| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Cardiovascular Medicine, Kyoto University,
Graduate School of Medicine, Kyoto, Japan.
Correspondence to Akira Matsumori, MD, PhD, Department of Cardiovascular Medicine, Kyoto University, 54 Kawara-cho, Shogoin, Sakyo-Ku, Kyoto 606, Japan.
Methods and ResultsIn a rat model of myocardial infarction,
progressive dilatation of the left ventricular cavity and
lack of appropriate hypertrophy of the surviving
myocardium were confirmed by transthoracic
echocardiography. The relative expression of mRNA
for tumor necrosis factor (TNF)-
ConclusionsThese findings suggest the possible involvement of
cytokines during the remodeling process of the noninfarcted
left ventricular myocardium.
Determination of Infarct Size and Histological Analysis
For the determination of cardiac collagen density, slide images were
obtained of the noninfarcted interventricular septum at a
x400 magnification. Three sections per animal and 20 fields per
section were scanned and computerized with a LUSEX3 digital image
analyzer on the basis of the red staining of the collagen.
Volume collagen fraction was calculated as the sum of all connective
tissue areas divided by the total area of the image. Perivascular
collagen was excluded from this measurement. It has been shown that the
total volume fraction determined by this morphometric approach is
closely related to hydroxyproline concentration of the
ventricle.13 14
Echocardiographic Studies
LV FS (%) = [(EDD-ESD) / EDD] x 100
RWT = 2 x PWT / EDD
RNA Preparation and First-Strand cDNA Synthesis
Competitive PCR
Composite primers comprising the TNF-
Immunohistochemistry
Statistical Analyses
Echocardiographic Study
PCR Analysis of Cytokine Genes
Histological Study
Immunohistochemistry
In acute ischemia leading to permanent myocyte injury, complex
local interactions exist among endothelial cells,
accumulation of infiltrating leukocytes, and tissue-based monocytes and
myocytes.24 25 Recent studies have followed the
temporal sequence of proinflammatory cytokine gene expression
in postischemic/reperfused
myocardium.26 27 28 However, those
studies addressed the postischemic myocardial inflammation
that occurs at a relatively acute stage, and the role of
cytokines on LV remodeling has not been thoroughly studied.
Habib et al29 30 localized the inducible form of
nitric oxide synthase (iNOS) and TNF-
It is becoming increasingly apparent that proinflammatory
cytokines play an important role in modulating the function and
structure of the heart. Elevated concentrations of TNF-
IL-1ß has deleterious effects on cardiac
contractility in isolated perfused rat
hearts.4 IL-1ß, TNF-
High cytokine levels have been found to activate
metalloproteinase under certain conditions.44 Cleutjens et al45 reported that
posttranslational activation of latent
collagenase (MMP-1) plays a predominant role at
the site of infarction, and this activation, measured by zymography,
began at day 2, peaked at day 7, and declined thereafter,
somewhat earlier than our findings of increased expression of
cytokines in the noninfarcted myocardium; in
addition, Cleutjens et al found no changes in MMP-1 activity at remote
sites or in sham-operated controls. Therefore, the contribution of
extracellular proteolysis seems relatively small in the present
study, and the positive correlation between IL-1ß
expression and collagen deposition suggests that increased
production exceeds its degradation.
In addition to necrosis, myocyte loss induced by apoptosis has
recently been proposed as an important mechanism in the pathogenesis of
CHF.46 However, Saraste et
al47 observed few apoptotic cells in the
remote, noninfarcted myocardium, and the contribution of
apoptotic myocyte death on interstitial fibrosis in
the surviving myocardium remains unknown.
An increasing number of experimental observations suggest that IL-6 is
also capable of modulating cardiovascular function,
exerting a negative inotropic effect through NO-dependent pathways as
well.5 Mice with overexpression of both IL-6 and
IL-6 receptors have been reported to show constitutive tyrosine
phosphorylation of gp130 and to develop cardiac
hypertrophy.48 Cardiac myocytes are
reported to produce IL-6 under hypoxic stress.49
Therefore, in the present experiment, IL-6 in the noninfarcted
myocardium may have been upregulated by relative
ischemia in the hypertrophied myocyte itself.
The mechanisms responsible for the upregulation of cytokine
gene expression in the noninfarcted myocardium are not
known. Further experiments will be directed toward determining the
mechanism of cytokine induction and the
physiological role of the intracardiac
cytokine system.
Received November 5, 1997;
revision received December 12, 1997;
accepted January 23, 1998.
2.
Fuster V, Badimon L, Badimon JJ, Chesebro JH. The
pathogenesis of coronary artery disease and the acute
coronary syndromes, II. N Engl J Med. 1992;326:310318.[Medline]
[Order article via Infotrieve]
3.
Davis MJ. A macro and micro view of coronary
vascular insult in ischemic heart disease.
Circulation. 1990;82(suppl II):II-38II-46.
4.
Hosenpud JD, Campbell SM, Mendelson DJ.
Interleukin-1-induced myocardial depression in an isolated beating
heart preparation. J Heart Transplant. 1989;8:460464.[Medline]
[Order article via Infotrieve]
5.
Finkel MS, Oddis CV, Jacob TD, Watkins SC, Hattler BG,
Simmons RL. Negative inotropic effects of cytokines on the
heart mediated by nitric oxide. Science. 1992;257:387389.
6.
Balligand JL, Ungureanu-Longrois D, Kelly RA, Kobzik
L, Pimental D, Michel T, Smith TW. Abnormal contractile function due to
induction of nitric oxide synthesis in rat cardiac myocytes follows
exposure to activated macrophage-conditioned medium.
J Clin Invest. 1993;91:23142319.
7.
Libby P, Warner SJ, Friedman GB. Interleukin 1: a
mitogen for human vascular smooth muscle cells that induces the release
of growth-inhibitory prostanoid. J Clin
Invest. 1988;81:487498.
8.
Boluyt MO, O'Neill L, Meredith AL, Bing OH, Brooks
WW, Conrad CH, Crow MT, Lakatta EG. Alterations in cardiac gene
expression during the transition from stable hypertrophy to
heart failure: marked upregulation of genes encoding extracellular
matrix components. Circ Res. 1994;75:2332.
9.
Woodley SL, McMillan M, Shelby J, Lynch DH, Roberts
LK, Ensley RD, Barry WH. Myocyte injury and contraction abnormalities
produced by cytotoxic T lymphocytes. Circulation. 1991;83:14101418.
10.
Wollert KC, Studer R, Doerfer K, Schieffer E,
Holubarsch C, Just H, Drexler H. Differential effects of kinins of
cardiomyocyte hypertrophy and
interstitial collagen matrix in the surviving
myocardium after myocardial infarction in the rat.
Circulation. 1997;95:19101917.
11.
Pfeffer MA, Braunwald E. Ventricular
remodeling after myocardial infarction. Circulation. 1990;81:11611172.
12.
Pfeffer MA, Pfeffer JM, Steinberg C, Finn P. Survival
after an experimental myocardial infarction: beneficial effects of
long-term therapy with captopril. Circulation. 1985;72:2:406412.
13.
Weber KT, Janicki JS, Schroff SG, Pick R, Chen RM,
Bashey RI. Collagen remodeling of the pressure-overloaded,
hypertrophied non-human primate myocardium. Circ
Res. 1988;62:757765.
14.
Nicoletti A, Heudes D, Hinglais N, Appay M-D, Philippe
M, Sassy-Prigent C, Bariety J, Michel J-B. Left ventricular
fibrosis in renovascular hypertensive rats: effect of losartan
and spironolactone. Hypertension. 1995;26:101111.
15.
Sahn DJ, DeMaria A, Kisslo J, Weyman A. Recommendations
regarding quantitation in M-mode echocardiography:
results of a survey of echocardiographic measurements.
Circulation. 1978;58:10721083.
16.
Chomczynski P, Sacchi N. Single-step method of RNA
isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem. 1987;162:156159.
17.
Shirai T, Shimizu N, Horiguchi S, Ito H. Cloning and
expression in Escherichia coli of the gene for rat tumor
necrosis factor. Agric Biol Chem. 1989;53:17331736.
18.
Feeser W, Freimark BD. Nucleotide sequence
of rat prointerleukin-1 beta mRNA. From GenBank database 1992.
19.
Northemann W, Braciak TA, Hattori M, Lee F, Fey GH.
Structure of the rat interleukin 6 gene and its expression in
macrophage-derived cells. J Biol Chem. 1989;264:1607216082.
20.
Fort P, Marty L, Piechaczyk M, el Sabrouty S, Dani C,
Jeanteur P, Blanchard JM. Various rat adult tissues express only one
major mRNA species from the
glyceraldehyde-3-phosphate-dehydrogenase multigenic
family. Nucleic Acids Res. 1985;13:14311442.
21.
Pfeffer MA, Braunwald E. Ventricular
remodeling after myocardial infarction: experimental observations and
clinical implications. Circulation. 1990;81:11611172.
22.
McKay RG, Pfeffer MA, Pasternak RC, Markis JE, Come PC,
Nakao S, Alderman JD, Ferguson JJ, Safian RD, Grossman W. Left
ventricular remodeling following myocardial infarction: a
corollary to infarct expansion. Circulation. 1986;74:693702.
23.
Abernethy M, Sharpe N, Smith H, Gamble G.
Echocardiographic prediction of left
ventricular volume after myocardial infarction.
J Am Coll Cardiol. 1991;17:15271532.[Abstract]
24.
Simpson PJ, Todd RF III, Mickelson JK, Fantone JC,
Gallagher KP, Lee KA, Tamura Y, Cronin M, Lucchesi BR. Sustained
limitation of myocardial reperfusion injury by a monoclonal antibody
that alters leukocyte function. Circulation. 1990;81:226237.
25.
Dreyer WJ, Michael LH, West MS, Smith CW, Rothlein R,
Rossen RD, Anderson DC, Entman ML. Neutrophil accumulation in
ischemic canine myocardium: insights into time
course, distribution, and mechanism of localization during early
reperfusion. Circulation. 1991;84:400411.
26.
Herskowitz A, Choi S, Ansari AA, Wesselingh S.
Cytokine mRNA expression in postischemic/reperfused
myocardium. Am J Pathol. 1995;146:419428.[Abstract]
27.
Kukielka GL, Smith CW, Manning AM, Youker KA, Michael
LH, Entman ML. Induction of interleukin-6 synthesis in the
myocardium: potential role in postreperfusion inflammatory
injury. Circulation. 1995;92:18661875.
28.
Kukielka GL, Smith CW, LaRosa GJ, Manning AM, Mendoza
LH, Daly TJ, Hughes BJ, Youker KA, Hawkins HK, Michael LH, Rot A,
Entman ML. Interleukin-8 gene induction in the myocardium
after ischemia and reperfusion in vivo. J Clin
Invest. 1995;95:89103.
29.
Habib FM, Springall DR, Davies GJ, Oakley CM, Yacoub
MH, Polak JM. Tumour necrosis factor and inducible nitric oxide
synthase in dilated cardiomyopathy.
Lancet. 1996;347:11511155.[Medline]
[Order article via Infotrieve]
30.
Habib F, Dutka D, Crossman D, Oakley CM, Cleland JG.
Enhanced basal nitric oxide production in heart failure:
another failed counter-regulatory vasodilator mechanism?
Lancet. 1994;344:371373.[Medline]
[Order article via Infotrieve]
31.
Levine B, Kalman J, Mayer L, Fillit HM, Packer M.
Elevated circulating levels of tumor necrosis factor in severe chronic
heart failure. N Engl J Med. 1990;323:236241.[Abstract]
32.
Matsumori A, Yamada T, Suzuki H, Matoba Y, Sasayama S.
Increased circulating cytokines in patients with myocarditis
and cardiomyopathy. Br Heart J. 1994;72:561566.
33.
Hegewisch S, Weh HJ, Hossfeld DK. TNF-induced
cardiomyopathy. Lancet. 1990;335:294295. Letter.[Medline]
[Order article via Infotrieve]
34.
Pinsky DJ, Cai B, Yang X, Rodriguez C, Sciacca RR,
Cannon PJ. The lethal effects of cytokine-induced nitric
oxide on cardiac myocytes are blocked by nitric oxide synthase
antagonism or transforming growth factor ß. J Clin
Invest. 1995;95:677685.
35.
Tsujino M, Hirata Y, Imai T, Kanno K, Eguchi S, Ito H,
Marumo F. Induction of nitric oxide synthase gene by
interleukin-1ß in cultured rat cardiocytes.
Circulation. 1994;90:375383.
36.
Thaik CM, Calderone A, Takahashi N, Colucci WS.
Interleukin-1ß modulates the growth and phenotype of
neonatal rat cardiac myocytes. J Clin Invest. 1995;96:10931099.
37.
McCormick RJ, Musch TI, Bergman BC, Thomas DP.
Regional differences in LV collagen accumulation and mature
cross-linking after myocardial infarction in rats. Am J
Physiol. 1994;266:H354H359.
38.
Cleutjens JPM, Verluyten MJA, Smiths JFM, Daemen MJAP.
Collagen remodeling after myocardial infarction in the rat heart.
Am J Pathol. 1995;147:325338.[Abstract]
39.
Schmidt JA, Mizel SB, Cohen D, Green I. Interleukin 1,
a potential regulator of fibroblast proliferation. J
Immunol. 1982;128:21772182.[Medline]
[Order article via Infotrieve]
40.
Bitterman PB, Wewers MD, Rennard SI, Adelberg S,
Crystal RG. Modulation of alveolar macrophage-driven fibroblast
proliferation by alternative macrophage mediators. J
Clin Invest. 1986;77:700708.
41.
Shioi T, Matsumori A, Sasayama S. Persistent
expression of cytokine in the chronic stage of viral
myocarditis in mice. Circulation. 1996;94:29302937.
42.
Palmer JN, Hartogensis WE, Patten M, Fortuin FD, Long
CS. Interleukin-1ß induces cardiac myocyte growth but inhibits
cardiac fibroblast proliferation in culture. J Clin
Invest. 1995;95:25552564.
43.
Thaik CM, Calderone A, Takahashi N, Cheng DLF, Colucci
WS. Effects of inflammatory cytokines on growth and growth
factor expression in cardiac myocytes and fibroblasts.
Circulation. 1995;92(suppl I):I-569I-570.
44.
Hanemaaijer R, Koolwijk P, le Clercq L, de Vree WJ, van
Hinsberg VW. Regulation of matrix metalloproteinase expression in human
vein and microvascular endothelial cells: effects of
tumour necrosis factor alpha, interleukin 1 and phorbol ester.
Biochem J. 1993;296:803809.
45.
Cleutjens JP, Kandala JC, Guarda E, Guntaka RV, Weber
KT. Regulation of collagen degradation in the rat
myocardium after infarction. J Mol Cell Cardiol. 1995;27:12811292.[Medline]
[Order article via Infotrieve]
46.
Anversa P, Kajstura J, Olivetti G. Myocyte death in
heart failure. Curr Opin Cardiol. 1996;11:245251.[Medline]
[Order article via Infotrieve]
47.
Saraste A, Pulkki K, Kallajoki M, Henriksen K, Parvinen
M, Voipio Pulkki LM. Apoptosis in human acute myocardial
infarction. Circulation. 1997;95:320323.
48.
Hirota H, Yoshida K, Kishimoto T, Taga T. Continuous
activation of gp130, a signal-transducing receptor component for
interleukin 6-related cytokines, causes myocardial
hypertrophy in mice. Proc Natl Acad Sci U S A. 1995;92:48624866.
49.
Yamauchi-Takihara K, Ihara Y, Ogata A, Yoshizaki K,
Azuma J, Kishimoto T. Hypoxic stress induces cardiac myocyte-derived
interleukin-6. Circulation. 1995;91:15201524.
© 1998 American Heart Association, Inc.
Basic Science Reports
Cytokine Gene Expression After Myocardial Infarction in Rat Hearts
Possible Implication in Left Ventricular Remodeling
![]()
Abstract
Top
Abstract
Introduction
Methods
Results
Discussion
References
BackgroundA large transmural
myocardial infarction may initiate structural and geometric changes in
the left ventricle that are commonly referred to as remodeling.
Progressive, adverse remodeling of the myocardium may lead
to ventricular dilatation and congestive heart failure.
Recent studies have highlighted the effects of some cytokines
on immune-mediated myocyte injury, postischemic myocardial
inflammation, and cardiac function. However, studies of the involvement
of cytokines in remodeling of the heart are few.
, interleukin (IL)-1ß, and IL-6 in
the infarcted and noninfarcted myocardium of these rats, as
well as in a group of sham-operated animals, was assessed by the
technique of quantitative polymerase chain reaction amplification. In
the infarcted region, TNF-
, IL-1ß, and IL-6 gene expression peaked
at 1 week after infarction and decreased rapidly thereafter. In
contrast, at 20 weeks after infarction, the gene expression levels of
these cytokines remained significantly higher in the
noninfarcted than in the infarcted zone or in the
myocardium of sham-operated animals. Furthermore, the
levels of these cytokines in the noninfarcted region correlated
with the left ventricular end-diastolic
diameter measured at 8 and 20 weeks after infarction. Among these
cytokines, IL-1ß expression was highest, and its
level correlated well with collagen deposition in the noninfarcted
myocardium at 8 and 20 weeks after surgery. At 20 weeks
after infarction, immunohistochemical analysis revealed the
presence of IL-1ß in macrophages, endothelial
cells, and vascular smooth muscle cells in the noninfarcted region,
whereas no such immunoreactivity was found in the
myocardium of sham-operated animals.
Key Words: cytokines remodeling myocardial infarction immunohistochemistry
![]()
Introduction
Top
Abstract
Introduction
Methods
Results
Discussion
References
Ischemic heart
disease is the leading cause of CHF in most Western
countries.1 2 A large transmural MI may initiate
a cascade of progressive structural and geometric changes in the LV
that is commonly referred to as remodeling. The remodeling process is
believed to serve initially as a compensatory mechanism to maintain
cardiac output. However, these architectural changes may eventually
contribute to the development of congestive symptoms from afterload
mismatch and exacerbation of LV dysfunction.3 The
effects of cytokines on immune-mediated myocyte injury and
myocardial function have been studied in depth recently.
Cytokines such as IL-1ß or TNF-
have negative inotropic
effects in the isolated perfused heart,4
papillary muscle preparation,5 and cultured
myocytes.6 IL-1ß activates
fibroblasts,7 which might affect the remodeling
process of the heart.8 In addition to these
humoral effects, these cytokines may cause direct myocyte
injury by activating cytotoxic T cells.9 In the
present study, the remodeling of the LV in a rat model of MI was
monitored with transthoracic
echocardiography, whereas the expression of
cytokines in the infarcted and noninfarcted
myocardium and in the hearts of sham-operated animals was
examined by use of quantitative reverse transcriptase PCR and
immunohistochemical analysis.
![]()
Methods
Top
Abstract
Introduction
Methods
Results
Discussion
References
Experimental MI
Male Wistar rats weighing 250 to 300 g were
anesthetized by intraperitoneal injection
of sodium pentobarbital (50 mg/kg) intubated, and ventilated with a
volume-cycled small-animal respirator. After the heart was exposed via
a left anterior thoracotomy, the left anterior descending
coronary artery was ligated proximally with a 70 silk suture.
Positive end-expiratory pressure was applied to fully inflate the
lungs, and the chest was closed in layers. Another group of rats
underwent the identical procedure without ligation of the
coronary artery. Four animals from each group were killed by
excision of the heart under pentobarbital anesthesia at 1,
8, and 20 weeks after surgery, respectively.
The LV and septum were separated from the right ventricle and
weighed. The LV was cut into six transverse slices from apex to base.
The first, third, and fifth slices were fixed in 10% formalin, and the
remaining three were used for RNA preparation. The former three slices
were embedded in paraffin and cut into 4-µm sections that were
mounted onto slides and stained with Sirius red F3BA (0.1% solution in
saturated aqueous picric acid) to allow a clear discrimination between
cardiomyocytes and collagen
matrix.10 The endocardial and epicardial
circumferences of the infarcted and noninfarcted LV were outlined with
a digital image analyzer (LUSEX3, Nikon). The
infarcted mean circumference (mean of endocardial and epicardial
circumferences) of the three slices was summed and expressed as the
ratio of summed mean circumference of the LV, as described by Pfeffer
et al.11 12
The evolution of the LV dimensions and function in vivo was
followed by transthoracic
echocardiography performed at 0, 1, 4, 8, and 20
weeks after surgery (Hewlett-Packard) with a 7.5-MHz sector scan probe.
Under light anesthesia with sodium pentobarbital (15 mg/kg
IM), the animal was placed in the supine position and the chest was
shaved. The ultrasound probe was placed in gentle contact with the mid
precordial area through a transmission medium. M-mode
echocardiograms, guided by two-dimensional long-axis images, were
obtained through the anterior and posterior LV walls at the level of
the papillary muscles and recorded at a paper speed of 100
mm/s. The LV EDD and ESD were measured from the M-mode tracings
according to the American Society for Echocardiology
leading-edge method.15 The LV posterior wall
thickness (PWT) was measured at end diastole. For each
measurement, data from at least three consecutive cardiac cycles were
averaged. LV fractional shortening (FS) and RWT were calculated
according to the following formulas:
Infarcted hearts at 1, 8, and 20 weeks after surgery were
sectioned into noninfarcted and infarcted areas by visual inspections;
beginning 1 week after coronary ligation, the infarcted area
becomes pale and can be easily distinguished from normal
myocardium. The border zone was included in the infarcted
area. Total RNA was isolated by use of the guanidinium
thiocyanate/phenol/chloroform/isoamyl alcohol
procedure.16 Total RNA (10 µg) was subjected to
first-strand cDNA synthesis in a 40-µL reaction mixture containing
50 mmol/L Tris-HCl (pH 8.3), 75 mmol/L KCl, 3 mmol/L
MgCl2, 1 mmol/L dNTP (Perkin-Elmer Cetus),
0.825-optical density random hexamers (Pharmacia LKB Biotechnology
Inc), 40 U of RNAasin (Promega Corp), and 200 U of murine leukemia
virus reverse transcriptase (Gibco BRL). The reaction mixture was
incubated at 37°C for 60 minutes, heated to 70°C for 5 minutes to
denature the reverse transcriptase, then cooled on ice for 3 minutes.
Water (60 µL) was added to each sample, and the samples were stored
at -20°C.
Competitive PCR was performed by titration of sample cDNA with
known amounts of nonhomologous TNF-
, IL-1ß, IL-6, and GAPDH-MIMIC
standard produced with the use of the Clontech PCR MIMIC construction
kit. Briefly, a sense primer (A) and an antisense primer (B) for rat
TNF-
,17 rat IL-1ß,18
rat IL-6,19 and rat GAPDH20
were synthesized with the use of the published cDNA sequences. The
actual sequences of the oligonucleotides were as
follows: TNF-
A, 5'-ATGAGCACGGAAAGCATGATCCGA-3'; TNF-
B,
5'-CCAAAGTAGACCTGCCCGGACTC-3'; IL-1ß A,
5'-ATGGCAACTGTCCCTGAACTCAACT-3'; IL-1ß B,
5'-CAGGACAGGTATAGATTCAACCCCTT-3'; IL-6 A,
5'-CCAGTTGCCTTCTTGGGACTGATG-3'; IL-6 B,
5'-ATTTTCTGACCACAGTGAGGAATG-3'; GAPDH A,
5'-TTCTTGTGCAGTGCCAGCCTCGTC-3'; and GAPDH B,
5'-TAGGAACACGGAAGGCCATGCCAG-3'.
, IL-1ß, IL-6, and GAPDH
gene-specific primers described above with v-erb B
oncogene-specific 20-nucleotide base sequences at the 3'
end (upstream, CGCAAGTGAAATCTCCTCCG; downstream,
TCTGTCAATG CAGTTTGTAG) were used to construct fragments of the
v-erb B oncogene with TNF-
, IL-1ß, IL-6, and
GAPDH-specific sequences at the 5' end of each strand. These TNF-
,
IL-1ß, IL-6, and GAPDH-MIMIC sequences were amplified by use of the
noncomposite TNF-
, IL-1ß, IL-6, and GAPDH-specific primers
described above, and the molar quantity produced was determined. Ten
micrograms of total RNA was used as template for cDNA synthesis. Two
percent portions of the cDNA were then amplified in the presence of
twofold dilutions of each of the TNF-
, IL-1ß, IL-6, and
GAPDH-MIMIC sequences. Each PCR reaction contained 100 µmol/L
dNTP, 0.5 µmol/L of each specific primer, 10 mmol/L
Tris-HCl (pH 8.3), 50 mmol/L KCl, 1.5 mmol/L
MgCl2, 0.001% gelatin, and 0.25 U of Taq
polymerase (Cetus) in a volume of 25 µL.
[
32P]dCTP was included in the reaction to
quantify the PCR products. Each cycle consisted of denaturation at
94°C for 45 seconds, annealing at 55°C for 45 seconds, and
extension at 72°C for 90 seconds. TNF-
, IL-1ß, and IL-6 were
amplified by 30 cycles of PCR, and GAPDH was amplified by 21 cycles
under the conditions in which linearity of the amplification was
confirmed. A 30% portion of the PCR reaction products was then
resolved by electrophoresis on a 4% polyacrylamide gel and
examined by use of a FUJIX bioimaging analyzer BAS 2000. The
molar ratio between the internal control and target was calculated
according to the following formula:
where IT and IC
represent the intensity of the PCR product from the target
and the internal control, respectively, and CC
and CT represent the dCTP content in the
PCR product from the target and the internal control. The amount of
target molecule was determined as the point of an equimolar ratio
between the internal control and the target (Figure 1

). The amounts of TNF-
, IL-1ß, and
IL-6 were divided by those of GAPDH to correct the efficiency of cDNA
synthesis.

View larger version (20K):
[in a new window]
Figure 1. Representative quantitative PCR
analysis of IL-1ß mRNA using internal controls. A, Lane 1
contains 1x10-2 attomoles of IL-1ß-MIMIC; lane 2,
5x10-3; lane 3, 2.5x10-3; lane 4,
1.25x10-3; lane 5, 6.25x10-4; lane 6,
3.13x10-4; and lane 7, 1.56x10-4. B,
Quantitative analysis of the competitive PCR experiment shown
in A. The log of the ratio of the corrected density of the target and
MIMIC was plotted against the log of (Molecules MIMIC) added to the PCR
reaction. The line was drawn from a linear regression analysis
of the data points. The amount of target molecule was determined as the
point of an equimolar ratio between the internal control and the
target.
Heart sections were embedded in OCT compound tissue medium
(Miles Inc), snap-frozen on dry ice, and stored at -70°C. Tissues
were sectioned on a cryostat at 6 µm. The sections were fixed
for 10 minutes in 4% paraformaldehyde at 4°C. The
primary antibodies used consisted of hamster monoclonal anti-mouse
IL-1ß (Genzyme Corp) at a concentration of 50 µg/mL and mouse
monoclonal anti-rat macrophage (clone Ki-M2R, BMA) diluted to
1:50. Incubation with the primary antibody was performed at 4°C
overnight. Biotinylated goat anti-hamster IgG (Cedarlane) diluted to
1:100, biotinylated goat anti-rabbit IgG (DAKO) diluted to 1:300, and
biotinylated rabbit anti-mouse IgG (DAKO) diluted 1:300 were used as
secondary antibodies. Incubation with secondary antibodies was
performed at room temperature for 30 minutes. After incubation with
avidin-biotinhorseradish peroxidase complexes (Vector Labs),
peroxidase was visualized by 3',3'-diaminobenzidine followed by
incubation with diaminobenzidine enhancing solution (Vector Labs).
Counterstaining was performed with methyl green. Omission of the
primary antibody and preabsorption of anti-mouse IL-1ß with
recombinant rat IL-1ß (provided by Otsuka Pharmaceutical Co,
Tokushima, Japan) served as controls to verify IL-1ß staining. The
primary antibody was omitted as a control for the staining of
macrophages.
Echocardiographic measurements are reported as
mean±SD. Measurements of cytokine gene expression were
normalized by assigning an arbitrary number of 100 to the peak
expression of IL-1ß from which means and SEs were derived. One-way
ANOVA with Fisher's protected least significant difference test was
used for statistical comparisons. A value of P<0.05 was
considered significant.
![]()
Results
Top
Abstract
Introduction
Methods
Results
Discussion
References
Infarct Size and Chamber Dimensions
There were no significant differences in infarct size within
groups over time (Table
). The LV mass indexed for body
weight was significantly increased in the MI group (overall mean: sham,
1.83 g/kg; MI, 2.32 g/kg; P<0.05). A similar pattern was
observed in the right ventricular mass indexed for body
weight.
View this table:
[in a new window]
Table 1. Physical Characteristics
Compared with sham-operated animals, rats with MI exhibited
progressive LV dilatation. Significant differences in LV ESD and EDD
were already measurable between the two groups at 1 week and continued
to widen up to 20 weeks (Figure 2
, left).
LV enlargement was accompanied by a marked decrease in fractional
shortening (Figure 2
, middle). Similarly, RWT was markedly decreased in
the rats with MI throughout the observation period (Figure 2
, right).
Thus, the increase in LV cavity size was disproportionate relative to
the thickness of the surviving myocardium, suggesting a
lack of appropriate hypertrophy and a progressive afterload
mismatch.

View larger version (17K):
[in a new window]
Figure 2. Graphs showing serial changes in LV geometry and
function before and 1, 4, 8, and 20 weeks after surgery in
sham-operated rats (n=12) and in rats with MI (n=12). Left,
Progressive increase in LV diastolic internal
dimension (EDD) after MI. Middle, Fractional shortening (FS) shows
progressive impairment in rats with MI. Right, Marked decrease in RWT
indicates a disproportionate increase in chamber dimension after MI.
*P<0.05 compared with controls; #P<0.05
compared with preoperative baseline; §P<0.05 compared
with 1 week after MI.
The evolution of the relative levels of TNF-
, IL-1ß, and IL-6
mRNA in both groups of rats is shown in Figure 3
. The gene expression level in the
sham-operated rats rose slightly at 1 week and returned to near
baseline thereafter. In the rats that underwent coronary
ligation, the gene expression level in the infarcted region rose
steeply at 1 week after surgery (TNF-
, 32±5%; IL-1ß,
100±17%; and IL-6, 31±4%), also falling to near baseline at 20
weeks (4±1%, 7±2%, and 4±1%, respectively). In contrast, in the
noninfarcted region, the cytokine gene expression levels rose
moderately at 1 week and at 20 weeks remained significantly higher than
those measured in both the infarcted zone and the
myocardium of the sham-operated rats (16±4%, 47±8%, and
15±4%, respectively). Furthermore, this rise in
cytokine expression levels in the noninfarcted heart correlated
with the EDD at 8 and 20 weeks after surgery (TNF-
,
r=0.743; IL-1ß, r=0.719; and IL-6,
r=0.713; Figure 4
).

View larger version (23K):
[in a new window]
Figure 3. Quantitative analysis of TNF-
, IL-1ß,
and IL-6. The value at each time point represents the
normalized mean±SEM for four rats. *P<0.05 compared
with sham operation group; #P<0.05 compared with
infarcted region.

View larger version (18K):
[in a new window]
Figure 4. Relationship between EDD of TNF-
,
IL-1ß, and IL-6 gene expression level in the noninfarcted zone at 8
and 20 weeks after coronary ligation. The expression of each
cytokine correlated positively with EDD.
Compared with control animals, a 3.63-fold increase in LV collagen
density was observed in MI rats at 20 weeks after surgery (Figures 5
, bottom panel; and 6, left panel). LV
collagen density at 8 and 20 weeks after surgery correlated well with
IL-1ß mRNA expression level (r=0.86; Figure 6
, right panel). No significant
correlation was found between collagen density and TNF-
or IL-6 mRNA
expression level.

View larger version (167K):
[in a new window]
Figure 5. Interventricular septum stained with
Sirius red at 20 weeks after surgery. Magnification x400; bar=50
µm. Top, Sham-operated rats; bottom, MI rats.

View larger version (12K):
[in a new window]
Figure 6. Serial changes in collagen density (left) and
relation between IL-1ß gene expression level and collagen density
(right). *P<0.05 compared with sham-operated
group.
Because the IL-1ß mRNA expression level was the most enhanced,
we performed its immunohistochemical analysis in these animals.
In the control rats, minimal immunoreactivity was observed by
immunohistochemical analysis performed at 1 week to localize
IL-1ß protein in the heart (Figure 7A
).
In contrast, in the infarcted region, IL-1ß immunoreactivity was
found in the infiltrating leukocytes (Figure 7B
), and in the
noninfarcted zone, it was found in vascular endothelial
cells and interstitial cells (Figure 7C
). At 20 weeks,
IL-1ß immunoreactivity remained almost absent in the heart of control
rats. In the rats with MI, the infarcted myocardium was
replaced by scar tissue with less mononuclear cell infiltration, and
immunoreactivity for IL-1ß protein was observed in scattered
mononuclear cells (Figure 7D
). In the noninfarcted
myocardium, IL-1ß staining was apparent in
endothelial cells and vascular smooth muscle cells
(Figure 7E
) as well as in the interstitial cells that were
positive for macrophage marker (Figure 7F
and 7G
).

View larger version (123K):
[in a new window]
Figure 7. Localization of IL-1ß by immunohistochemical
analysis in control and infarcted hearts. Magnification x400;
bar=50 µm. A, Absence of IL-1ß protein in the heart from a
sham-operated rat at 1 week after surgery. B, Presence of IL-1ß
protein in infiltrating leukocytes of an infarcted zone 1 week after
coronary ligation. C, Presence of IL-1ß protein in vascular
endothelial cells and interstitial cells in
the noninfarcted region 1 week after coronary ligation. D, Scar
tissue replacement in infarcted territory at 20 weeks after
coronary ligation. Immunoreactivity for IL-1ß protein is
observed in scattered mononuclear cells. E, Positive staining for
IL-1ß in endothelial cells and vascular smooth muscle
cells in the noninfarcted myocardium 20 weeks after
coronary ligation. F and G, Positive staining for IL-1ß
(arrows in F) in interstitial macrophage (arrows in
G) in the noninfarcted zone 20 weeks after coronary
ligation.
![]()
Discussion
Top
Abstract
Introduction
Methods
Results
Discussion
References
Ventricular remodeling after MI is a consequence of
large infarcts.21 This complex process is not
limited to the areas of infarction.22 23 In the
present study, we followed the remodeling process in a rat model of
post-MI heart failure using serial transthoracic
echocardiography. In this model, LV dilatation
develops in the first week after MI and continues to progress over the
subsequent 20 weeks. In the noninfarcted myocardium,
adaptive hypertrophy undergoes a transition, leading to
further cardiac dilatation, with a strong tendency toward a decrease in
the thickness of the noninfarcted myocardium relative to
the LV diameter. The decrease in RWT in rats with MI implies that the
limits of compensation have been reached and that there is lack of
appropriate hypertrophy of the surviving
myocardium.
within cardiac tissues in DCM,
and they hypothesized that locally produced TNF-
might contribute to
the pathogenesis and complications of DCM by inducing iNOS in the
heart. Ischemic heart disease is the leading cause of CHF, and
we hypothesize that similar inflammatory and immune processes may be
implicated at the level of the noninfarcted myocardium. In
our model, at 20 weeks, the cytokine expression level in the
noninfarcted region was significantly higher than in the control rats
and correlated well with EDD. The cause for this cytokine gene
upregulation is uncertain, although several factors that cause LV
dilatation might contribute to it.
have been
reported in patients with chronic heart
failure,31 32 and TNF-
has been found to
depress the contractility of isolated hamster papillary
muscles. Repeated TNF-
infusion may lead to a permanent decrease in
myocardial contractility and may result in
DCM.33
, and IFN-
increased
NO production in rat cardiocytes by induction of iNOS
gene expression.34 These cytokines also
have cytotoxic effects on cultured myocytes.35
More recently, IL-1ß acting via an NO-independent mechanism has been
shown to cause myocyte hypertrophy and downregulation of
calcium regulating genes,36 and in
ischemic cardiomyopathy, alterations in
collagen concentration and phenotypes have been
demonstrated.37 Enhanced type I and type III
collagen production by fibroblasts in the noninfarcted
myocardium has been reported in the rat heart after
MI.38 In our model, collagen density of
noninfarcted myocardium gradually increased and correlated
well with IL-1ß expression level. Because IL-1ß exhibits
mitogenic effects on human fibroblasts in certain
circumstances,39 40 the upregulation of IL-1ß
in the noninfarcted myocardium in our model may be partly
responsible in this setting for altering the compliance of the
myocardium, resulting in exacerbation of heart failure. We
found a similar correlation between IL-1ß mRNA expression
and cardiac fibrosis in a murine model of
myocarditis.41 However, the effects of
IL-1ß on fibroblasts may be complex. For example, Palmer et
al42 reported an antiproliferative effect of
IL-1ß on cultured rat cardiac fibroblasts. In another
study, Thaik et al43 found that IL-1ß
stimulated protein synthesis in cultured rat cardiac fibroblasts,
although it inhibited DNA synthesis. Therefore, further
studies are needed to define more precisely the effects of IL-1ß on
the collagen deposition in vivo.
![]()
Selected Abbreviations and Acronyms
CHF
=
congestive heart failure
DCM
=
dilated cardiomyopathy
EDD
=
end-diastolic diameter
ESD
=
end-systolic diameter
IL
=
interleukin
iNOS
=
inducible nitric oxide synthase
LV
=
left ventricle, left ventricular
MI
=
myocardial infarction
PCR
=
polymerase chain reaction
RWT
=
relative wall thickness
TNF
=
tumor necrosis factor
![]()
Acknowledgments
This work was supported by a research grant from the Ministry of
Health and Welfare of Japan and a grant-in-aid for general scientific
research from the Ministry of Education, Science, and Culture of Japan.
We would like to thank Otsuka Pharmaceutical Co for supplying the
recombinant rat IL-1ß.
![]()
References
Top
Abstract
Introduction
Methods
Results
Discussion
References
1.
Fuster V, Badimon L, Badimon JJ, Chesebro JH. The
pathogenesis of coronary artery disease and the acute
coronary syndromes, I. N Engl J Med. 1992;326:242250.[Medline]
[Order article via Infotrieve]
This article has been cited by other articles:
![]() |
K. M. Eggers, B. Lagerqvist, P. Venge, L. Wallentin, and B. Lindahl Prognostic Value of Biomarkers During and After Non-ST-Segment Elevation Acute Coronary Syndrome J. Am. Coll. Cardiol., July 21, 2009; 54(4): 357 - 364. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Isidoro Tavares, P. Philip-Couderc, A. J. Baertschi, R. Lerch, and C. Montessuit Angiotensin II and tumour necrosis factor {alpha} as mediators of ATP-dependent potassium channel remodelling in post-infarction heart failure Cardiovasc Res, June 11, 2009; (2009) cvp162v2. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Hohensinner, C. Kaun, K. Rychli, A. Niessner, S. Pfaffenberger, G. Rega, A. Furnkranz, P. Uhrin, J. Zaujec, T. Afonyushkin, et al. The inflammatory mediator oncostatin M induces stromal derived factor-1 in human adult cardiac cells FASEB J, March 1, 2009; 23(3): 774 - 782. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-C. Lee, H.-C. Hsu, W.-Y. I. Tseng, C.-Y. Chen, H.-J. Lin, Y.-L. Ho, M.-J. Su, and M.-F. Chen Cell therapy generates a favourable chemokine gradient for stem cell recruitment into the infarcted heart in rabbits Eur J Heart Fail, March 1, 2009; 11(3): 238 - 245. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kohno, T. Anzai, K. Naito, T. Miyasho, M. Okamoto, H. Yokota, S. Yamada, Y. Maekawa, T. Takahashi, T. Yoshikawa, et al. Role of high-mobility group box 1 protein in post-infarction healing process and left ventricular remodelling Cardiovasc Res, February 15, 2009; 81(3): 565 - 573. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Krishnamurthy, J. Rajasingh, E. Lambers, G. Qin, D. W. Losordo, and R. Kishore IL-10 Inhibits Inflammation and Attenuates Left Ventricular Remodeling After Myocardial Infarction via Activation of STAT3 and Suppression of HuR Circ. Res., January 30, 2009; 104(2): e9 - e18. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ishii, T. Amano, T. Matsubara, and T. Murohara Pharmacological Intervention for Prevention of Left Ventricular Remodeling and Improving Prognosis in Myocardial Infarction Circulation, December 16, 2008; 118(25): 2710 - 2718. [Full Text] [PDF] |
||||
![]() |
J. C. Hardwick, E. M. Southerland, and J. L. Ardell Chronic myocardial infarction induces phenotypic and functional remodeling in the guinea pig cardiac plexus Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2008; 295(6): R1926 - R1933. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takahashi, S. Fukushima, K. Yamahara, K. Yashiro, Y. Shintani, S. R. Coppen, H. K. Salem, S. W. Brouilette, M. H. Yacoub, and K. Suzuki Modulated Inflammation by Injection of High-Mobility Group Box 1 Recovers Post-Infarction Chronically Failing Heart Circulation, September 30, 2008; 118(14_suppl_1): S106 - S114. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Shivakumar, S. J. Sollott, M. Sangeetha, S. Sapna, B. Ziman, S. Wang, and E. G. Lakatta Paracrine effects of hypoxic fibroblast-derived factors on the MPT-ROS threshold and viability of adult rat cardiac myocytes Am J Physiol Heart Circ Physiol, June 1, 2008; 294(6): H2653 - H2658. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Beeri, C. Yosefy, J. L. Guerrero, F. Nesta, S. Abedat, M. Chaput, F. del Monte, M. D. Handschumacher, R. Stroud, S. Sullivan, et al. Mitral regurgitation augments post-myocardial infarction remodeling failure of hypertrophic compensation. J. Am. Coll. Cardiol., January 29, 2008; 51(4): 476 - 486. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Moro, M.-G. Jouan, A. Rakotovao, M.-C. Toufektsian, O. Ormezzano, N. Nagy, A. Tosaki, J. de Leiris, and F. Boucher Delayed expression of cytokines after reperfused myocardial infarction: possible trigger for cardiac dysfunction and ventricular remodeling Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H3014 - H3019. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Vellaichamy, D. Zhao, N. Somanna, and K. N. Pandey Genetic disruption of guanylyl cyclase/natriuretic peptide receptor-A upregulates ACE and AT1 receptor gene expression and signaling: role in cardiac hypertrophy Physiol Genomics, October 19, 2007; 31(2): 193 - 202. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Batista Jr., R. V. T. Santos, E. M. Oliveira, M. C. L. Seelaender, and L. F. B. P. Costa Rosa Endurance training restores peritoneal macrophage function in post-MI congestive heart failure rats J Appl Physiol, May 1, 2007; 102(5): 2033 - 2039. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Westphal, Li Chen, C. Pilowski, S. Koch, H. Ebelt, U. Muller-Werdan, K. Werdan, and H. Loppnow Endotoxin-activated cultured neonatal rat cardiomyocytes express functional surface-associated interleukin-1{alpha} Innate Immunity, February 1, 2007; 13(1): 25 - 34. [Abstract] [PDF] |
||||
![]() |
V. Adams, A. Linke, U. Wisloff, C. Doring, S. Erbs, N. Krankel, C. C. Witt, S. Labeit, U. Muller-Werdan, G. Schuler, et al. Myocardial expression of Murf-1 and MAFbx after induction of chronic heart failure: Effect on myocardial contractility Cardiovasc Res, January 1, 2007; 73(1): 120 - 129. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, G. Takemura, H. Okada, S. Miyata, R. Maruyama, L. Li, M. Higuchi, S. Minatoguchi, T. Fujiwara, and H. Fujiwara Reduction of inflammatory cytokine expression and oxidative damage by erythropoietin in chronic heart failure Cardiovasc Res, September 1, 2006; 71(4): 684 - 694. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Lafontant, A. R. Burns, E. Donnachie, S. B. Haudek, C. W. Smith, and M. L. Entman Oncostatin M differentially regulates CXC chemokines in mouse cardiac fibroblasts Am J Physiol Cell Physiol, July 1, 2006; 291(1): C18 - C26. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kaur, A. K. Sharma, and P. K. Singal Significance of changes in TNF-{alpha} and IL-10 levels in the progression of heart failure subsequent to myocardial infarction Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H106 - H113. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nishikawa, M. Yoshida, M. Kusuhara, N. Ishigami, K. Isoda, K. Miyazaki, and F. Ohsuzu Left ventricular hypertrophy in mice with a cardiac-specific overexpression of interleukin-1 Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H176 - H183. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Miki, T. Miura, T. Yano, A. Takahashi, J. Sakamoto, M. Tanno, H. Kobayashi, Y. Ikeda, M. Nishihara, K. Naitoh, et al. Alteration in Erythropoietin-Induced Cardioprotective Signaling by Postinfarct Ventricular Remodeling J. Pharmacol. Exp. Ther., April 1, 2006; 317(1): 68 - 75. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Guerra, R. Roncon-Albuquerque Jr, A. P. Lourenco, I. Falcao-Pires, P. Cibrao-Coutinho, and A. F. Leite-Moreira Remote myocardium gene expression after 30 and 120 min of ischaemia in the rat Exp Physiol, March 1, 2006; 91(2): 473 - 480. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Trescher, O. Bernecker, B. Fellner, M. Gyongyosi, R. Schafer, S. Aharinejad, R. DeMartin, E. Wolner, and B. K. Podesser Inflammation and postinfarct remodeling: Overexpression of I{kappa}B prevents ventricular dilation via increasing TIMP levels Cardiovasc Res, February 15, 2006; 69(3): 746 - 754. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Matsumoto-Ida, Y. Takimoto, T. Aoyama, M. Akao, T. Takeda, and T. Kita Activation of TGF-{beta}1-TAK1-p38 MAPK pathway in spared cardiomyocytes is involved in left ventricular remodeling after myocardial infarction in rats Am J Physiol Heart Circ Physiol, February 1, 2006; 290(2): H709 - H715. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. G. Dean, L. C. Balding, R. Candido, W. C. Burns, Z. Cao, S. M. Twigg, and L. M. Burrell Connective Tissue Growth Factor and Cardiac Fibrosis after Myocardial Infarction J. Histochem. Cytochem., October 1, 2005; 53(10): 1245 - 1256. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Cowling, X. Zhang, V. C. Reese, M. Iwata, D. Gurantz, W. H. Dillmann, and B. H. Greenberg Effects of cytokine treatment on angiotensin II type 1A receptor transcription and splicing in rat cardiac fibroblasts Am J Physiol Heart Circ Physiol, September 1, 2005; 289(3): H1176 - H1183. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Deten, G. Marx, W. Briest, H. Christian Volz, and H.-G. Zimmer Heart function and molecular biological parameters are comparable in young adult and aged rats after chronic myocardial infarction Cardiovasc Res, May 1, 2005; 66(2): 364 - 373. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. Bongartz, M. J. Cramer, P. A. Doevendans, J. A. Joles, and B. Braam The severe cardiorenal syndrome: 'Guyton revisited' Eur. Heart J., January 1, 2005; 26(1): 11 - 17. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sun, F. Dawood, W.-H. Wen, M. Chen, I. Dixon, L. A. Kirshenbaum, and P. P. Liu Excessive Tumor Necrosis Factor Activation After Infarction Contributes to Susceptibility of Myocardial Rupture and Left Ventricular Dysfunction Circulation, November 16, 2004; 110(20): 3221 - 3228. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Xie, M. Singh, and K. Singh Differential Regulation of Matrix Metalloproteinase-2 and -9 Expression and Activity in Adult Rat Cardiac Fibroblasts in Response to Interleukin-1{beta} J. Biol. Chem., September 17, 2004; 279(38): 39513 - 39519. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Suzuki, B. Murtuza, J. R. Beauchamp, N. J. Brand, P. J. R. Barton, A. Varela-Carver, S. Fukushima, S. R. Coppen, T. A. Partridge, and M. H. Yacoub Role of Interleukin-1{beta} in Acute Inflammation and Graft Death After Cell Transplantation to the Heart Circulation, September 14, 2004; 110(11_suppl_1): II-219 - II-224. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Jaffre, J. Callebert, A. Sarre, N. Etienne, C. G. Nebigil, J.-M. Launay, L. Maroteaux, and L. Monassier Involvement of the Serotonin 5-HT2B Receptor in Cardiac Hypertrophy Linked to Sympathetic Stimulation: Control of Interleukin-6, Interleukin-1{beta}, and Tumor Necrosis Factor-{alpha} Cytokine Production by Ventricular Fibroblasts Circulation, August 24, 2004; 110(8): 969 - 974. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sekiguchi, X. Li, M. Coker, M. Flesch, P. M Barger, N. Sivasubramanian, and D. L Mann Cross-regulation between the renin-angiotensin system and inflammatory mediators in cardiac hypertrophy and failure Cardiovasc Res, August 15, 2004; 63(3): 433 - 442. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Francis, Z.-H. Zhang, R. M. Weiss, and R. B. Felder Neural regulation of the proinflammatory cytokine response to acute myocardial infarction Am J Physiol Heart Circ Physiol, August 1, 2004; 287(2): H791 - H797. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Rebsamen, E. Perrier, C. Gerber-Wicht, J.-P. Benitah, and U. Lang Direct and Indirect Effects of Aldosterone on Cyclooxygenase-2 and Interleukin-6 Expression in Rat Cardiac Cells in Culture and after Myocardial Infarction Endocrinology, July 1, 2004; 145(7): 3135 - 3142. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Berthonneche, T. Sulpice, F. Boucher, L. Gouraud, J. de Leiris, S. E. O'Connor, J.-M. Herbert, and P. Janiak New insights into the pathological role of TNF-{alpha} in early cardiac dysfunction and subsequent heart failure after infarction in rats Am J Physiol Heart Circ Physiol, July 1, 2004; 287(1): H340 - H350. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nian, P. Lee, N. Khaper, and P. Liu Inflammatory Cytokines and Postmyocardial Infarction Remodeling Circ. Res., June 25, 2004; 94(12): 1543 - 1553. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Francis, Y. Chu, A. K. Johnson, R. M. Weiss, and R. B. Felder Acute myocardial infarction induces hypothalamic cytokine synthesis Am J Physiol Heart Circ Physiol, June 1, 2004; 286(6): H2264 - H2271. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Murtuza, K. Suzuki, G. Bou-Gharios, J. R. Beauchamp, R. T. Smolenski, T. A. Partridge, and M. H. Yacoub Transplantation of skeletal myoblasts secreting an IL-1 inhibitor modulates adverse remodeling in infarcted murine myocardium PNAS, March 23, 2004; 101(12): 4216 - 4221. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takeshita, M. Hayashi, S. Iino, T. Kondo, Y. Inden, M. Iwase, T. Kojima, M. Hirai, M. Ito, D. J. Loskutoff, et al. Increased Expression of Plasminogen Activator Inhibitor-1 in Cardiomyocytes Contributes to Cardiac Fibrosis after Myocardial Infarction Am. J. Pathol., February 1, 2004; 164(2): 449 - 456. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Omura, M. Yoshiyama, S. Kim, R. Matsumoto, Y. Nakamura, Y. Izumi, H. Ichijo, T. Sudo, K. Akioka, H. Iwao, et al. Involvement of Apoptosis Signal-Regulating Kinase-1 on Angiotensin II-Induced Monocyte Chemoattractant Protein-1 Expression Arterioscler. Thromb. Vasc. Biol., February 1, 2004; 24(2): 270 - 275. [Abstract] [Full Text] |
||||
![]() |
Z. Xie, M. Singh, D. A. Siwik, W. L. Joyner, and K. Singh Osteopontin Inhibits Interleukin-1{beta}-stimulated Increases in Matrix Metalloproteinase Activity in Adult Rat Cardiac Fibroblasts: ROLE OF PROTEIN KINASE C-{zeta} J. Biol. Chem., December 5, 2003; 278(49): 48546 - 48552. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Aker, S. Belosjorow, I. Konietzka, A. Duschin, C. Martin, G. Heusch, and R. Schulz Serum but not myocardial TNF-{alpha} concentration is increased in pacing-induced heart failure in rabbits Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2003; 285(2): R463 - R469. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Frantz, D. Fraccarollo, H. Wagner, T. M Behr, P. Jung, C. E Angermann, G. Ertl, and J. Bauersachs Sustained activation of nuclear factor kappa B and activator protein 1 in chronic heart failure Cardiovasc Res, March 1, 2003; 57(3): 749 - 756. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Calabresi, G. Rossoni, M. Gomaraschi, F. Sisto, F. Berti, and G. Franceschini High-Density Lipoproteins Protect Isolated Rat Hearts From Ischemia-Reperfusion Injury by Reducing Cardiac Tumor Necrosis Factor-{alpha} Content and Enhancing Prostaglandin Release Circ. Res., February 21, 2003; 92(3): 330 - 337. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Peng, D. Gurantz, V. Tran, R. T. Cowling, and B. H. Greenberg Tumor Necrosis Factor-{alpha}-Induced AT1 Receptor Upregulation Enhances Angiotensin II-Mediated Cardiac Fibroblast Responses That Favor Fibrosis Circ. Res., December 13, 2002; 91(12): 1119 - 1126. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fuchs and H. Drexler Pharmacotherapy of chronic heart failure: current status and future aspects Eur. Heart J. Suppl., December 1, 2002; 4(suppl_I): I81 - I87. [Abstract] [PDF] |
||||
![]() |
B. Tian, J. Liu, P. B. Bitterman, and R. J. Bache Mechanisms of cytokine induced NO-mediated cardiac fibroblast apoptosis Am J Physiol Heart Circ Physiol, November 1, 2002; 283(5): H1958 - H1967. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M Smith, S. Lecour, and M. N Sack Innate immunity and cardiac preconditioning: a putative intrinsic cardioprotective program Cardiovasc Res, August 15, 2002; 55(3): 474 - 482. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M Smith, N. Suleman, J. McCarthy, and M. N Sack Classic ischemic but not pharmacologic preconditioning is abrogated following genetic ablation of the TNF{alpha} gene Cardiovasc Res, August 15, 2002; 55(3): 553 - 560. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Deten, H. C. Volz, W. Briest, and H.-G. Zimmer Cardiac cytokine expression is upregulated in the acute phase after myocardial infarction. Experimental studies in rats Cardiovasc Res, August 1, 2002; 55(2): 329 - 340. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Briest Do we have a new early marker of chronic transplant dysfunction now? Cardiovasc Res, June 1, 2002; 54(3): 492 - 494. [Full Text] [PDF] |
||||
![]() |
Y. T. Sia, N. Lapointe, T. G. Parker, J. N. Tsoporis, C. F. Deschepper, A. Calderone, A. Pourdjabbar, J.F. Jasmin, J.F. Sarrazin, P. Liu, et al. Beneficial Effects of Long-Term Use of the Antioxidant Probucol in Heart Failure in the Rat Circulation, May 28, 2002; 105(21): 2549 - 2555. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Lapointe, C. Blais Jr, A. Adam, T. Parker, M. G. Sirois, H. Gosselin, R. Clement, and J. L. Rouleau Comparison of the effects of an angiotensin-converting enzyme inhibitor and a vasopeptidase inhibitor after myocardial infarction in the rat J. Am. Coll. Cardiol., May 15, 2002; 39(10): 1692 - 1698. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Cowling, D. Gurantz, J. Peng, W. H. Dillmann, and B. H. Greenberg Transcription Factor NF-kappa B Is Necessary for Up-regulation of Type 1 Angiotensin II Receptor mRNA in Rat Cardiac Fibroblasts Treated with Tumor Necrosis Factor-alpha or Interleukin-1beta J. Biol. Chem., February 15, 2002; 277(8): 5719 - 5724. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hara, K. Ono, M.-W. Hwang, A. Iwasaki, M. Okada, K. Nakatani, S. Sasayama, and A. Matsumori Evidence for a Role of Mast Cells in the Evolution to Congestive Heart Failure J. Exp. Med., February 4, 2002; 195(3): 375 - 381. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mendez and M. C. LaPointe Trophic Effects of the Cyclooxygenase-2 Product Prostaglandin E2 in Cardiac Myocytes Hypertension, February 1, 2002; 39(2): 382 - 388. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. T. Sia, T. G. Parker, P. Liu, J. N. Tsoporis, A. Adam, and J. L. Rouleau Improved post-myocardial infarction survival with probucol in rats: Effects on left ventricular function, morphology, cardiac oxidative stress and cytokine expression J. Am. Coll. Cardiol., January 2, 2002; 39(1): 148 - 156. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. O. Iversen, P. R. Woldbaek, T. Tonnessen, and G. Christensen Decreased hematopoiesis in bone marrow of mice with congestive heart failure Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2002; 282(1): R166 - R172. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takahashi, J. Nishihira, M. Shimpo, Y. Mizue, S. Ueno, H. Mano, E. Kobayashi, U. Ikeda, and K. Shimada Macrophage migration inhibitory factor as a redox-sensitive cytokine in cardiac myocytes Cardiovasc Res, December 1, 2001; 52(3): 438 - 445. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-W. Hwang, A. Matsumori, Y. Furukawa, K. Ono, M. Okada, A. Iwasaki, M. Hara, T. Miyamoto, M. Touma, and S. Sasayama Neutralization of interleukin-1{beta} in the acute phase of myocardial infarction promotes the progression of left ventricular remodeling J. Am. Coll. Cardiol., November 1, 2001; 38(5): 1546 - 1553. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. O. Iversen, G. Nicolaysen, and M. Sioud DNA enzyme targeting TNF-alpha mRNA improves hemodynamic performance in rats with postinfarction heart failure Am J Physiol Heart Circ Physiol, November 1, 2001; 281(5): H2211 - H2217. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Suzuki, B. Murtuza, R. T. Smolenski, I. A. Sammut, N. Suzuki, Y. Kaneda, and M. H. Yacoub Overexpression of Interleukin-1 Receptor Antagonist Provides Cardioprotection Against Ischemia-Reperfusion Injury Associated With Reduction in Apoptosis Circulation, September 18, 2001; 104 (2009): I-308 - I-313. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kamihata, H. Matsubara, T. Nishiue, S. Fujiyama, Y. Tsutsumi, R. Ozono, H. Masaki, Y. Mori, O. Iba, E. Tateishi, et al. Implantation of Bone Marrow Mononuclear Cells Into Ischemic Myocardium Enhances Collateral Perfusion and Regional Function via Side Supply of Angioblasts, Angiogenic Ligands, and Cytokines Circulation, August 28, 2001; 104(9): 1046 - 1052. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. P. Liu and J. W. Mason Advances in the Understanding of Myocarditis Circulation, August 28, 2001; 104(9): 1076 - 1082. [Full Text] [PDF] |
||||
![]() |
B. D. Hoit Two Faces of Nitric Oxide: Lessons Learned From the NOS2 Knockout Circ. Res., August 17, 2001; 89(4): 289 - 291. [Full Text] [PDF] |
||||
![]() |
A. Burger, M. Benicke, A. Deten, and H.-G. Zimmer Catecholamines stimulate interleukin-6 synthesis in rat cardiac fibroblasts Am J Physiol Heart Circ Physiol, July 1, 2001; 281(1): H14 - H21. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Loennechen, A. Stoylen, V. Beisvag, U. Wisloff, and O. Ellingsen Regional expression of endothelin-1, ANP, IGF-1, and LV wall stress in the infarcted rat heart Am J Physiol Heart Circ Physiol, June 1, 2001; 280(6): H2902 - H2910. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Abe, M. Tokumura, T. Ito, T. Murai, A. Takashima, and N. Ibii Involvement of iNOS in postischemic heart dysfunction of stroke-prone spontaneously hypertensive rats Am J Physiol Heart Circ Physiol, February 1, 2001; 280(2): H668 - H673. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Damas, H. G. Eiken, E. Oie, V. Bjerkeli, A. Yndestad, T. Ueland, T. Tonnessen, O. R. Geiran, H. Aass, S. Simonsen, et al. Myocardial expression of CC- and CXC-chemokines and their receptors in human end-stage heart failure Cardiovasc Res, September 1, 2000; 47(4): 778 - 787. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Siwik, D. L.-F. Chang, and W. S. Colucci Interleukin-1{beta} and Tumor Necrosis Factor-{alpha} Decrease Collagen Synthesis and Increase Matrix Metalloproteinase Activity in Cardiac Fibroblasts In Vitro Circ. Res., June 23, 2000; 86(12): 1259 - 1265. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Oie, R. Bjornerheim, O. P. F. Clausen, and H. Attramadal Cyclosporin A inhibits cardiac hypertrophy and enhances cardiac dysfunction during postinfarction failure in rats Am J Physiol Heart Circ Physiol, June 1, 2000; 278(6): H2115 - H2123. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. W. Stanton, L. J. Garrard, D. Damm, B. L. Garrick, A. Lam, A. M. Kapoun, Q. Zheng, A. A. Protter, G. F. Schreiner, and R. T. White Altered Patterns of Gene Expression in Response to Myocardial Infarction Circ. Res., May 12, 2000; 86(9): 939 - 945. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Prabhu, B. Chandrasekar, D. R. Murray, and G. L. Freeman {beta}-Adrenergic Blockade in Developing Heart Failure : Effects on Myocardial Inflammatory Cytokines, Nitric Oxide, and Remodeling Circulation, May 2, 2000; 101(17): 2103 - 2109. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Nagaya, T. Nishikimi, F. Yoshihara, T. Horio, A. Morimoto, and K. Kangawa Cardiac adrenomedullin gene expression and peptide accumulation after acute myocardial infarction in rats Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2000; 278(4): R1019 - R1026. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nakamura, N.-P. Wang, Z.-Q. Zhao, J. N Wilcox, V. Thourani, R. A Guyton, and J. Vinten-Johansen Preconditioning decreases Bax expression, PMN accumulation and apoptosis in reperfused rat heart Cardiovasc Res, February 1, 2000; 45(3): 661 - 670. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Isenovic and M. C. LaPointe Role of Ca2+-Independent Phospholipase A2 in the Regulation of Inducible Nitric Oxide Synthase in Cardiac Myocytes Hypertension, January 1, 2000; 35(1): 249 - 254. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Azzawi and P. Hasleton Tumour necrosis factor alpha and the cardiovascular system: its role in cardiac allograft rejection and heart disease Cardiovasc Res, September 1, 1999; 43(4): 850 - 859. [Full Text] [PDF] |
||||
![]() |
D. Gurantz, R. T. Cowling, F. J. Villarreal, and B. H. Greenberg Tumor Necrosis Factor-{alpha} Upregulates Angiotensin II Type 1 Receptors on Cardiac Fibroblasts Circ. Res., August 6, 1999; 85(3): 272 - 279. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sasayama, A. Matsumori, and Y. Kihara New insights into the pathophysiological role for cytokines in heart failure Cardiovasc Res, June 1, 1999; 42(3): 557 - 564. [Full Text] [PDF] |
||||
![]() |
J. M.B Pinto and P. A Boyden Electrical remodeling in ischemia and infarction Cardiovasc Res, May 1, 1999; 42(2): 284 - 297. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Liebold, C. Keyl, and D. E. Birnbaum The heart produces but the lungs consume proinflammatory cytokines following cardiopulmonary bypass Eur. J. Cardiothorac. Surg., March 1, 1999; 15(3): 340 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Trueblood, Z. Xie, C. Communal, F. Sam, S. Ngoy, L. Liaw, A. W. Jenkins, J. Wang, D. B. Sawyer, O. H. L. Bing, et al. Exaggerated Left Ventricular Dilation and Reduced Collagen Deposition After Myocardial Infarction in Mice Lacking Osteopontin Circ. Res., May 25, 2001; 88(10): 1080 - 1087. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Sam, D. B. Sawyer, Z. Xie, D. L.F. Chang, S. Ngoy, D. A. Brenner, D. A. Siwik, K. Singh, C. S. Apstein, and W. S. Colucci Mice Lacking Inducible Nitric Oxide Synthase Have Improved Left Ventricular Contractile Function and Reduced Apoptotic Cell Death Late After Myocardial Infarction Circ. Res., August 17, 2001; 89(4): 351 - 356. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |