl alcohol procedure.16 Total RNA (10 µg) was subjected to first-strand cDNA synthesis in a 40-µL reaction mixture containing 50 mmol/L Tris-HCl (pH 8.3), 75 mmol/L KCl, 3 mmol/L MgCl2, 1 mmol/L dNTP (Perkin-Elmer Cetus), 0.825-optical density random hexamers (Pharmacia LKB Biotechnology Inc), 40 U of RNAasin (Promega Corp), and 200 U of murine leukemia virus reverse transcriptase (Gibco BRL). The reaction mixture was incubated at 37°C for 60 minutes, heated to 70°C for 5 minutes to denature the reverse transcriptase, then cooled on ice for 3 minutes. Water (60 µL) was added to each sample, and the samples were stored at -20°C.

Competitive PCR
Competitive PCR was performed by titration of sample cDNA with known amounts of nonhomologous TNF-{alpha}, IL-1ß, IL-6, and GAPDH-MIMIC standard produced with the use of the Clontech PCR MIMIC construction kit. Briefly, a sense primer (A) and an antisense primer (B) for rat TNF-{alpha},17 rat IL-1ß,18 rat IL-6,19 and rat GAPDH20 were synthesized with the use of the published cDNA sequences. The actual sequences of the oligonucleotides were as follows: TNF-{alpha} A, 5'-ATGAGCACGGAAAGCATGATCCGA-3'; TNF-{alpha} B, 5'-CCAAAGTAGACCTGCCCGGACTC-3'; IL-1ß A, 5'-ATGGCAACTGTCCCTGAACTCAACT-3'; IL-1ß B, 5'-CAGGACAGGTATAGATTCAACCCCTT-3'; IL-6 A, 5'-CCAGTTGCCTTCTTGGGACTGATG-3'; IL-6 B, 5'-ATTTTCTGACCACAGTGAGGAATG-3'; GAPDH A, 5'-TTCTTGTGCAGTGCCAGCCTCGTC-3'; and GAPDH B, 5'-TAGGAACACGGAAGGCCATGCCAG-3'.

Composite primers comprising the TNF-{alpha}, IL-1ß, IL-6, and GAPDH gene-specific primers described above with v-erb B oncogene-specific 20-nucleotide base sequences at the 3' end (upstream, CGCAAGTGAAATCTCCTCCG; downstream, TCTGTCAATG CAGTTTGTAG) were used to construct fragments of the v-erb B oncogene with TNF-{alpha}–, IL-1ß–, IL-6–, and GAPDH-specific sequences at the 5' end of each strand. These TNF-{alpha}, IL-1ß, IL-6, and GAPDH-MIMIC sequences were amplified by use of the noncomposite TNF-{alpha}–, IL-1ß–, IL-6–, and GAPDH-specific primers described above, and the molar quantity produced was determined. Ten micrograms of total RNA was used as template for cDNA synthesis. Two percent portions of the cDNA were then amplified in the presence of twofold dilutions of each of the TNF-{alpha}, IL-1ß, IL-6, and GAPDH-MIMIC sequences. Each PCR reaction contained 100 µmol/L dNTP, 0.5 µmol/L of each specific primer, 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.001% gelatin, and 0.25 U of Taq polymerase (Cetus) in a volume of 25 µL. [{alpha}32P]dCTP was included in the reaction to quantify the PCR products. Each cycle consisted of denaturation at 94°C for 45 seconds, annealing at 55°C for 45 seconds, and extension at 72°C for 90 seconds. TNF-{alpha}, IL-1ß, and IL-6 were amplified by 30 cycles of PCR, and GAPDH was amplified by 21 cycles under the conditions in which linearity of the amplification was confirmed. A 30% portion of the PCR reaction products was then resolved by electrophoresis on a 4% polyacrylamide gel and examined by use of a FUJIX bioimaging analyzer BAS 2000. The molar ratio between the internal control and target was calculated according to the following formula:

where IT and IC represent the intensity of the PCR product from the target and the internal control, respectively, and CC and CT represent the dCTP content in the PCR product from the target and the internal control. The amount of target molecule was determined as the point of an equimolar ratio between the internal control and the target (Figure 1Down). The amounts of TNF-{alpha}, IL-1ß, and IL-6 were divided by those of GAPDH to correct the efficiency of cDNA synthesis.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. Representative quantitative PCR analysis of IL-1ß mRNA using internal controls. A, Lane 1 contains 1x10-2 attomoles of IL-1ß-MIMIC; lane 2, 5x10-3; lane 3, 2.5x10-3; lane 4, 1.25x10-3; lane 5, 6.25x10-4; lane 6, 3.13x10-4; and lane 7, 1.56x10-4. B, Quantitative analysis of the competitive PCR experiment shown in A. The log of the ratio of the corrected density of the target and MIMIC was plotted against the log of (Molecules MIMIC) added to the PCR reaction. The line was drawn from a linear regression analysis of the data points. The amount of target molecule was determined as the point of an equimolar ratio between the internal control and the target.

Immunohistochemistry
Heart sections were embedded in OCT compound tissue medium (Miles Inc), snap-frozen on dry ice, and stored at -70°C. Tissues were sectioned on a cryostat at 6 µm. The sections were fixed for 10 minutes in 4% paraformaldehyde at 4°C. The primary antibodies used consisted of hamster monoclonal anti-mouse IL-1ß (Genzyme Corp) at a concentration of 50 µg/mL and mouse monoclonal anti-rat macrophage (clone Ki-M2R, BMA) diluted to 1:50. Incubation with the primary antibody was performed at 4°C overnight. Biotinylated goat anti-hamster IgG (Cedarlane) diluted to 1:100, biotinylated goat anti-rabbit IgG (DAKO) diluted to 1:300, and biotinylated rabbit anti-mouse IgG (DAKO) diluted 1:300 were used as secondary antibodies. Incubation with secondary antibodies was performed at room temperature for 30 minutes. After incubation with avidin-biotin–horseradish peroxidase complexes (Vector Labs), peroxidase was visualized by 3',3'-diaminobenzidine followed by incubation with diaminobenzidine enhancing solution (Vector Labs). Counterstaining was performed with methyl green. Omission of the primary antibody and preabsorption of anti-mouse IL-1ß with recombinant rat IL-1ß (provided by Otsuka Pharmaceutical Co, Tokushima, Japan) served as controls to verify IL-1ß staining. The primary antibody was omitted as a control for the staining of macrophages.

Statistical Analyses
Echocardiographic measurements are reported as mean±SD. Measurements of cytokine gene expression were normalized by assigning an arbitrary number of 100 to the peak expression of IL-1ß from which means and SEs were derived. One-way ANOVA with Fisher's protected least significant difference test was used for statistical comparisons. A value of P<0.05 was considered significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Infarct Size and Chamber Dimensions
There were no significant differences in infarct size within groups over time (TableDown). The LV mass indexed for body weight was significantly increased in the MI group (overall mean: sham, 1.83 g/kg; MI, 2.32 g/kg; P<0.05). A similar pattern was observed in the right ventricular mass indexed for body weight.


View this table:
[in this window]
[in a new window]
 
Table 1. Physical Characteristics

Echocardiographic Study
Compared with sham-operated animals, rats with MI exhibited progressive LV dilatation. Significant differences in LV ESD and EDD were already measurable between the two groups at 1 week and continued to widen up to 20 weeks (Figure 2Down, left). LV enlargement was accompanied by a marked decrease in fractional shortening (Figure 2Down, middle). Similarly, RWT was markedly decreased in the rats with MI throughout the observation period (Figure 2Down, right). Thus, the increase in LV cavity size was disproportionate relative to the thickness of the surviving myocardium, suggesting a lack of appropriate hypertrophy and a progressive afterload mismatch.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 2. Graphs showing serial changes in LV geometry and function before and 1, 4, 8, and 20 weeks after surgery in sham-operated rats (n=12) and in rats with MI (n=12). Left, Progressive increase in LV diastolic internal dimension (EDD) after MI. Middle, Fractional shortening (FS) shows progressive impairment in rats with MI. Right, Marked decrease in RWT indicates a disproportionate increase in chamber dimension after MI. *P<0.05 compared with controls; #P<0.05 compared with preoperative baseline; §P<0.05 compared with 1 week after MI.

PCR Analysis of Cytokine Genes
The evolution of the relative levels of TNF-{alpha}, IL-1ß, and IL-6 mRNA in both groups of rats is shown in Figure 3Down. The gene expression level in the sham-operated rats rose slightly at 1 week and returned to near baseline thereafter. In the rats that underwent coronary ligation, the gene expression level in the infarcted region rose steeply at 1 week after surgery (TNF-{alpha}, 32±5%; IL-1ß, 100±17%; and IL-6, 31±4%), also falling to near baseline at 20 weeks (4±1%, 7±2%, and 4±1%, respectively). In contrast, in the noninfarcted region, the cytokine gene expression levels rose moderately at 1 week and at 20 weeks remained significantly higher than those measured in both the infarcted zone and the myocardium of the sham-operated rats (16±4%, 47±8%, and 15±4%, respectively). Furthermore, this rise in cytokine expression levels in the noninfarcted heart correlated with the EDD at 8 and 20 weeks after surgery (TNF-{alpha}, r=0.743; IL-1ß, r=0.719; and IL-6, r=0.713; Figure 4Down).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Quantitative analysis of TNF-{alpha}, IL-1ß, and IL-6. The value at each time point represents the normalized mean±SEM for four rats. *P<0.05 compared with sham operation group; #P<0.05 compared with infarcted region.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Relationship between EDD of TNF-{alpha}, IL-1ß, and IL-6 gene expression level in the noninfarcted zone at 8 and 20 weeks after coronary ligation. The expression of each cytokine correlated positively with EDD.

Histological Study
Compared with control animals, a 3.63-fold increase in LV collagen density was observed in MI rats at 20 weeks after surgery (Figures 5Down, bottom panel; and 6, left panel). LV collagen density at 8 and 20 weeks after surgery correlated well with IL-1ß mRNA expression level (r=0.86; Figure 6Down, right panel). No significant correlation was found between collagen density and TNF-{alpha} or IL-6 mRNA expression level.



View larger version (167K):
[in this window]
[in a new window]
 
Figure 5. Interventricular septum stained with Sirius red at 20 weeks after surgery. Magnification x400; bar=50 µm. Top, Sham-operated rats; bottom, MI rats.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 6. Serial changes in collagen density (left) and relation between IL-1ß gene expression level and collagen density (right). *P<0.05 compared with sham-operated group.

Immunohistochemistry
Because the IL-1ß mRNA expression level was the most enhanced, we performed its immunohistochemical analysis in these animals. In the control rats, minimal immunoreactivity was observed by immunohistochemical analysis performed at 1 week to localize IL-1ß protein in the heart (Figure 7ADown). In contrast, in the infarcted region, IL-1ß immunoreactivity was found in the infiltrating leukocytes (Figure 7BDown), and in the noninfarcted zone, it was found in vascular endothelial cells and interstitial cells (Figure 7CDown). At 20 weeks, IL-1ß immunoreactivity remained almost absent in the heart of control rats. In the rats with MI, the infarcted myocardium was replaced by scar tissue with less mononuclear cell infiltration, and immunoreactivity for IL-1ß protein was observed in scattered mononuclear cells (Figure 7DDown). In the noninfarcted myocardium, IL-1ß staining was apparent in endothelial cells and vascular smooth muscle cells (Figure 7EDown) as well as in the interstitial cells that were positive for macrophage marker (Figure 7FDown and 7GDown).



View larger version (123K):
[in this window]
[in a new window]
 
Figure 7. Localization of IL-1ß by immunohistochemical analysis in control and infarcted hearts. Magnification x400; bar=50 µm. A, Absence of IL-1ß protein in the heart from a sham-operated rat at 1 week after surgery. B, Presence of IL-1ß protein in infiltrating leukocytes of an infarcted zone 1 week after coronary ligation. C, Presence of IL-1ß protein in vascular endothelial cells and interstitial cells in the noninfarcted region 1 week after coronary ligation. D, Scar tissue replacement in infarcted territory at 20 weeks after coronary ligation. Immunoreactivity for IL-1ß protein is observed in scattered mononuclear cells. E, Positive staining for IL-1ß in endothelial cells and vascular smooth muscle cells in the noninfarcted myocardium 20 weeks after coronary ligation. F and G, Positive staining for IL-1ß (arrows in F) in interstitial macrophage (arrows in G) in the noninfarcted zone 20 weeks after coronary ligation.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Ventricular remodeling after MI is a consequence of large infarcts.21 This complex process is not limited to the areas of infarction.22 23 In the present study, we followed the remodeling process in a rat model of post-MI heart failure using serial transthoracic echocardiography. In this model, LV dilatation develops in the first week after MI and continues to progress over the subsequent 20 weeks. In the noninfarcted myocardium, adaptive hypertrophy undergoes a transition, leading to further cardiac dilatation, with a strong tendency toward a decrease in the thickness of the noninfarcted myocardium relative to the LV diameter. The decrease in RWT in rats with MI implies that the limits of compensation have been reached and that there is lack of appropriate hypertrophy of the surviving myocardium.

In acute ischemia leading to permanent myocyte injury, complex local interactions exist among endothelial cells, accumulation of infiltrating leukocytes, and tissue-based monocytes and myocytes.24 25 Recent studies have followed the temporal sequence of proinflammatory cytokine gene expression in postischemic/reperfused myocardium.26 27 28 However, those studies addressed the postischemic myocardial inflammation that occurs at a relatively acute stage, and the role of cytokines on LV remodeling has not been thoroughly studied.

Habib et al29 30 localized the inducible form of nitric oxide synthase (iNOS) and TNF-{alpha} within cardiac tissues in DCM, and they hypothesized that locally produced TNF-{alpha} might contribute to the pathogenesis and complications of DCM by inducing iNOS in the heart. Ischemic heart disease is the leading cause of CHF, and we hypothesize that similar inflammatory and immune processes may be implicated at the level of the noninfarcted myocardium. In our model, at 20 weeks, the cytokine expression level in the noninfarcted region was significantly higher than in the control rats and correlated well with EDD. The cause for this cytokine gene upregulation is uncertain, although several factors that cause LV dilatation might contribute to it.

It is becoming increasingly apparent that proinflammatory cytokines play an important role in modulating the function and structure of the heart. Elevated concentrations of TNF-{alpha} have been reported in patients with chronic heart failure,31 32 and TNF-{alpha} has been found to depress the contractility of isolated hamster papillary muscles. Repeated TNF-{alpha} infusion may lead to a permanent decrease in myocardial contractility and may result in DCM.33

IL-1ß has deleterious effects on cardiac contractility in isolated perfused rat hearts.4 IL-1ß, TNF-{alpha}, and IFN-{gamma} increased NO production in rat cardiocytes by induction of iNOS gene expression.34 These cytokines also have cytotoxic effects on cultured myocytes.35 More recently, IL-1ß acting via an NO-independent mechanism has been shown to cause myocyte hypertrophy and downregulation of calcium regulating genes,36 and in ischemic cardiomyopathy, alterations in collagen concentration and phenotypes have been demonstrated.37 Enhanced type I and type III collagen production by fibroblasts in the noninfarcted myocardium has been reported in the rat heart after MI.38 In our model, collagen density of noninfarcted myocardium gradually increased and correlated well with IL-1ß expression level. Because IL-1ß exhibits mitogenic effects on human fibroblasts in certain circumstances,39 40 the upregulation of IL-1ß in the noninfarcted myocardium in our model may be partly responsible in this setting for altering the compliance of the myocardium, resulting in exacerbation of heart failure. We found a similar correlation between IL-1ß mRNA expression and cardiac fibrosis in a murine model of myocarditis.41 However, the effects of IL-1ß on fibroblasts may be complex. For example, Palmer et al42 reported an antiproliferative effect of IL-1ß on cultured rat cardiac fibroblasts. In another study, Thaik et al43 found that IL-1ß stimulated protein synthesis in cultured rat cardiac fibroblasts, although it inhibited DNA synthesis. Therefore, further studies are needed to define more precisely the effects of IL-1ß on the collagen deposition in vivo.

High cytokine levels have been found to activate metalloproteinase under certain conditions.44 Cleutjens et al45 reported that posttranslational activation of latent collagenase (MMP-1) plays a predominant role at the site of infarction, and this activation, measured by zymography, began at day 2, peaked at day 7, and declined thereafter, somewhat earlier than our findings of increased expression of cytokines in the noninfarcted myocardium; in addition, Cleutjens et al found no changes in MMP-1 activity at remote sites or in sham-operated controls. Therefore, the contribution of extracellular proteolysis seems relatively small in the present study, and the positive correlation between IL-1ß expression and collagen deposition suggests that increased production exceeds its degradation.

In addition to necrosis, myocyte loss induced by apoptosis has recently been proposed as an important mechanism in the pathogenesis of CHF.46 However, Saraste et al47 observed few apoptotic cells in the remote, noninfarcted myocardium, and the contribution of apoptotic myocyte death on interstitial fibrosis in the surviving myocardium remains unknown.

An increasing number of experimental observations suggest that IL-6 is also capable of modulating cardiovascular function, exerting a negative inotropic effect through NO-dependent pathways as well.5 Mice with overexpression of both IL-6 and IL-6 receptors have been reported to show constitutive tyrosine phosphorylation of gp130 and to develop cardiac hypertrophy.48 Cardiac myocytes are reported to produce IL-6 under hypoxic stress.49 Therefore, in the present experiment, IL-6 in the noninfarcted myocardium may have been upregulated by relative ischemia in the hypertrophied myocyte itself.

The mechanisms responsible for the upregulation of cytokine gene expression in the noninfarcted myocardium are not known. Further experiments will be directed toward determining the mechanism of cytokine induction and the physiological role of the intracardiac cytokine system.


*    Selected Abbreviations and Acronyms
 
CHF = congestive heart failure
DCM = dilated cardiomyopathy
EDD = end-diastolic diameter
ESD = end-systolic diameter
IL = interleukin
iNOS = inducible nitric oxide synthase
LV = left ventricle, left ventricular
MI = myocardial infarction
PCR = polymerase chain reaction
RWT = relative wall thickness
TNF = tumor necrosis factor


*    Acknowledgments
 
This work was supported by a research grant from the Ministry of Health and Welfare of Japan and a grant-in-aid for general scientific research from the Ministry of Education, Science, and Culture of Japan. We would like to thank Otsuka Pharmaceutical Co for supplying the recombinant rat IL-1ß.

Received November 5, 1997; revision received December 12, 1997; accepted January 23, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Fuster V, Badimon L, Badimon JJ, Chesebro JH. The pathogenesis of coronary artery disease and the acute coronary syndromes, I. N Engl J Med. 1992;326:242–250.[Medline] [Order article via Infotrieve]

2. Fuster V, Badimon L, Badimon JJ, Chesebro JH. The pathogenesis of coronary artery disease and the acute coronary syndromes, II. N Engl J Med. 1992;326:310–318.[Medline] [Order article via Infotrieve]

3. Davis MJ. A macro and micro view of coronary vascular insult in ischemic heart disease. Circulation. 1990;82(suppl II):II-38–II-46.

4. Hosenpud JD, Campbell SM, Mendelson DJ. Interleukin-1-induced myocardial depression in an isolated beating heart preparation. J Heart Transplant. 1989;8:460–464.[Medline] [Order article via Infotrieve]

5. Finkel MS, Oddis CV, Jacob TD, Watkins SC, Hattler BG, Simmons RL. Negative inotropic effects of cytokines on the heart mediated by nitric oxide. Science. 1992;257:387–389.[Abstract/Free Full Text]

6. Balligand JL, Ungureanu-Longrois D, Kelly RA, Kobzik L, Pimental D, Michel T, Smith TW. Abnormal contractile function due to induction of nitric oxide synthesis in rat cardiac myocytes follows exposure to activated macrophage-conditioned medium. J Clin Invest. 1993;91:2314–2319.

7. Libby P, Warner SJ, Friedman GB. Interleukin 1: a mitogen for human vascular smooth muscle cells that induces the release of growth-inhibitory prostanoid. J Clin Invest. 1988;81:487–498.

8. Boluyt MO, O'Neill L, Meredith AL, Bing OH, Brooks WW, Conrad CH, Crow MT, Lakatta EG. Alterations in cardiac gene expression during the transition from stable hypertrophy to heart failure: marked upregulation of genes encoding extracellular matrix components. Circ Res. 1994;75:23–32.[Abstract/Free Full Text]

9. Woodley SL, McMillan M, Shelby J, Lynch DH, Roberts LK, Ensley RD, Barry WH. Myocyte injury and contraction abnormalities produced by cytotoxic T lymphocytes. Circulation. 1991;83:1410–1418.[Abstract/Free Full Text]

10. Wollert KC, Studer R, Doerfer K, Schieffer E, Holubarsch C, Just H, Drexler H. Differential effects of kinins of cardiomyocyte hypertrophy and interstitial collagen matrix in the surviving myocardium after myocardial infarction in the rat. Circulation. 1997;95:1910–1917.[Abstract/Free Full Text]

11. Pfeffer MA, Braunwald E. Ventricular remodeling after myocardial infarction. Circulation. 1990;81:1161–1172.[Abstract/Free Full Text]

12. Pfeffer MA, Pfeffer JM, Steinberg C, Finn P. Survival after an experimental myocardial infarction: beneficial effects of long-term therapy with captopril. Circulation. 1985;72:2:406–412.

13. Weber KT, Janicki JS, Schroff SG, Pick R, Chen RM, Bashey RI. Collagen remodeling of the pressure-overloaded, hypertrophied non-human primate myocardium. Circ Res. 1988;62:757–765.[Abstract/Free Full Text]

14. Nicoletti A, Heudes D, Hinglais N, Appay M-D, Philippe M, Sassy-Prigent C, Bariety J, Michel J-B. Left ventricular fibrosis in renovascular hypertensive rats: effect of losartan and spironolactone. Hypertension. 1995;26:101–111.[Abstract/Free Full Text]

15. Sahn DJ, DeMaria A, Kisslo J, Weyman A. Recommendations regarding quantitation in M-mode echocardiography: results of a survey of echocardiographic measurements. Circulation. 1978;58:1072–1083.[Abstract/Free Full Text]

16. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159.

17. Shirai T, Shimizu N, Horiguchi S, Ito H. Cloning and expression in Escherichia coli of the gene for rat tumor necrosis factor. Agric Biol Chem. 1989;53:1733–1736.

18. Feeser W, Freimark BD. Nucleotide sequence of rat prointerleukin-1 beta mRNA. From GenBank database 1992.

19. Northemann W, Braciak TA, Hattori M, Lee F, Fey GH. Structure of the rat interleukin 6 gene and its expression in macrophage-derived cells. J Biol Chem. 1989;264:16072–16082.[Abstract/Free Full Text]

20. Fort P, Marty L, Piechaczyk M, el Sabrouty S, Dani C, Jeanteur P, Blanchard JM. Various rat adult tissues express only one major mRNA species from the glyceraldehyde-3-phosphate-dehydrogenase multigenic family. Nucleic Acids Res. 1985;13:1431–1442.[Abstract/Free Full Text]

21. Pfeffer MA, Braunwald E. Ventricular remodeling after myocardial infarction: experimental observations and clinical implications. Circulation. 1990;81:1161–1172.

22. McKay RG, Pfeffer MA, Pasternak RC, Markis JE, Come PC, Nakao S, Alderman JD, Ferguson JJ, Safian RD, Grossman W. Left ventricular remodeling following myocardial infarction: a corollary to infarct expansion. Circulation. 1986;74:693–702.[Abstract/Free Full Text]

23. Abernethy M, Sharpe N, Smith H, Gamble G. Echocardiographic prediction of left ventricular volume after myocardial infarction. J Am Coll Cardiol. 1991;17:1527–1532.[Abstract]

24. Simpson PJ, Todd RF III, Mickelson JK, Fantone JC, Gallagher KP, Lee KA, Tamura Y, Cronin M, Lucchesi BR. Sustained limitation of myocardial reperfusion injury by a monoclonal antibody that alters leukocyte function. Circulation. 1990;81:226–237.[Abstract/Free Full Text]

25. Dreyer WJ, Michael LH, West MS, Smith CW, Rothlein R, Rossen RD, Anderson DC, Entman ML. Neutrophil accumulation in ischemic canine myocardium: insights into time course, distribution, and mechanism of localization during early reperfusion. Circulation. 1991;84:400–411.[Abstract/Free Full Text]

26. Herskowitz A, Choi S, Ansari AA, Wesselingh S. Cytokine mRNA expression in postischemic/reperfused myocardium. Am J Pathol. 1995;146:419–428.[Abstract]

27. Kukielka GL, Smith CW, Manning AM, Youker KA, Michael LH, Entman ML. Induction of interleukin-6 synthesis in the myocardium: potential role in postreperfusion inflammatory injury. Circulation. 1995;92:1866–1875.[Abstract/Free Full Text]

28. Kukielka GL, Smith CW, LaRosa GJ, Manning AM, Mendoza LH, Daly TJ, Hughes BJ, Youker KA, Hawkins HK, Michael LH, Rot A, Entman ML. Interleukin-8 gene induction in the myocardium after ischemia and reperfusion in vivo. J Clin Invest. 1995;95:89–103.

29. Habib FM, Springall DR, Davies GJ, Oakley CM, Yacoub MH, Polak JM. Tumour necrosis factor and inducible nitric oxide synthase in dilated cardiomyopathy. Lancet. 1996;347:1151–1155.[Medline] [Order article via Infotrieve]

30. Habib F, Dutka D, Crossman D, Oakley CM, Cleland JG. Enhanced basal nitric oxide production in heart failure: another failed counter-regulatory vasodilator mechanism? Lancet. 1994;344:371–373.[Medline] [Order article via Infotrieve]

31. Levine B, Kalman J, Mayer L, Fillit HM, Packer M. Elevated circulating levels of tumor necrosis factor in severe chronic heart failure. N Engl J Med. 1990;323:236–241.[Abstract]

32. Matsumori A, Yamada T, Suzuki H, Matoba Y, Sasayama S. Increased circulating cytokines in patients with myocarditis and cardiomyopathy. Br Heart J. 1994;72:561–566.[Abstract/Free Full Text]

33. Hegewisch S, Weh HJ, Hossfeld DK. TNF-induced cardiomyopathy. Lancet. 1990;335:294–295. Letter.[Medline] [Order article via Infotrieve]

34. Pinsky DJ, Cai B, Yang X, Rodriguez C, Sciacca RR, Cannon PJ. The lethal effects of cytokine-induced nitric oxide on cardiac myocytes are blocked by nitric oxide synthase antagonism or transforming growth factor ß. J Clin Invest. 1995;95:677–685.

35. Tsujino M, Hirata Y, Imai T, Kanno K, Eguchi S, Ito H, Marumo F. Induction of nitric oxide synthase gene by interleukin-1ß in cultured rat cardiocytes. Circulation. 1994;90:375–383.[Abstract/Free Full Text]

36. Thaik CM, Calderone A, Takahashi N, Colucci WS. Interleukin-1ß modulates the growth and phenotype of neonatal rat cardiac myocytes. J Clin Invest. 1995;96:1093–1099.

37. McCormick RJ, Musch TI, Bergman BC, Thomas DP. Regional differences in LV collagen accumulation and mature cross-linking after myocardial infarction in rats. Am J Physiol. 1994;266:H354–H359.[Abstract/Free Full Text]

38. Cleutjens JPM, Verluyten MJA, Smiths JFM, Daemen MJAP. Collagen remodeling after myocardial infarction in the rat heart. Am J Pathol. 1995;147:325–338.[Abstract]

39. Schmidt JA, Mizel SB, Cohen D, Green I. Interleukin 1, a potential regulator of fibroblast proliferation. J Immunol. 1982;128:2177–2182.[Medline] [Order article via Infotrieve]

40. Bitterman PB, Wewers MD, Rennard SI, Adelberg S, Crystal RG. Modulation of alveolar macrophage-driven fibroblast proliferation by alternative macrophage mediators. J Clin Invest. 1986;77:700–708.

41. Shioi T, Matsumori A, Sasayama S. Persistent expression of cytokine in the chronic stage of viral myocarditis in mice. Circulation. 1996;94:2930–2937.[Abstract/Free Full Text]

42. Palmer JN, Hartogensis WE, Patten M, Fortuin FD, Long CS. Interleukin-1ß induces cardiac myocyte growth but inhibits cardiac fibroblast proliferation in culture. J Clin Invest. 1995;95:2555–2564.

43. Thaik CM, Calderone A, Takahashi N, Cheng DLF, Colucci WS. Effects of inflammatory cytokines on growth and growth factor expression in cardiac myocytes and fibroblasts. Circulation. 1995;92(suppl I):I-569–I-570.

44. Hanemaaijer R, Koolwijk P, le Clercq L, de Vree WJ, van Hinsberg VW. Regulation of matrix metalloproteinase expression in human vein and microvascular endothelial cells: effects of tumour necrosis factor alpha, interleukin 1 and phorbol ester. Biochem J. 1993;296:803–809.

45. Cleutjens JP, Kandala JC, Guarda E, Guntaka RV, Weber KT. Regulation of collagen degradation in the rat myocardium after infarction. J Mol Cell Cardiol. 1995;27:1281–1292.[Medline] [Order article via Infotrieve]

46. Anversa P, Kajstura J, Olivetti G. Myocyte death in heart failure. Curr Opin Cardiol. 1996;11:245–251.[Medline] [Order article via Infotrieve]

47. Saraste A, Pulkki K, Kallajoki M, Henriksen K, Parvinen M, Voipio Pulkki LM. Apoptosis in human acute myocardial infarction. Circulation. 1997;95:320–323.[Abstract/Free Full Text]

48. Hirota H, Yoshida K, Kishimoto T, Taga T. Continuous activation of gp130, a signal-transducing receptor component for interleukin 6-related cytokines, causes myocardial hypertrophy in mice. Proc Natl Acad Sci U S A. 1995;92:4862–4866.[Abstract/Free Full Text]

49. Yamauchi-Takihara K, Ihara Y, Ogata A, Yoshizaki K, Azuma J, Kishimoto T. Hypoxic stress induces cardiac myocyte-derived interleukin-6. Circulation. 1995;91:1520–1524.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J Am Coll CardiolHome page
K. M. Eggers, B. Lagerqvist, P. Venge, L. Wallentin, and B. Lindahl
Prognostic Value of Biomarkers During and After Non-ST-Segment Elevation Acute Coronary Syndrome
J. Am. Coll. Cardiol., July 21, 2009; 54(4): 357 - 364.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
N. Isidoro Tavares, P. Philip-Couderc, A. J. Baertschi, R. Lerch, and C. Montessuit
Angiotensin II and tumour necrosis factor {alpha} as mediators of ATP-dependent potassium channel remodelling in post-infarction heart failure
Cardiovasc Res, June 11, 2009; (2009) cvp162v2.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
P. J. Hohensinner, C. Kaun, K. Rychli, A. Niessner, S. Pfaffenberger, G. Rega, A. Furnkranz, P. Uhrin, J. Zaujec, T. Afonyushkin, et al.
The inflammatory mediator oncostatin M induces stromal derived factor-1 in human adult cardiac cells
FASEB J, March 1, 2009; 23(3): 774 - 782.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
B.-C. Lee, H.-C. Hsu, W.-Y. I. Tseng, C.-Y. Chen, H.-J. Lin, Y.-L. Ho, M.-J. Su, and M.-F. Chen
Cell therapy generates a favourable chemokine gradient for stem cell recruitment into the infarcted heart in rabbits
Eur J Heart Fail, March 1, 2009; 11(3): 238 - 245.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
T. Kohno, T. Anzai, K. Naito, T. Miyasho, M. Okamoto, H. Yokota, S. Yamada, Y. Maekawa, T. Takahashi, T. Yoshikawa, et al.
Role of high-mobility group box 1 protein in post-infarction healing process and left ventricular remodelling
Cardiovasc Res, February 15, 2009; 81(3): 565 - 573.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. Krishnamurthy, J. Rajasingh, E. Lambers, G. Qin, D. W. Losordo, and R. Kishore
IL-10 Inhibits Inflammation and Attenuates Left Ventricular Remodeling After Myocardial Infarction via Activation of STAT3 and Suppression of HuR
Circ. Res., January 30, 2009; 104(2): e9 - e18.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H. Ishii, T. Amano, T. Matsubara, and T. Murohara
Pharmacological Intervention for Prevention of Left Ventricular Remodeling and Improving Prognosis in Myocardial Infarction
Circulation, December 16, 2008; 118(25): 2710 - 2718.
[Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. C. Hardwick, E. M. Southerland, and J. L. Ardell
Chronic myocardial infarction induces phenotypic and functional remodeling in the guinea pig cardiac plexus
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2008; 295(6): R1926 - R1933.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
K. Takahashi, S. Fukushima, K. Yamahara, K. Yashiro, Y. Shintani, S. R. Coppen, H. K. Salem, S. W. Brouilette, M. H. Yacoub, and K. Suzuki
Modulated Inflammation by Injection of High-Mobility Group Box 1 Recovers Post-Infarction Chronically Failing Heart
Circulation, September 30, 2008; 118(14_suppl_1): S106 - S114.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
K. Shivakumar, S. J. Sollott, M. Sangeetha, S. Sapna, B. Ziman, S. Wang, and E. G. Lakatta
Paracrine effects of hypoxic fibroblast-derived factors on the MPT-ROS threshold and viability of adult rat cardiac myocytes
Am J Physiol Heart Circ Physiol, June 1, 2008; 294(6): H2653 - H2658.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
R. Beeri, C. Yosefy, J. L. Guerrero, F. Nesta, S. Abedat, M. Chaput, F. del Monte, M. D. Handschumacher, R. Stroud, S. Sullivan, et al.
Mitral regurgitation augments post-myocardial infarction remodeling failure of hypertrophic compensation.
J. Am. Coll. Cardiol., January 29, 2008; 51(4): 476 - 486.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. Moro, M.-G. Jouan, A. Rakotovao, M.-C. Toufektsian, O. Ormezzano, N. Nagy, A. Tosaki, J. de Leiris, and F. Boucher
Delayed expression of cytokines after reperfused myocardial infarction: possible trigger for cardiac dysfunction and ventricular remodeling
Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H3014 - H3019.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
E. Vellaichamy, D. Zhao, N. Somanna, and K. N. Pandey
Genetic disruption of guanylyl cyclase/natriuretic peptide receptor-A upregulates ACE and AT1 receptor gene expression and signaling: role in cardiac hypertrophy
Physiol Genomics, October 19, 2007; 31(2): 193 - 202.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
M. L. Batista Jr., R. V. T. Santos, E. M. Oliveira, M. C. L. Seelaender, and L. F. B. P. Costa Rosa
Endurance training restores peritoneal macrophage function in post-MI congestive heart failure rats
J Appl Physiol, May 1, 2007; 102(5): 2033 - 2039.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
E. Westphal, Li Chen, C. Pilowski, S. Koch, H. Ebelt, U. Muller-Werdan, K. Werdan, and H. Loppnow
Endotoxin-activated cultured neonatal rat cardiomyocytes express functional surface-associated interleukin-1{alpha}
Innate Immunity, February 1, 2007; 13(1): 25 - 34.
[Abstract] [PDF]


Home page
Cardiovasc ResHome page
V. Adams, A. Linke, U. Wisloff, C. Doring, S. Erbs, N. Krankel, C. C. Witt, S. Labeit, U. Muller-Werdan, G. Schuler, et al.
Myocardial expression of Murf-1 and MAFbx after induction of chronic heart failure: Effect on myocardial contractility
Cardiovasc Res, January 1, 2007; 73(1): 120 - 129.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
Y. Li, G. Takemura, H. Okada, S. Miyata, R. Maruyama, L. Li, M. Higuchi, S. Minatoguchi, T. Fujiwara, and H. Fujiwara
Reduction of inflammatory cytokine expression and oxidative damage by erythropoietin in chronic heart failure
Cardiovasc Res, September 1, 2006; 71(4): 684 - 694.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
P. J. Lafontant, A. R. Burns, E. Donnachie, S. B. Haudek, C. W. Smith, and M. L. Entman
Oncostatin M differentially regulates CXC chemokines in mouse cardiac fibroblasts
Am J Physiol Cell Physiol, July 1, 2006; 291(1): C18 - C26.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
K. Kaur, A. K. Sharma, and P. K. Singal
Significance of changes in TNF-{alpha} and IL-10 levels in the progression of heart failure subsequent to myocardial infarction
Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H106 - H113.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
K. Nishikawa, M. Yoshida, M. Kusuhara, N. Ishigami, K. Isoda, K. Miyazaki, and F. Ohsuzu
Left ventricular hypertrophy in mice with a cardiac-specific overexpression of interleukin-1
Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H176 - H183.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
T. Miki, T. Miura, T. Yano, A. Takahashi, J. Sakamoto, M. Tanno, H. Kobayashi, Y. Ikeda, M. Nishihara, K. Naitoh, et al.
Alteration in Erythropoietin-Induced Cardioprotective Signaling by Postinfarct Ventricular Remodeling
J. Pharmacol. Exp. Ther., April 1, 2006; 317(1): 68 - 75.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
M. S. Guerra, R. Roncon-Albuquerque Jr, A. P. Lourenco, I. Falcao-Pires, P. Cibrao-Coutinho, and A. F. Leite-Moreira
Remote myocardium gene expression after 30 and 120 min of ischaemia in the rat
Exp Physiol, March 1, 2006; 91(2): 473 - 480.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
K. Trescher, O. Bernecker, B. Fellner, M. Gyongyosi, R. Schafer, S. Aharinejad, R. DeMartin, E. Wolner, and B. K. Podesser
Inflammation and postinfarct remodeling: Overexpression of I{kappa}B prevents ventricular dilation via increasing TIMP levels
Cardiovasc Res, February 15, 2006; 69(3): 746 - 754.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Matsumoto-Ida, Y. Takimoto, T. Aoyama, M. Akao, T. Takeda, and T. Kita
Activation of TGF-{beta}1-TAK1-p38 MAPK pathway in spared cardiomyocytes is involved in left ventricular remodeling after myocardial infarction in rats
Am J Physiol Heart Circ Physiol, February 1, 2006; 290(2): H709 - H715.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
R. G. Dean, L. C. Balding, R. Candido, W. C. Burns, Z. Cao, S. M. Twigg, and L. M. Burrell
Connective Tissue Growth Factor and Cardiac Fibrosis after Myocardial Infarction
J. Histochem. Cytochem., October 1, 2005; 53(10): 1245 - 1256.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. T. Cowling, X. Zhang, V. C. Reese, M. Iwata, D. Gurantz, W. H. Dillmann, and B. H. Greenberg
Effects of cytokine treatment on angiotensin II type 1A receptor transcription and splicing in rat cardiac fibroblasts
Am J Physiol Heart Circ Physiol, September 1, 2005; 289(3): H1176 - H1183.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Deten, G. Marx, W. Briest, H. Christian Volz, and H.-G. Zimmer
Heart function and molecular biological parameters are comparable in young adult and aged rats after chronic myocardial infarction
Cardiovasc Res, May 1, 2005; 66(2): 364 - 373.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
L. G. Bongartz, M. J. Cramer, P. A. Doevendans, J. A. Joles, and B. Braam
The severe cardiorenal syndrome: 'Guyton revisited'
Eur. Heart J., January 1, 2005; 26(1): 11 - 17.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. Sun, F. Dawood, W.-H. Wen, M. Chen, I. Dixon, L. A. Kirshenbaum, and P. P. Liu
Excessive Tumor Necrosis Factor Activation After Infarction Contributes to Susceptibility of Myocardial Rupture and Left Ventricular Dysfunction
Circulation, November 16, 2004; 110(20): 3221 - 3228.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Xie, M. Singh, and K. Singh
Differential Regulation of Matrix Metalloproteinase-2 and -9 Expression and Activity in Adult Rat Cardiac Fibroblasts in Response to Interleukin-1{beta}
J. Biol. Chem., September 17, 2004; 279(38): 39513 - 39519.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
K. Suzuki, B. Murtuza, J. R. Beauchamp, N. J. Brand, P. J. R. Barton, A. Varela-Carver, S. Fukushima, S. R. Coppen, T. A. Partridge, and M. H. Yacoub
Role of Interleukin-1{beta} in Acute Inflammation and Graft Death After Cell Transplantation to the Heart
Circulation, September 14, 2004; 110(11_suppl_1): II-219 - II-224.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
F. Jaffre, J. Callebert, A. Sarre, N. Etienne, C. G. Nebigil, J.-M. Launay, L. Maroteaux, and L. Monassier
Involvement of the Serotonin 5-HT2B Receptor in Cardiac Hypertrophy Linked to Sympathetic Stimulation: Control of Interleukin-6, Interleukin-1{beta}, and Tumor Necrosis Factor-{alpha} Cytokine Production by Ventricular Fibroblasts
Circulation, August 24, 2004; 110(8): 969 - 974.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
K. Sekiguchi, X. Li, M. Coker, M. Flesch, P. M Barger, N. Sivasubramanian, and D. L Mann
Cross-regulation between the renin-angiotensin system and inflammatory mediators in cardiac hypertrophy and failure
Cardiovasc Res, August 15, 2004; 63(3): 433 - 442.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. Francis, Z.-H. Zhang, R. M. Weiss, and R. B. Felder
Neural regulation of the proinflammatory cytokine response to acute myocardial infarction
Am J Physiol Heart Circ Physiol, August 1, 2004; 287(2): H791 - H797.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. C. Rebsamen, E. Perrier, C. Gerber-Wicht, J.-P. Benitah, and U. Lang
Direct and Indirect Effects of Aldosterone on Cyclooxygenase-2 and Interleukin-6 Expression in Rat Cardiac Cells in Culture and after Myocardial Infarction
Endocrinology, July 1, 2004; 145(7): 3135 - 3142.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. Berthonneche, T. Sulpice, F. Boucher, L. Gouraud, J. de Leiris, S. E. O'Connor, J.-M. Herbert, and P. Janiak
New insights into the pathological role of TNF-{alpha} in early cardiac dysfunction and subsequent heart failure after infarction in rats
Am J Physiol Heart Circ Physiol, July 1, 2004; 287(1): H340 - H350.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Nian, P. Lee, N. Khaper, and P. Liu
Inflammatory Cytokines and Postmyocardial Infarction Remodeling
Circ. Res., June 25, 2004; 94(12): 1543 - 1553.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. Francis, Y. Chu, A. K. Johnson, R. M. Weiss, and R. B. Felder
Acute myocardial infarction induces hypothalamic cytokine synthesis
Am J Physiol Heart Circ Physiol, June 1, 2004; 286(6): H2264 - H2271.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Murtuza, K. Suzuki, G. Bou-Gharios, J. R. Beauchamp, R. T. Smolenski, T. A. Partridge, and M. H. Yacoub
Transplantation of skeletal myoblasts secreting an IL-1 inhibitor modulates adverse remodeling in infarcted murine myocardium
PNAS, March 23, 2004; 101(12): 4216 - 4221.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. Takeshita, M. Hayashi, S. Iino, T. Kondo, Y. Inden, M. Iwase, T. Kojima, M. Hirai, M. Ito, D. J. Loskutoff, et al.
Increased Expression of Plasminogen Activator Inhibitor-1 in Cardiomyocytes Contributes to Cardiac Fibrosis after Myocardial Infarction
Am. J. Pathol., February 1, 2004; 164(2): 449 - 456.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Omura, M. Yoshiyama, S. Kim, R. Matsumoto, Y. Nakamura, Y. Izumi, H. Ichijo, T. Sudo, K. Akioka, H. Iwao, et al.
Involvement of Apoptosis Signal-Regulating Kinase-1 on Angiotensin II-Induced Monocyte Chemoattractant Protein-1 Expression
Arterioscler. Thromb. Vasc. Biol., February 1, 2004; 24(2): 270 - 275.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Z. Xie, M. Singh, D. A. Siwik, W. L. Joyner, and K. Singh
Osteopontin Inhibits Interleukin-1{beta}-stimulated Increases in Matrix Metalloproteinase Activity in Adult Rat Cardiac Fibroblasts: ROLE OF PROTEIN KINASE C-{zeta}
J. Biol. Chem., December 5, 2003; 278(49): 48546 - 48552.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. Aker, S. Belosjorow, I. Konietzka, A. Duschin, C. Martin, G. Heusch, and R. Schulz
Serum but not myocardial TNF-{alpha} concentration is increased in pacing-induced heart failure in rabbits
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2003; 285(2): R463 - R469.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Frantz, D. Fraccarollo, H. Wagner, T. M Behr, P. Jung, C. E Angermann, G. Ertl, and J. Bauersachs
Sustained activation of nuclear factor kappa B and activator protein 1 in chronic heart failure
Cardiovasc Res, March 1, 2003; 57(3): 749 - 756.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
L. Calabresi, G. Rossoni, M. Gomaraschi, F. Sisto, F. Berti, and G. Franceschini
High-Density Lipoproteins Protect Isolated Rat Hearts From Ischemia-Reperfusion Injury by Reducing Cardiac Tumor Necrosis Factor-{alpha} Content and Enhancing Prostaglandin Release
Circ. Res., February 21, 2003; 92(3): 330 - 337.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. Peng, D. Gurantz, V. Tran, R. T. Cowling, and B. H. Greenberg
Tumor Necrosis Factor-{alpha}-Induced AT1 Receptor Upregulation Enhances Angiotensin II-Mediated Cardiac Fibroblast Responses That Favor Fibrosis
Circ. Res., December 13, 2002; 91(12): 1119 - 1126.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart J SupplHome page
M. Fuchs and H. Drexler
Pharmacotherapy of chronic heart failure: current status and future aspects
Eur. Heart J. Suppl., December 1, 2002; 4(suppl_I): I81 - I87.
[Abstract] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
B. Tian, J. Liu, P. B. Bitterman, and R. J. Bache
Mechanisms of cytokine induced NO-mediated cardiac fibroblast apoptosis
Am J Physiol Heart Circ Physiol, November 1, 2002; 283(5): H1958 - H1967.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
R. M Smith, S. Lecour, and M. N Sack
Innate immunity and cardiac preconditioning: a putative intrinsic cardioprotective program
Cardiovasc Res, August 15, 2002; 55(3): 474 - 482.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
R. M Smith, N. Suleman, J. McCarthy, and M. N Sack
Classic ischemic but not pharmacologic preconditioning is abrogated following genetic ablation of the TNF{alpha} gene
Cardiovasc Res, August 15, 2002; 55(3): 553 - 560.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Deten, H. C. Volz, W. Briest, and H.-G. Zimmer
Cardiac cytokine expression is upregulated in the acute phase after myocardial infarction. Experimental studies in rats
Cardiovasc Res, August 1, 2002; 55(2): 329 - 340.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
W. Briest
Do we have a new early marker of chronic transplant dysfunction now?
Cardiovasc Res, June 1, 2002; 54(3): 492 - 494.
[Full Text] [PDF]


Home page
CirculationHome page
Y. T. Sia, N. Lapointe, T. G. Parker, J. N. Tsoporis, C. F. Deschepper, A. Calderone, A. Pourdjabbar, J.F. Jasmin, J.F. Sarrazin, P. Liu, et al.
Beneficial Effects of Long-Term Use of the Antioxidant Probucol in Heart Failure in the Rat
Circulation, May 28, 2002; 105(21): 2549 - 2555.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
N. Lapointe, C. Blais Jr, A. Adam, T. Parker, M. G. Sirois, H. Gosselin, R. Clement, and J. L. Rouleau
Comparison of the effects of an angiotensin-converting enzyme inhibitor and a vasopeptidase inhibitor after myocardial infarction in the rat
J. Am. Coll. Cardiol., May 15, 2002; 39(10): 1692 - 1698.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. T. Cowling, D. Gurantz, J. Peng, W. H. Dillmann, and B. H. Greenberg
Transcription Factor NF-kappa B Is Necessary for Up-regulation of Type 1 Angiotensin II Receptor mRNA in Rat Cardiac Fibroblasts Treated with Tumor Necrosis Factor-alpha or Interleukin-1beta
J. Biol. Chem., February 15, 2002; 277(8): 5719 - 5724.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Hara, K. Ono, M.-W. Hwang, A. Iwasaki, M. Okada, K. Nakatani, S. Sasayama, and A. Matsumori
Evidence for a Role of Mast Cells in the Evolution to Congestive Heart Failure
J. Exp. Med., February 4, 2002; 195(3): 375 - 381.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Mendez and M. C. LaPointe
Trophic Effects of the Cyclooxygenase-2 Product Prostaglandin E2 in Cardiac Myocytes
Hypertension, February 1, 2002; 39(2): 382 - 388.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
Y. T. Sia, T. G. Parker, P. Liu, J. N. Tsoporis, A. Adam, and J. L. Rouleau
Improved post-myocardial infarction survival with probucol in rats: Effects on left ventricular function, morphology, cardiac oxidative stress and cytokine expression
J. Am. Coll. Cardiol., January 2, 2002; 39(1): 148 - 156.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
P. O. Iversen, P. R. Woldbaek, T. Tonnessen, and G. Christensen
Decreased hematopoiesis in bone marrow of mice with congestive heart failure
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2002; 282(1): R166 - R172.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Takahashi, J. Nishihira, M. Shimpo, Y. Mizue, S. Ueno, H. Mano, E. Kobayashi, U. Ikeda, and K. Shimada
Macrophage migration inhibitory factor as a redox-sensitive cytokine in cardiac myocytes
Cardiovasc Res, December 1, 2001; 52(3): 438 - 445.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
M.-W. Hwang, A. Matsumori, Y. Furukawa, K. Ono, M. Okada, A. Iwasaki, M. Hara, T. Miyamoto, M. Touma, and S. Sasayama
Neutralization of interleukin-1{beta} in the acute phase of myocardial infarction promotes the progression of left ventricular remodeling
J. Am. Coll. Cardiol., November 1, 2001; 38(5): 1546 - 1553.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. O. Iversen, G. Nicolaysen, and M. Sioud
DNA enzyme targeting TNF-alpha mRNA improves hemodynamic performance in rats with postinfarction heart failure
Am J Physiol Heart Circ Physiol, November 1, 2001; 281(5): H2211 - H2217.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
K. Suzuki, B. Murtuza, R. T. Smolenski, I. A. Sammut, N. Suzuki, Y. Kaneda, and M. H. Yacoub
Overexpression of Interleukin-1 Receptor Antagonist Provides Cardioprotection Against Ischemia-Reperfusion Injury Associated With Reduction in Apoptosis
Circulation, September 18, 2001; 104 (2009): I-308 - I-313.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H. Kamihata, H. Matsubara, T. Nishiue, S. Fujiyama, Y. Tsutsumi, R. Ozono, H. Masaki, Y. Mori, O. Iba, E. Tateishi, et al.
Implantation of Bone Marrow Mononuclear Cells Into Ischemic Myocardium Enhances Collateral Perfusion and Regional Function via Side Supply of Angioblasts, Angiogenic Ligands, and Cytokines
Circulation, August 28, 2001; 104(9): 1046 - 1052.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. P. Liu and J. W. Mason
Advances in the Understanding of Myocarditis
Circulation, August 28, 2001; 104(9): 1076 - 1082.
[Full Text] [PDF]


Home page
Circ. Res.Home page
B. D. Hoit
Two Faces of Nitric Oxide: Lessons Learned From the NOS2 Knockout
Circ. Res., August 17, 2001; 89(4): 289 - 291.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. Burger, M. Benicke, A. Deten, and H.-G. Zimmer
Catecholamines stimulate interleukin-6 synthesis in rat cardiac fibroblasts
Am J Physiol Heart Circ Physiol, July 1, 2001; 281(1): H14 - H21.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. P. Loennechen, A. Stoylen, V. Beisvag, U. Wisloff, and O. Ellingsen
Regional expression of endothelin-1, ANP, IGF-1, and LV wall stress in the infarcted rat heart
Am J Physiol Heart Circ Physiol, June 1, 2001; 280(6): H2902 - H2910.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
K. Abe, M. Tokumura, T. Ito, T. Murai, A. Takashima, and N. Ibii
Involvement of iNOS in postischemic heart dysfunction of stroke-prone spontaneously hypertensive rats
Am J Physiol Heart Circ Physiol, February 1, 2001; 280(2): H668 - H673.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. K. Damas, H. G. Eiken, E. Oie, V. Bjerkeli, A. Yndestad, T. Ueland, T. Tonnessen, O. R. Geiran, H. Aass, S. Simonsen, et al.
Myocardial expression of CC- and CXC-chemokines and their receptors in human end-stage heart failure
Cardiovasc Res, September 1, 2000; 47(4): 778 - 787.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
D. A. Siwik, D. L.-F. Chang, and W. S. Colucci
Interleukin-1{beta} and Tumor Necrosis Factor-{alpha} Decrease Collagen Synthesis and Increase Matrix Metalloproteinase Activity in Cardiac Fibroblasts In Vitro
Circ. Res., June 23, 2000; 86(12): 1259 - 1265.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. Oie, R. Bjornerheim, O. P. F. Clausen, and H. Attramadal
Cyclosporin A inhibits cardiac hypertrophy and enhances cardiac dysfunction during postinfarction failure in rats
Am J Physiol Heart Circ Physiol, June 1, 2000; 278(6): H2115 - H2123.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
L. W. Stanton, L. J. Garrard, D. Damm, B. L. Garrick, A. Lam, A. M. Kapoun, Q. Zheng, A. A. Protter, G. F. Schreiner, and R. T. White
Altered Patterns of Gene Expression in Response to Myocardial Infarction
Circ. Res., May 12, 2000; 86(9): 939 - 945.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. D. Prabhu, B. Chandrasekar, D. R. Murray, and G. L. Freeman
{beta}-Adrenergic Blockade in Developing Heart Failure : Effects on Myocardial Inflammatory Cytokines, Nitric Oxide, and Remodeling
Circulation, May 2, 2000; 101(17): 2103 - 2109.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
N. Nagaya, T. Nishikimi, F. Yoshihara, T. Horio, A. Morimoto, and K. Kangawa
Cardiac adrenomedullin gene expression and peptide accumulation after acute myocardial infarction in rats
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2000; 278(4): R1019 - R1026.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Nakamura, N.-P. Wang, Z.-Q. Zhao, J. N Wilcox, V. Thourani, R. A Guyton, and J. Vinten-Johansen
Preconditioning decreases Bax expression, PMN accumulation and apoptosis in reperfused rat heart
Cardiovasc Res, February 1, 2000; 45(3): 661 - 670.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
E. Isenovic and M. C. LaPointe
Role of Ca2+-Independent Phospholipase A2 in the Regulation of Inducible Nitric Oxide Synthase in Cardiac Myocytes
Hypertension, January 1, 2000; 35(1): 249 - 254.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Azzawi and P. Hasleton
Tumour necrosis factor alpha and the cardiovascular system: its role in cardiac allograft rejection and heart disease
Cardiovasc Res, September 1, 1999; 43(4): 850 - 859.
[Full Text] [PDF]


Home page
Circ. Res.Home page
D. Gurantz, R. T. Cowling, F. J. Villarreal, and B. H. Greenberg
Tumor Necrosis Factor-{alpha} Upregulates Angiotensin II Type 1 Receptors on Cardiac Fibroblasts
Circ. Res., August 6, 1999; 85(3): 272 - 279.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Sasayama, A. Matsumori, and Y. Kihara
New insights into the pathophysiological role for cytokines in heart failure
Cardiovasc Res, June 1, 1999; 42(3): 557 - 564.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. M.B Pinto and P. A Boyden
Electrical remodeling in ischemia and infarction
Cardiovasc Res, May 1, 1999; 42(2): 284 - 297.
[Abstract] [Full Text] [PDF]


Home page
Eur. J. Cardiothorac. Surg.Home page
A. Liebold, C. Keyl, and D. E. Birnbaum
The heart produces but the lungs consume proinflammatory cytokines following cardiopulmonary bypass
Eur. J. Cardiothorac. Surg., March 1, 1999; 15(3): 340 - 345.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. A. Trueblood, Z. Xie, C. Communal, F. Sam, S. Ngoy, L. Liaw, A. W. Jenkins, J. Wang, D. B. Sawyer, O. H. L. Bing, et al.
Exaggerated Left Ventricular Dilation and Reduced Collagen Deposition After Myocardial Infarction in Mice Lacking Osteopontin
Circ. Res., May 25, 2001; 88(10): 1080 - 1087.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
F. Sam, D. B. Sawyer, Z. Xie, D. L.F. Chang, S. Ngoy, D. A. Brenner, D. A. Siwik, K. Singh, C. S. Apstein, and W. S. Colucci
Mice Lacking Inducible Nitric Oxide Synthase Have Improved Left Ventricular Contractile Function and Reduced Apoptotic Cell Death Late After Myocardial Infarction
Circ. Res., August 17, 2001; 89(4): 351 - 356.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ono, K.
Right arrow Articles by Sasayama, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ono, K.
Right arrow Articles by Sasayama, S.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Heart Attack