From the Division of Cardiology (M.K., P.K., J.V.), Department of
Medicine, Helsinki University Central Hospital, Helsinki, Finland; Institute
of Biomedicine and Physiology (A.H., L.L.), University of Helsinki, Finland;
and Department of Pediatrics (H.N., P.C.W.), University of Texas Southwestern
Medical Center (Dallas).
Methods and ResultsA Finnish population sample of 84 persons (44
women) aged 36 to 37 years was studied by M-mode and Doppler
echocardiography to assess left
ventricular size, mass, and function. Subjects were
genotyped through the use of the polymerase chain reaction for
two diallelic polymorphisms in CYP11B2: one in the
transcriptional regulatory region (promoter) and the other in the
second intron. In multiple regression analyses, the
CYP11B2 promoter genotype predicted
statistically significant variations in left ventricular
end-diastolic diameter (ß=.40, P<.0001),
end-systolic diameter (ß=.33, P=.0009), and
mass (ß=.17, P=.023). These effects were independent
of potentially confounding factors, including sex, body size, blood
pressure, physical activity, smoking, and ethanol consumption.
Genotype groups also differed in a measure of left
ventricular diastolic function, the heart
rateadjusted atrial filling fraction (P=.018).
Increased dietary salt, which is known to predict increased left
ventricular mass, had this effect only in association with
certain CYP11B2 genotypes
(P<.001).
ConclusionsGenetic variations in or near the
aldosterone synthase (CYP11B2) gene strongly
affect left ventricular size and mass in young adults free
of clinical heart disease. These polymorphisms may also influence
the response of the left ventricle to increases in dietary salt.
Aldosterone controls sodium balance and intravascular
volume and thus helps regulate blood pressure (reviewed in Ref 11).
Therefore, genetic variations in the regulation of
aldosterone synthesis might influence the structure and
function of the left ventricle.
Aldosterone secretion is regulated primarily by the
renin-angiotensin system.11 In
response to decreased intravascular volume, renin is secreted by the
renal juxtaglomerular apparatus and converts
angiotensinogen to angiotensin I, which is then
converted to angiotensin II by ACE. The genes encoding
these components have been investigated as risk factors for
hypertension and, in some cases, left ventricular
hypertrophy. A deletion polymorphism in an intron (an
internal region of the gene that does not encode part of the protein)
has been associated with increased ACE levels,12
increased risk of cardiovascular
mortality,13 and increased risk of left
ventricular
hypertrophy.14 15 However, we have
been unable to confirm any association between ACE
genotype and left ventricular size or mass in
normal young adults,16 and a recent large
population-based study also failed to confirm either association or
genetic linkage between ACE and left ventricular
hypertrophy.17
In the adrenal cortex, aldosterone is synthesized from
deoxycorticosterone by a mitochondrial cytochrome P450 enzyme,
aldosterone synthase (CYP11B2).18 The
corresponding gene is located on chromosome 8, band 8q22. It is
adjacent to a closely related gene that encodes steroid
11ß-hydroxylase (CYP11B1), an enzyme required for cortisol
biosynthesis.19 Mutations in CYP11B2
can cause aldosterone deficiency.20
Conversely, an inherited form of hypertension,
glucocorticoid-suppressible hyperaldosteronism, is caused by genetic
recombinations between CYP11B1 and CYP11B2 that
increase expression of CYP11B2 and lead to inappropriate secretion of
aldosterone.21 22 23 Therefore, it is
plausible that other polymorphisms in CYP11B2 might affect
aldosterone biosynthesis and thus perhaps influence left
ventricular mass or size.
Several frequent polymorphisms have recently been described in the
transcriptional regulatory region and the second intron of
CYP11B2.24 We now report that two of
these polymorphisms have significant associations with left
ventricular size, mass, and function in an
age-homogeneous population sample with a low prevalence of
cardiovascular diseases.
The subjects' daily physical activity and ethanol and cigarette
consumption were determined by 2-month prospective daily
recording.25 The estimation of salt
intake was based on a 7-day food record.25
Body height and weight were measured in light indoor clothing just
before the echocardiographic examination. Resting
brachial artery cuff blood pressure was averaged over three
measurements made over the 2-month follow-up period. Hematocrit and
serum insulin were determined on venous blood obtained after an
overnight fast.25
All subjects were studied by M-mode
echocardiography to determine left
ventricular size (end-diastolic and
end-systolic cavity diameter), wall thickness, and mass and by
pulsed Doppler velocimetry to determine the peak early and late
(atrial) diastolic transmitral velocities, atrial filling
fraction, and deceleration of the early diastolic flow
velocity. Details of the technique and measurements, including
calculation of peripheral arterial
resistance,25 have been presented
previously.16 25 26 27 Data were analyzed
without knowledge of the subjects' other characteristics, including
the CYP11B2 genotype.
Molecular Analysis of the Aldosterone Synthase
(CYP11B2) Gene
Subjects were genotyped for the -344 promoter polymorphism
using primers CAGGAGGAGACCCCATGTGAC (sense) and CCTCCACCCTGTTCAGCCC
(antisense). Then, 5 µL from each reaction (consisting mainly of a
537-bp product) was digested with 10 U of restriction endonuclease
Hae III in the supplied buffer for 2 hours at 37°C.
Reactions were subjected to electrophoresis in 2.5% agarose gels. The
-344T allele lacks an Hae III site (GGCC)
present in the -344C allele, so -344T
alleles are detected as Hae III fragments of 273 bp and
-344C alleles as fragments of 202 bp (plus smaller
fragments in each case). Subjects were typed for a gene conversion
polymorphism in the second intron of CYP11B2 by allele-specific
polymerase chain reaction. Both reactions used the same antisense
primer: AGGAACCTCTGCACGGCC. Reactions to detect allele 1 with the
gene conversion (1013-bp product) also contained the primer
CAGAAAATCCCTCCCCCCTA (67°C annealing temperature), whereas reactions
to detect allele 2 lacking the gene conversion (yielding a 1017-bp
product) instead used the sense primer TGGAGAAAAGCCCTACCCTGT.
Statistical Analysis
Table 2
Associations Between CYP11B2 Genotype and
Echocardiographic Measurements
Stepwise multiple regression analyses also were performed.
Table 4
In the regression model for left ventricular mass
(see Table 4
Analyses of the echocardiographic data
using the same covariates as with the promoter polymorphism showed
that intron 2 polymorphism (expressed as the number of
nonconversion alleles) was an independent predictor of left
ventricular end-diastolic diameter (ß=.29,
P=.002) and mass (ß=.18, P=.010) and was
associated with differences in the peak early diastolic
transmitral velocity (P=.025). The associations with other
echocardiographic measurements did not reach
statistical significance.
The apparent effect of the CYP11B2 promoter polymorphism
on left ventricular size and mass is of considerable
magnitude. The data on left ventricular diameters (see
Table 2
Possible Explanations for CYP11B2 Genotype
Effects
In addition to indirect cardiovascular effects,
aldosterone has had direct actions on the heart in animal
studies, including induction of myocardial hypertrophy and
fibrosis.30 31 These effects are probably
mediated via mineralocorticoid receptors in the myocardium.
Although the mineralocorticoid receptor itself binds both
mineralocorticoids and glucocorticoids, mineralocorticoid target
tissues express an enzyme, 11ß-hydroxysteroid dehydrogenase, that
oxidizes glucocorticoids and prevents them from occupying the
mineralocorticoid receptor. Although it was originally thought that the
heart did not express this enzyme,32 33 more
recent studies have confirmed that the human heart does express the
same isozyme as the kidney and other mineralocorticoid target
tissues.34 35 This permits mineralocorticoids to
have direct effects on the heart.
It is not yet known whether the polymorphisms that we studied
actually affect aldosterone levels in young adults.
Although dietary sodium intake is known in our subjects, renin and
aldosterone levels and urinary sodium excretion values are
not available. Unpublished studies in other populations have thus far
yielded inconsistent results, with a trend toward higher
urinary aldosterone excretion associated with the
-344C allele in healthy white US schoolchildren but a
statistically significant association in the opposite direction in a
cohort of Finnish men who were slightly older (mean, 45 years) than the
group in the present study. To rigorously determine the effects of
CYP11B2 genotype on aldosterone
secretion, it would be most useful to examine a population in whom
blood aldosterone levels or 24-hour urinary
aldosterone excretion were measured under controlled
conditions of diet and activity.
The -344 position in the CYP11B2 promoter is immediately
adjacent to a binding site for a transcription factor, SF-1, that is
thought to be essential for expression of steroid biosynthetic enzymes
in the adrenal cortex.36 In vitro, the
-344C allele binds SF-1 approximately four times as
strongly as does the -344T allele (unpublished
observations), which is consistent with an effect on expression
of CYP11B2. However, in cultured human adrenocortical cells,
another SF-1 site downstream in the promoter is much more important for
transcriptional control, and the site near the -344 polymorphism
can be entirely deleted without affecting
transcription.37 It remains possible that the
-344 site is important for developmental regulation of
CYP11B2 in the adrenal or in extra-adrenal sites.
It also remains possible that the polymorphisms we examined are
merely markers for one or more additional nearby polymorphisms that
actually mediate the observed effects on heart size. There might be a
nonrandom association between the "large heart size" allele of
such a hypothetical locus and the -344C allele of
CYP11B2, a condition termed genetic linkage disequilbrium.
Indeed, the -344 and intron 2 polymorphisms are in linkage
disequilibrium, and similar associations have been documented between
polymorphisms in CYP11B2 and
CYP11B1.22 38 It is even theoretically
possible that polymorphisms in CYP11B1 are responsible
for our observations. However, the -344 promoter polymorphism is a
much better predictor of left ventricular size than is the
intron 2 gene conversion polymorphism. Because the degree of
linkage disequilibrium between loci is usually directly proportional to
their proximity, it is more likely that the -344 polymorphism is
close or identical to the polymorphism that is responsible for the
observed effects on heart size.
Comparisons With Previous Studies
Received March 12, 1997;
revision received September 18, 1997;
accepted October 20, 1997.
2.
Lauer MS, Evans JC, Levy D. Prognostic implications of
subclinical left ventricular dilatation and
systolic dysfunction in men free of overt
cardiovascular disease (the Framingham Heart Study).
Am J Cardiol. 1992;70:11801184.[Medline]
[Order article via Infotrieve]
3.
Galderisi M, Anderson KM, Wilson PW, Levy D.
Echocardiographic evidence for the existence of a
distinct diabetic cardiomyopathy (the Framingham
Heart Study). Am J Cardiol. 1991;68:8589.[Medline]
[Order article via Infotrieve]
4.
Manolio TA, Levy D, Garrison RJ, Castelli WP, Kannel
WB. Relation of alcohol intake to left ventricular mass:
the Framingham Study. J Am Coll Cardiol. 1991;17:717721.[Abstract]
5.
Levy D, Anderson KM, Savage DD, Kannel WB,
Christiansen JC, Castelli WP. Echocardiographically
detected left ventricular hypertrophy:
prevalence and risk factors: the Framingham Heart Study. Ann
Intern Med. 1988;108:713.
6.
Liebson PR, Grandits G, Prineas R, Dianzumba S, Flack
JM, Cutler JA, Grimm R, Stamler J. Echocardiographic
correlates of left ventricular structure among 844 mildly
hypertensive men and women in the Treatment of Mild Hypertension Study
(TOMHS). Circulation. 1993;87:476486.
7.
Adams TD, Yanowitz FG, Fisher AG, Ridges JD, Nelson
AG, Hagan AD, Williams RR, Hunt SC. Heritability of cardiac size: an
echocardiographic and electrocardiographic study of
monozygotic and dizygotic twins. Circulation. 1985;71:3944.
8.
Harshfield GA, Grim CE, Hwang C, Savage DD, Anderson
SJ. Genetic and environmental influences on
echocardiographically determined left
ventricular mass in black twins. Am J
Hypertens. 1990;3:538543.[Medline]
[Order article via Infotrieve]
9.
Bielen E, Fagard R, Amery A. Inheritance of heart
structure and physical exercise capacity: a study of left
ventricular structure and exercise capacity in 7-year-old
twins. Eur Heart J. 1990;11:716.
10.
Verhaaren HA, Schieken RM, Mosteller M, Hewitt JK,
Eaves LJ, Nance WE. Bivariate genetic analysis of left
ventricular mass and weight in pubertal twins (the Medical
College of Virginia Twin Study). Am J Cardiol. 1991;68:661668.[Medline]
[Order article via Infotrieve]
11.
White PC. Disorders of aldosterone
biosynthesis and action. N Engl J Med. 1994;331:250258.
12.
Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P,
Soubrier F. An insertion/deletion polymorphism in the
angiotensin I-converting enzyme gene accounting for half
the variance of serum enzyme levels. J Clin Invest. 1990;86:13431346.
13.
Cambien F, Poirier O, Lecerf L, Evans A, Cambou JP,
Arveiler D, Luc G, Bard JM, Bara L, Ricard S. Deletion polymorphism
in the gene for angiotensin-converting enzyme is a potent
risk factor for myocardial infarction. Nature. 1992;359:641644.[Medline]
[Order article via Infotrieve]
14.
Schunkert H, Hense HW, Holmer SR, Stender M, Perz S,
Keil U, Lorell BH, Riegger GA. Association between a deletion
polymorphism of the angiotensin-converting-enzyme gene
and left ventricular hypertrophy. N
Engl J Med. 1994;330:16341638.
15.
Iwai N, Ohmichi N, Nakamura Y, Kinoshita M.
DD genotype of the
angiotensin-converting enzyme gene is a risk factor for
left ventricular hypertrophy.
Circulation. 1994;90:26222628.
16.
Kupari M, Perola M, Koskinen P, Virolainen J, Karhunen
PJ. Left ventricular size, mass, and function in relation
to angiotensin-converting enzyme gene polymorphism in
humans. Am J Physiol. 1994;267:H1107H1111.
17.
Lindpaintner K, Lee MA, Larson MG, Rao US, Pfeffer MA,
Ordovas JM, Schaefer EJ, Wilson AF, Wilson PW, Vasan RS, Myers RH, Levy
D. Absence of association or genetic linkage between the
angiotensin-converting-enzyme gene and left
ventricular mass. N Engl J Med. 1996;334:10231028.
18.
Curnow KM, Tusie-Luna MT, Pascoe L, Natarajan R, Gu JL,
Nadler JL, White PC. The product of the CYP11B2 gene is required
for aldosterone biosynthesis in the human adrenal cortex.
Mol Endocrinol. 1991;5:15131522.
19.
Mornet E, Dupont J, Vitek A, White PC. Characterization
of two genes encoding human steroid 11 beta-hydroxylase (P-450(11)
beta). J Biol Chem. 1989;264:2096120967.
20.
Pascoe L, Curnow KM, Slutsker L, Rosler A, White PC.
Mutations in the human CYP11B2 (aldosterone synthase) gene
causing corticosterone methyloxidase II deficiency. Proc Natl
Acad Sci U S A. 1992;89:49965000.
21.
Lifton RP, Dluhy RG, Powers M, Rich GM, Cook S, Ulick
S, Lalouel JM. A chimaeric 11 beta-hydroxylase/aldosterone
synthase gene causes glucocorticoid-remediable aldosteronism and human
hypertension. Nature. 1992;355:262265.[Medline]
[Order article via Infotrieve]
22.
Lifton RP, Dluhy RG, Powers M, Rich GM, Gutkin M, Fallo
F, Gill JR Jr, Feld L, Ganguly A, Laidlaw JC, Murnaghan DJ, Kaufman C,
Stockigt JR, Ulick S, Lalouel JM. Hereditary hypertension caused by
chimaeric gene duplications and ectopic expression of
aldosterone synthase. Nat Genet. 1992;2:6674.[Medline]
[Order article via Infotrieve]
23.
Pascoe L, Curnow KM, Slutsker L, Connell JM, Speiser
PW, New MI, White PC. Glucocorticoid-suppressible hyperaldosteronism
results from hybrid genes created by unequal crossovers between CYP11B1
and CYP11B2. Proc Natl Acad Sci U S A. 1992;89:83278331.
24.
White PC, Slutsker L. Haplotype analysis of
CYP11B2. Endocr Res. 1995;21:437442.[Medline]
[Order article via Infotrieve]
25.
Kupari M, Koskinen P, Virolainen J. Correlates of left
ventricular mass in a population sample aged 36 to 37
years: focus on lifestyle and salt intake. Circulation. 1994;89:10411050.
26.
Kupari M, Koskinen P, Hynynen M, Salmenpera M, Ventila
M. Acute effects of ethanol on left ventricular
diastolic function. Br Heart J. 1990;64:129132.
27.
Kupari M. Reproducibility of M-mode
echocardiographic assessment of left
ventricular function: significance of the temporal range of
measurements. Eur Heart J. 1984;5:412418.
28.
Sullivan JM, Ratts TE, Schoenberger AA, Samaha JK,
Palmer ET. The effect of diet on echocardiographic left
ventricular dimensions in normal man. Am J Clin
Nutr. 1979;32:24102415.
29.
Ferrara LA, de Simone G, Pasanisi F, Mancini M. Left
ventricular mass reduction during salt depletion in
arterial hypertension. Hypertension. 1984;6:755759.
30.
Brilla CG, Matsubara LS, Weber KT.
Anti-aldosterone treatment and the prevention of myocardial
fibrosis in primary and secondary hyperaldosteronism. J Mol Cell
Cardiol. 1993;25:563575.[Medline]
[Order article via Infotrieve]
31.
Young M, Fullerton MJ, Dilley R, Funder JW.
Mineralocorticoids, hypertension and cardiac fibrosis. J
Clin Invest. 1994;93:25782583.
32.
Edwards CR, Stewart PM, Burt D, Brett L, McIntyre MA,
Sutanto WS, de Kloet ER, Monder C. Localisation of 11
beta-hydroxysteroid dehydrogenasetissue specific protector of the
mineralocorticoid receptor. Lancet. 1988;2:986989.[Medline]
[Order article via Infotrieve]
33.
Funder JW, Pearce PT, Smith R, Smith AI.
Mineralocorticoid action: target tissue specificity is enzyme, not
receptor, mediated. Science. 1988;242:583585.
34.
Lombes M, Alfaidy N, Eugene E, Lessana A, Farman N,
Bonvalet JP. Prerequisite for cardiac aldosterone action:
mineralocorticoid receptor and 11 beta-hydroxysteroid dehydrogenase in
the human heart. Circulation. 1995;92:175182.
35.
Slight S, Ganjam VK, Gomez-Sanchez CE, Zhou MY, Weber
KT. High affinity NAD+-dependent
11ß-hydroxysteroid dehydrogenase in the human heart. J Mol Cell
Cardiol. 1996;28:781787.[Medline]
[Order article via Infotrieve]
36.
Lala DS, Rice DA, Parker KL. Steroidogenic factor I, a
key regulator of steroidogenic enzyme expression, is the mouse homolog
of fushi tarazu-factor I. Mol Endocrinol. 1992;6:12491258.
37.
Clyne CD, Zhang Y, Slutsker L, Mathis JM, White PC,
Rainey WE. Angiotensin II and potassium regulate human
CYP11B2 transcription through common cis elements. Mol
Endocrinol. 1997;11:638649.
38.
Globerman H, Rosler A, Theodor R, New MI, White PC. An
inherited defect in aldosterone biosynthesis caused by a
mutation in or near the gene for steroid 11-hydroxylase. N
Engl J Med. 1988;319:11931197.[Abstract]
© 1998 American Heart Association, Inc.
Clinical Investigation and Reports
Associations Between Human Aldosterone Synthase (CYP11B2) Gene Polymorphisms and Left Ventricular Size, Mass, and Function
![]()
Abstract
Top
Abstract
Introduction
Methods
Results
Discussion
References
BackgroundAldosterone
has direct and indirect effects on the heart, and genetic variations in
aldosterone synthesis could therefore influence cardiac
structure and function. Such variations might be associated with
polymorphisms in the gene encoding aldosterone synthase
(CYP11B2), the enzyme catalyzing the last steps of
aldosterone biosynthesis.
Key Words: ventricles echocardiography genes
![]()
Introduction
Top
Abstract
Introduction
Methods
Results
Discussion
References
Left
ventricular size, mass, and function are important
predictors of cardiovascular morbidity and mortality in
cardiac patients and in the general
population.1 2 A number of constitutional and
environmental factors have been identified that influence left
ventricular size; these include age, sex, body size, blood
pressure, physical activity, salt intake, alcohol consumption, and the
presence of heart disease or diabetes.3 4 5 6
Studies of monozygotic and dizygotic twins have suggested that
inherited factors are also important.7 8 9 10
![]()
Methods
Top
Abstract
Introduction
Methods
Results
Discussion
References
Study Population
We previously examined left ventricular structure
and function in a population sample with a low prevalence of
cardiovascular diseases.16 25 We
solicited a random sample of 120 persons living in Helsinki who were 36
to 37 years old at the time of our investigation; 42 men and 51 women
(78% of the sample) entered the study.16 We
obtained both high-quality echocardiographic data and
leukocyte DNA samples on 84 subjects. Several subjects had been
followed for borderline blood pressure elevation, but none was on
antihypertensive drug therapy. No subject had heart disease by history,
clinical examination, or 12-lead ECG. At
echocardiography, 1 woman had moderate tricuspid
regurgitation, and 1 man had a possible incipient
dilated cardiomyopathy; both were
asymptomatic.
DNA was extracted from whole blood. Segments of CYP11B2 (Fig 1
) were amplified from
20 ng of each
DNA sample by the polymerase chain reaction in 20-µL reactions
containing 0.2 U Taq DNA polymerase, 1x concentration of
the supplied buffer, 0.2 mmol/L concentration of each
deoxynucleotide triphosphate, and 10 pmol of each primer.
After initial denaturation at 94°C for 5 minutes, a manual hot start
at 80°C was used, followed by 35 cycles of 94°C for 1 minute, 67°
or 68°C annealing for 1 minute, and 72°C extension for 2
minutes.

View larger version (16K):
[in a new window]
Figure 1. Top, Relative orientations of the
CYP11B2 (aldosterone synthase) and
CYP11B1 (11ß-hydroxylase) genes. Arrows indicate the
direction of transcription, and a scale of 10,000 bases (10 kb) is
marked. Bottom, Schematic of the CYP11B2 gene showing
the locations of polymorphisms at the -344 position in the
promoter and in the second intron (an intervening region that is
spliced out of mRNA). Protein-encoding regions in the gene are
indicated by boxes. A scale of 1000 bases (1 kb) is marked.
Group comparisons were made by ANOVA and the Kruskal-Wallis test
(asymmetrical data distribution). In comparing the groups for the
Doppler transmitral velocity measurements, heart rate was used as a
covariate. Frequency data were analyzed by the
2 test. A hypothesis of a "gene dosage
effect" on left ventricular measurements was tested by
linear regression analysis with the number of -344C
alleles in the CYP11B2 gene promoter (0, 1, and 2,
corresponding to TT, CT, and CC
genotypes) as the explanatory factor. Stepwise multiple linear
regression analysis was used to examine whether the number of
-344C alleles carried by each subject had statistical
influence on left ventricular diameters and mass
independent of sex, body size, blood pressure, hematocrit, serum
insulin, and lifestyle factors, including daily salt intake, physical
activity index (square-root transformed), smoking, and ethanol
consumption (square-root transformed). The
level for entry and
removal of terms at each forward step was .10. Asymmetrically
distributed variables were square-root transformed before
regression analysis. Continuous data are summarized as mean±SD
or as median (range). The associations found in
multivariate analyses are reported as multiple
regression coefficients (b) ±SEM and as standardized regression
coefficients (ß). Squared multiple correlation coefficients
(R2) were also calculated. Two-tailed
values of P<.05 were considered statistically
significant.
![]()
Results
Top
Abstract
Introduction
Methods
Results
Discussion
References
Genotyping of Subjects
We genotyped 84 individuals for two polymorphisms in
the aldosterone synthase (CYP11B2)
gene.24 The first is located in the
transcriptional regulatory region, or promoter, of CYP11B2,
344 nucleotides before the start of the protein coding
sequence. This position can be either a cytosine
(-344C) or thymidine (-344T).
Persons homozygous for C, heterozygous for C and T, or homozygous for T
will be referred to as having the genotypes -344CC,
-344CT, or -344TT, respectively. The second
polymorphism is in the second intron of CYP11B2; in some
individuals, the usual sequence of this intron has been largely
replaced by the sequence typically found in the related gene,
CYP11B1. Such replacement is termed gene conversion, and the
alleles at this locus will be referred to as 1 (conversion) and 2
(no conversion) (Fig 1
). The
genotype at the -344 position was TT in 22 persons,
CT in 42, and CC in 20. The distribution is
compatible with the Hardy-Weinberg equilibrium. There were no
statistically significant differences in sex distribution, body size
measurements, heart rate, peripheral arterial
resistance, hematocrit or insulin levels, physical activity, smoking,
ethanol consumption, or salt intake across the different
genotype groups (Table 1
). There
also were no significant differences in blood pressure.
View this table:
[in a new window]
Table 1. Characteristics of Subjects in the Different
Genotype Groups by Cytosine/Thymidine (C/T)
Polymorphism in the Promoter of the Aldosterone
Synthase Gene
shows the distribution of the
CYP11B2 intron 2 conversion genotypes in
relation to the -344 C/T promoter genotypes in our study
population. The data confirm linkage disequilibrium (ie, nonrandom
associations of alleles) between these two polymorphic loci in
the CYP11B2 gene; allele 1 in intron 2 was seen only in
association with -344T. Intron 2 genotype did not
influence any of the factors listed above (not shown).
View this table:
[in a new window]
Table 2. Distribution of the Promoter -344 C/T
Genotypes and Intron 2 Conversion Genotypes1
of
CYP11B2 in the Study Population
Table 3
summarizes the M-mode
and Doppler echocardiographic measurements for the
three CYP11B2 promoter genotype groups:
-344CC, -344CT, and -344TT. ANOVA
revealed a statistically significant main effect of the promoter
genotype on left ventricular
end-diastolic diameter (Fig 2
), end-systolic diameter,
early-to-late transmitral velocity ratio, and atrial filling fraction.
The data on left ventricular diameters, mass, and atrial
filling fraction were consistent with a gene dosage effect,
such that these parameters increased in a linear
relationship with the number of -344C alleles carried
by each subject.
View this table:
[in a new window]
Table 3. M-Mode and Doppler
Echocardiographic Measurements in the Different
Genotype Groups by Cytosine/Thymidine (C/T)
Polymorphism in the Promoter of the Aldosterone
Synthase Gene

View larger version (20K):
[in a new window]
Figure 2. Individual data on left ventricular
end-diastolic diameter in relation to the -344 C/T
polymorphism in the promoter of CYP11B2. Short
horizontal lines indicate group mean values.
lists the factors selected into
the multivariate models. The CYP11B2
promoter polymorphism was the single most important statistical
predictor of left ventricular diameters and also
independently predicted left ventricular mass. The result
was the same if weight, height, body mass index, or the second or third
power of height were substituted for body surface area or if sex was
forced into the equation (data not shown). In sex-specific
analyses, the CYP11B2 promoter polymorphism was
independently associated with left ventricular
end-diastolic diameter (ß=.43, P=.007),
end-systolic diameter (ß=.34, P=.036), and mass
(ß=.28, P=.036) in men and with end-diastolic
diameter (ß=.43, P=.0006) and end-systolic
diameter (ß=.41, P=.003), but not mass, in women.
View this table:
[in a new window]
Table 4. Multiple Regression Equations for the Prediction of
Left Ventricular Diameters and Mass
), a statistically significant interaction was observed
between the CYP11B2 promoter polymorphism and salt
intake (P=.001). Added to the equation, the product term
"salt intake*CYP11B2 polymorphism" increased the
R2 (predictive power) of the model from .65
to .70. Fig 3
illustrates the association
of left ventricular mass with salt intake in relation to
the CYP11B2 promoter genotype. The plots show that the
regression of left ventricular mass on salt intake was
strong and statistically highly significant in the -344CC
group, intermediate in the -344CT group, and nonexistent in
the -344TT group. We previously reported an interaction
between systolic blood pressure and salt intake on left
ventricular mass in the present study
population.16 The interaction between salt intake
and CYP11B2 promoter polymorphism remained statistically
significant (P=.045) even after the term "systolic
blood pressure*salt intake" was added to the model;
R2 rose to .73. No interaction between salt
intake and CYP11B2 promoter genotype was observed in
the models predicting left ventricular diameters.

View larger version (15K):
[in a new window]
Figure 3. The association of left ventricular
mass with sodium intake in relation to the CYP11B2 promoter
polymorphism. A through C, Plots for the -344TT,
-344CT, and -344CC genotype
groups, respectively. The left ventricular mass data are
adjusted for body surface area to remove any spurious association
resulting from the fact that both left ventricular mass and
sodium intake are related to body size.
![]()
Discussion
Top
Abstract
Introduction
Methods
Results
Discussion
References
CYP11B2 Genotype Influences Left
Ventricular Size
This study shows that polymorphic variations in the
CYP11B2 gene are associated with left
ventricular size, mass, and, to some extent,
diastolic function in persons free of clinical
cardiovascular disease. The influence of
CYP11B2 gene polymorphism is statistically independent
of constitutional and environmental factors that also predict left
ventricular measurements. We believe these observations
represent genuine associations because the nature of the study
population makes a selection bias unlikely, because we used validated
and reproducible methods for echocardiography and
CYP11B2 genotype assessment, and because the
investigators responsible for the respective analyses were
blinded to each other's work. The results are extremely unlikely to be
due to unsuspected admixture of populations in our study sample because
the population of Helsinki is ethnically highly homogeneous
and the allele frequencies obtained in the present study are
identical to those of Caucasian populations in the United States and
the United Kingdom (unpublished observations). To the best of our
knowledge, CYP11B2 genotype is the only genetic
factor identified thus far that affects heart size in young adults.
) suggest that homozygotes for the -344C allele
(ie, -344CC genotype) average, by cubic
approximation, 28% larger end-diastolic volumes and 21%
greater mass than homozygotes for the -344T allele
(-344TT). The Doppler indexes of left
ventricular diastolic function fit logically
with the size measurements in that the genotype group with the
smallest left ventricular mass (-344TT) has the
"best" preserved diastolic function as indicated by the
highest early-to-late transmitral velocity ratio and the lowest atrial
filling fraction.
The mechanism of the association of left ventricular
size and mass with the CYP11B2 promoter polymorphism is
unknown at present. The M-mode echocardiographic
data on left ventricular size (Table 3
) are compatible with
an increased volume load on the left ventricle in persons with
-344CC and, to a lesser extent, with -344CT
compared with the -344TT genotype. The measurements
also suggest that the increase of left ventricular mass
with the number of -344C alleles reflects increasing
ventricular volume rather than differences in wall
thickness. Previous echocardiographic studies in humans
have demonstrated that increases or decreases in dietary sodium result
in corresponding changes in left ventricular volumes and
mass.28 29 Thus, differences in the body's
sodium balance and intravascular volume related to the
CYP11B2 genotype are a plausible mechanism for our
observations. This idea is supported by the interaction between the
effects of salt intake and CYP11B2 promoter genotype
on left ventricular mass.
The design of the present study differs in important respects
from other studies of genetic influences on left
ventricular characteristics. Our study population was
relatively young and homogeneous for age. Moreover, our
population was almost completely free of hypertension and other
cardiovascular disease, whereas other studies examined
patients from cardiology clinics or individuals with
ECG evidence of left ventricular hypertrophy.
Thus, studies of our population should only detect factors that affect
left ventricular size or function in young, healthy adults.
Conversely, although the present study demonstrates that
CYP11B2 genotype has major effects on heart size in
normal individuals, it cannot answer the question of whether
CYP11B2 genotype is, like ACE, a possible
risk factor for the development of cardiovascular
pathology such as myocardial infarction. Case-control studies of
patients with cardiovascular disease would be the best
way to answer this question.
![]()
Acknowledgments
This work was supported in part by grants from the Foundation
for Alcohol Research and the Signe and Ane Gyllenberg Foundation,
Helsinki, Finland, and grants DK42169 and DK37867 from the National
Institutes of Health.
![]()
Footnotes
Reprint requests to Perrin C. White, MD, Division of Pediatric Endocrinology, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd, Dallas, TX 75235-9063.
![]()
References
Top
Abstract
Introduction
Methods
Results
Discussion
References
1.
Levy D, Garrison RJ, Savage DD, Kannel WB,
Castelli WP. Prognostic implications of
echocardiographically determined left
ventricular mass in the Framingham Heart Study.
N Engl J Med. 1990;322:15611566.[Abstract]
This article has been cited by other articles:
![]() |
S Sookoian, T F Gianotti, and C J Pirola Role of the C-344T aldosterone synthase gene variant in left ventricular mass and left ventricular structure-related phenotypes Heart, July 1, 2008; 94(7): 903 - 910. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. de Denus, M. Zakrzewski-Jakubiak, M.-P. Dube, F. Belanger, S. Lepage, M.-H. Leblanc, D. Gossard, A. Ducharme, N. Racine, L. Whittom, et al. Effects of AGTR1 A1166C Gene Polymorphism in Patients with Heart Failure Treated with Candesartan Ann. Pharmacother., July 1, 2008; 42(7): 925 - 932. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Barr, S. M. MacKenzie, E. C. Friel, C. D. Holloway, D. M. Wilkinson, N. J.R. Brain, M. C. Ingram, R. Fraser, M. Brown, N. J. Samani, et al. Polymorphic Variation in the 11{beta}-Hydroxylase Gene Associates With Reduced 11-Hydroxylase Efficiency Hypertension, January 1, 2007; 49(1): 113 - 119. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. McNamara, S. W. Tam, M. L. Sabolinski, P. Tobelmann, K. Janosko, A. L. Taylor, J. N. Cohn, A. M. Feldman, and M. Worcel Aldosterone Synthase Promoter Polymorphism Predicts Outcome in African Americans With Heart Failure: Results From the A-HeFT Trial J. Am. Coll. Cardiol., September 19, 2006; 48(6): 1277 - 1282. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Perkins, S. L. Van Driest, E. G. Ellsworth, M. L. Will, B. J. Gersh, S. R. Ommen, and M. J. Ackerman Gene-specific modifying effects of pro-LVH polymorphisms involving the renin-angiotensin-aldosterone system among 389 unrelated patients with hypertrophic cardiomyopathy Eur. Heart J., November 2, 2005; 26(22): 2457 - 2462. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tanahashi, T. Mune, Y. Takahashi, M. Isaji, T. Suwa, H. Morita, N. Yamakita, K. Yasuda, T. Deguchi, P. C. White, et al. Association of Lys173Arg Polymorphism with CYP11B2 Expression in Normal Adrenal Glands and Aldosterone-Producing Adenomas J. Clin. Endocrinol. Metab., November 1, 2005; 90(11): 6226 - 6231. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Meneton, X. Jeunemaitre, H. E. de Wardener, and G. A. Macgregor Links Between Dietary Salt Intake, Renal Salt Handling, Blood Pressure, and Cardiovascular Diseases Physiol Rev, April 1, 2005; 85(2): 679 - 715. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. C. White and W. E. Rainey Polymorphisms in CYP11B Genes and 11-Hydroxylase Activity J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1252 - 1255. [Full Text] [PDF] |
||||
![]() |
B. Keavney, B. Mayosi, N. Gaukrodger, H. Imrie, M. Baker, R. Fraser, M. Ingram, H. Watkins, M. Farrall, E. Davies, et al. Genetic Variation at the Locus Encompassing 11-{beta} Hydroxylase and Aldosterone Synthase Accounts for Heritability in Cortisol Precursor (11-Deoxycortisol) Urinary Metabolite Excretion J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1072 - 1077. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. K Shieh, E. Kotlyar, and F. Sam Aldosterone and cardiovascular remodelling: focus on myocardial failure Journal of Renin-Angiotensin-Aldosterone System, March 1, 2004; 5(1): 3 - 13. [Abstract] [PDF] |
||||
![]() |
P. Stella, G. Bigatti, L. Tizzoni, C. Barlassina, C. Lanzani, G. Bianchi, and D. Cusi Association between aldosterone synthase (CYP11B2) polymorphism and left ventricular mass in human essential hypertension J. Am. Coll. Cardiol., January 21, 2004; 43(2): 265 - 270. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kosachunhanun, S. C. Hunt, P. N. Hopkins, R. R. Williams, X. Jeunemaitre, P. Corvol, C. Ferri, R. M. Mortensen, N. K. Hollenberg, and G. H. Williams Genetic Determinants of Nonmodulating Hypertension Hypertension, November 1, 2003; 42(5): 901 - 908. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. C. White Aldosterone: Direct Effects on and Production by the Heart J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2376 - 2383. [Full Text] [PDF] |
||||
![]() |
J Song, I Narita, S Goto, N Saito, K Omori, F Sato, J Ajiro, D Saga, D Kondo, M Sakatsume, et al. Gender specific association of aldosterone synthase gene polymorphism with renal survival in patients with IgA nephropathy J. Med. Genet., May 1, 2003; 40(5): 372 - 376. [Full Text] [PDF] |
||||
![]() |
L. Swan, D.H. Birnie, S. Padmanabhan, G. Inglis, J.M.C. Connell, and W.S. Hillis The genetic determination of left ventricular mass in healthy adults Eur. Heart J., March 2, 2003; 24(6): 577 - 582. [Abstract] [Full Text] [PDF] |
||||
![]() |
E Takai, H Akita, K Kanazawa, N Shiga, M Terashima, Y Matsuda, C Iwai, Y Miyamoto, H Kawai, A Takarada, et al. Association between aldosterone synthase (CYP11B2) gene polymorphism and left ventricular volume in patients with dilated cardiomyopathy Heart, December 1, 2002; 88(6): 649 - 650. [Full Text] [PDF] |
||||
![]() |
P. O. Lim, T. M. Macdonald, C. Holloway, E. Friel, N. H. Anderson, E. Dow, R. T. Jung, E. Davies, R. Fraser, and J. M. C. Connell Variation at the Aldosterone Synthase (CYP11B2) Locus Contributes to Hypertension in Subjects with a Raised Aldosterone-to-Renin Ratio J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4398 - 4402. [Abstract] [Full Text] [PDF] |
||||
![]() |
J R Ortlepp, H P Vosberg, S Reith, F Ohme, N G Mahon, D Schroder, H G Klues, P Hanrath, and W J McKenna Genetic polymorphisms in the renin-angiotensin-aldosterone system associated with expression of left ventricular hypertrophy in hypertrophic cardiomyopathy: a study of five polymorphic genes in a family with a disease causing mutation in the myosin binding protein C gene Heart, March 1, 2002; 87(3): 270 - 275. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Delles, J. Erdmann, J. Jacobi, K. F. Hilgers, E. Fleck, V. Regitz-Zagrosek, and R. E. Schmieder Aldosterone synthase (CYP11B2) -344 C/T polymorphism is associated with left ventricular structure in human arterial hypertension J. Am. Coll. Cardiol., March 1, 2001; 37(3): 878 - 884. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Padmanabhan, S. Padmanabhan, and J. M. Connell Genetic basis of cardiovascular disease -- the renin-angiotensin-aldosterone system as a paradigm Journal of Renin-Angiotensin-Aldosterone System, December 1, 2000; 1(4): 316 - 324. [PDF] |
||||
![]() |
Y. Tsujita, N. Iwai, S. Tamaki, Y. Nakamura, M. Nishimura, and M. Kinoshita Genetic mapping of quantitative trait loci influencing left ventricular mass in rats Am J Physiol Heart Circ Physiol, November 1, 2000; 279(5): H2062 - H2067. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Agarwal, G. Giacchetti, G. Lavery, H. Nikkila, M. Palermo, M. Ricketts, C. McTernan, G. Bianchi, P. Manunta, P. Strazzullo, et al. CA-Repeat Polymorphism in Intron 1 of HSD11B2 : Effects on Gene Expression and Salt Sensitivity Hypertension, August 1, 2000; 36(2): 187 - 194. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Mulatero, D. Schiavone, F. Fallo, F. Rabbia, C. Pilon, L. Chiandussi, L. Pascoe, and F. Veglio CYP11B2 Gene Polymorphisms in Idiopathic Hyperaldosteronism Hypertension, March 1, 2000; 35(3): 694 - 698. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hengstenberg, S. R. Holmer, B. Mayer, H. Lowel, S. Engel, H.-W. Hense, G. A. J. Riegger, and H. Schunkert Evaluation of the Aldosterone Synthase (CYP11B2) Gene Polymorphism in Patients With Myocardial Infarction Hypertension, March 1, 2000; 35(3): 704 - 709. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Tiret, C. Mallet, O. Poirier, V. Nicaud, A. Millaire, J.-B. Bouhour, G.e. Roizes, M. Desnos, R. Dorent, K. Schwartz, et al. Lack of association between polymorphisms of eight candidate genes and idiopathic dilated cardiomyopathy: The CARDIGENE study J. Am. Coll. Cardiol., January 1, 2000; 35(1): 29 - 35. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ylitalo, K. E. J. Airaksinen, A. Hautanen, M. Kupari, M. Carson, J. Virolainen, M. Savolainen, H. Kauma, Y. A. Kesaniemi, P. C. White, et al. Baroreflex sensitivity and variants of the renin angiotensin system genes J. Am. Coll. Cardiol., January 1, 2000; 35(1): 194 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hautanen, P. Toivanen, M. Manttari, L. Tenkanen, M. Kupari, V. Manninen, K. M. Kayes, S. Rosenfeld, and P. C. White Joint Effects of an Aldosterone Synthase (CYP11B2) Gene Polymorphism and Classic Risk Factors on Risk of Myocardial Infarction Circulation, November 30, 1999; 100(22): 2213 - 2218. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Delcayre and J.-S. Silvestre Aldosterone and the heart: towards a physiological function? Cardiovasc Res, July 1, 1999; 43(1): 7 - 12. [Full Text] [PDF] |
||||
![]() |
H. Schunkert, C. Hengstenberg, S. R. Holmer, U. Broeckel, A. Luchner, M. W. Muscholl, S. Kurzinger, A. Doring, H.-W. Hense, and G. A. J. Riegger Lack of Association Between a Polymorphism of the Aldosterone Synthase Gene and Left Ventricular Structure Circulation, May 4, 1999; 99(17): 2255 - 2260. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takeda, K. Furukawa, S. Inaba, I. Miyamori, and H. Mabuchi Genetic Analysis of Aldosterone Synthase in Patients with Idiopathic Hyperaldosteronism J. Clin. Endocrinol. Metab., May 1, 1999; 84(5): 1633 - 1637. [Abstract] [Full Text] |
||||
![]() |
E. Davies, C. D. Holloway, M. C. Ingram, G. C. Inglis, E. C. Friel, C. Morrison, N. H. Anderson, R. Fraser, and J. M. C. Connell Aldosterone Excretion Rate and Blood Pressure in Essential Hypertension Are Related to Polymorphic Differences in the Aldosterone Synthase Gene CYP11B2 Hypertension, February 1, 1999; 33(2): 703 - 707. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tamaki, N. Iwai, Y. Tsujita, and M. Kinoshita Genetic Polymorphism of CYP11B2 Gene and Hypertension in Japanese Hypertension, January 1, 1999; 33(1): 266 - 270. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Lloyd-MacGilp, L. Torielli, S. Bechtel, G. Tripodi, C. E. Gomez-Sanchez, L. Zagato, R. Bernhardt, and C. J. Kenyon Mutations in aldosterone synthase gene of Milan hypertensive rats: phenotypic consequences Am J Physiol Endocrinol Metab, March 1, 2002; 282(3): E608 - E617. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1998 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |