This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kupari, M. Articles by White, P. C. Search for Related Content PubMed PubMed Citation Articles by Kupari, M. Articles by White, P. C.

(Circulation. 1998;97:569-575.)
© 1998 American Heart Association, Inc.

Clinical Investigation and Reports

Associations Between Human Aldosterone Synthase (CYP11B2) Gene Polymorphisms and Left Ventricular Size, Mass, and Function

Markku Kupari, MD; Aarno Hautanen, MD; Laura Lankinen, MB; Pekka Koskinen, MD; Juha Virolainen, MD; Heli Nikkila, PhD; ; Perrin C. White, MD

From the Division of Cardiology (M.K., P.K., J.V.), Department of Medicine, Helsinki University Central Hospital, Helsinki, Finland; Institute of Biomedicine and Physiology (A.H., L.L.), University of Helsinki, Finland; and Department of Pediatrics (H.N., P.C.W.), University of Texas Southwestern Medical Center (Dallas).

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background—Aldosterone has direct and indirect effects on the heart, and genetic variations in aldosterone synthesis could therefore influence cardiac structure and function. Such variations might be associated with polymorphisms in the gene encoding aldosterone synthase (CYP11B2), the enzyme catalyzing the last steps of aldosterone biosynthesis.

Methods and Results—A Finnish population sample of 84 persons (44 women) aged 36 to 37 years was studied by M-mode and Doppler echocardiography to assess left ventricular size, mass, and function. Subjects were genotyped through the use of the polymerase chain reaction for two diallelic polymorphisms in CYP11B2: one in the transcriptional regulatory region (promoter) and the other in the second intron. In multiple regression analyses, the CYP11B2 promoter genotype predicted statistically significant variations in left ventricular end-diastolic diameter (ß=.40, P<.0001), end-systolic diameter (ß=.33, P=.0009), and mass (ß=.17, P=.023). These effects were independent of potentially confounding factors, including sex, body size, blood pressure, physical activity, smoking, and ethanol consumption. Genotype groups also differed in a measure of left ventricular diastolic function, the heart rate–adjusted atrial filling fraction (P=.018). Increased dietary salt, which is known to predict increased left ventricular mass, had this effect only in association with certain CYP11B2 genotypes (P<.001).

Conclusions—Genetic variations in or near the aldosterone synthase (CYP11B2) gene strongly affect left ventricular size and mass in young adults free of clinical heart disease. These polymorphisms may also influence the response of the left ventricle to increases in dietary salt.

Key Words: ventricles • echocardiography • genes

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Left ventricular size, mass, and function are important predictors of cardiovascular morbidity and mortality in cardiac patients and in the general population.^{1 2} A number of constitutional and environmental factors have been identified that influence left ventricular size; these include age, sex, body size, blood pressure, physical activity, salt intake, alcohol consumption, and the presence of heart disease or diabetes.^{3 4 5 6} Studies of monozygotic and dizygotic twins have suggested that inherited factors are also important.^{7 8 9 10}

Aldosterone controls sodium balance and intravascular volume and thus helps regulate blood pressure (reviewed in Ref 11). Therefore, genetic variations in the regulation of aldosterone synthesis might influence the structure and function of the left ventricle.

Aldosterone secretion is regulated primarily by the renin-angiotensin system.¹¹ In response to decreased intravascular volume, renin is secreted by the renal juxtaglomerular apparatus and converts angiotensinogen to angiotensin I, which is then converted to angiotensin II by ACE. The genes encoding these components have been investigated as risk factors for hypertension and, in some cases, left ventricular hypertrophy. A deletion polymorphism in an intron (an internal region of the gene that does not encode part of the protein) has been associated with increased ACE levels,¹² increased risk of cardiovascular mortality,¹³ and increased risk of left ventricular hypertrophy.^{14 15} However, we have been unable to confirm any association between ACE genotype and left ventricular size or mass in normal young adults,¹⁶ and a recent large population-based study also failed to confirm either association or genetic linkage between ACE and left ventricular hypertrophy.¹⁷

In the adrenal cortex, aldosterone is synthesized from deoxycorticosterone by a mitochondrial cytochrome P450 enzyme, aldosterone synthase (CYP11B2).¹⁸ The corresponding gene is located on chromosome 8, band 8q22. It is adjacent to a closely related gene that encodes steroid 11ß-hydroxylase (CYP11B1), an enzyme required for cortisol biosynthesis.¹⁹ Mutations in CYP11B2 can cause aldosterone deficiency.²⁰ Conversely, an inherited form of hypertension, glucocorticoid-suppressible hyperaldosteronism, is caused by genetic recombinations between CYP11B1 and CYP11B2 that increase expression of CYP11B2 and lead to inappropriate secretion of aldosterone.^{21 22 23} Therefore, it is plausible that other polymorphisms in CYP11B2 might affect aldosterone biosynthesis and thus perhaps influence left ventricular mass or size.

Several frequent polymorphisms have recently been described in the transcriptional regulatory region and the second intron of CYP11B2.²⁴ We now report that two of these polymorphisms have significant associations with left ventricular size, mass, and function in an age-homogeneous population sample with a low prevalence of cardiovascular diseases.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Study Population
We previously examined left ventricular structure and function in a population sample with a low prevalence of cardiovascular diseases.^{16 25} We solicited a random sample of 120 persons living in Helsinki who were 36 to 37 years old at the time of our investigation; 42 men and 51 women (78% of the sample) entered the study.¹⁶ We obtained both high-quality echocardiographic data and leukocyte DNA samples on 84 subjects. Several subjects had been followed for borderline blood pressure elevation, but none was on antihypertensive drug therapy. No subject had heart disease by history, clinical examination, or 12-lead ECG. At echocardiography, 1 woman had moderate tricuspid regurgitation, and 1 man had a possible incipient dilated cardiomyopathy; both were asymptomatic.

The subjects' daily physical activity and ethanol and cigarette consumption were determined by 2-month prospective daily recording.²⁵ The estimation of salt intake was based on a 7-day food record.²⁵ Body height and weight were measured in light indoor clothing just before the echocardiographic examination. Resting brachial artery cuff blood pressure was averaged over three measurements made over the 2-month follow-up period. Hematocrit and serum insulin were determined on venous blood obtained after an overnight fast.²⁵

All subjects were studied by M-mode echocardiography to determine left ventricular size (end-diastolic and end-systolic cavity diameter), wall thickness, and mass and by pulsed Doppler velocimetry to determine the peak early and late (atrial) diastolic transmitral velocities, atrial filling fraction, and deceleration of the early diastolic flow velocity. Details of the technique and measurements, including calculation of peripheral arterial resistance,²⁵ have been presented previously.^{16 25 26 27} Data were analyzed without knowledge of the subjects' other characteristics, including the CYP11B2 genotype.

Molecular Analysis of the Aldosterone Synthase (CYP11B2) Gene
DNA was extracted from whole blood. Segments of CYP11B2 (Fig 1) were amplified from 20 ng of each DNA sample by the polymerase chain reaction in 20-µL reactions containing 0.2 U Taq DNA polymerase, 1x concentration of the supplied buffer, 0.2 mmol/L concentration of each deoxynucleotide triphosphate, and 10 pmol of each primer. After initial denaturation at 94°C for 5 minutes, a manual hot start at 80°C was used, followed by 35 cycles of 94°C for 1 minute, 67° or 68°C annealing for 1 minute, and 72°C extension for 2 minutes.

View larger version (16K): [in this window] [in a new window]   Figure 1. Top, Relative orientations of the CYP11B2 (aldosterone synthase) and CYP11B1 (11ß-hydroxylase) genes. Arrows indicate the direction of transcription, and a scale of 10,000 bases (10 kb) is marked. Bottom, Schematic of the CYP11B2 gene showing the locations of polymorphisms at the -344 position in the promoter and in the second intron (an intervening region that is spliced out of mRNA). Protein-encoding regions in the gene are indicated by boxes. A scale of 1000 bases (1 kb) is marked.

Subjects were genotyped for the -344 promoter polymorphism using primers CAGGAGGAGACCCCATGTGAC (sense) and CCTCCACCCTGTTCAGCCC (antisense). Then, 5 µL from each reaction (consisting mainly of a 537-bp product) was digested with 10 U of restriction endonuclease Hae III in the supplied buffer for 2 hours at 37°C. Reactions were subjected to electrophoresis in 2.5% agarose gels. The -344T allele lacks an Hae III site (GGCC) present in the -344C allele, so -344T alleles are detected as Hae III fragments of 273 bp and -344C alleles as fragments of 202 bp (plus smaller fragments in each case). Subjects were typed for a gene conversion polymorphism in the second intron of CYP11B2 by allele-specific polymerase chain reaction. Both reactions used the same antisense primer: AGGAACCTCTGCACGGCC. Reactions to detect allele 1 with the gene conversion (1013-bp product) also contained the primer CAGAAAATCCCTCCCCCCTA (67°C annealing temperature), whereas reactions to detect allele 2 lacking the gene conversion (yielding a 1017-bp product) instead used the sense primer TGGAGAAAAGCCCTACCCTGT.

Statistical Analysis
Group comparisons were made by ANOVA and the Kruskal-Wallis test (asymmetrical data distribution). In comparing the groups for the Doppler transmitral velocity measurements, heart rate was used as a covariate. Frequency data were analyzed by the ² test. A hypothesis of a "gene dosage effect" on left ventricular measurements was tested by linear regression analysis with the number of -344C alleles in the CYP11B2 gene promoter (0, 1, and 2, corresponding to TT, CT, and CC genotypes) as the explanatory factor. Stepwise multiple linear regression analysis was used to examine whether the number of -344C alleles carried by each subject had statistical influence on left ventricular diameters and mass independent of sex, body size, blood pressure, hematocrit, serum insulin, and lifestyle factors, including daily salt intake, physical activity index (square-root transformed), smoking, and ethanol consumption (square-root transformed). The level for entry and removal of terms at each forward step was .10. Asymmetrically distributed variables were square-root transformed before regression analysis. Continuous data are summarized as mean±SD or as median (range). The associations found in multivariate analyses are reported as multiple regression coefficients (b) ±SEM and as standardized regression coefficients (ß). Squared multiple correlation coefficients (R²) were also calculated. Two-tailed values of P<.05 were considered statistically significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Genotyping of Subjects
We genotyped 84 individuals for two polymorphisms in the aldosterone synthase (CYP11B2) gene.²⁴ The first is located in the transcriptional regulatory region, or promoter, of CYP11B2, 344 nucleotides before the start of the protein coding sequence. This position can be either a cytosine (-344C) or thymidine (-344T). Persons homozygous for C, heterozygous for C and T, or homozygous for T will be referred to as having the genotypes -344CC, -344CT, or -344TT, respectively. The second polymorphism is in the second intron of CYP11B2; in some individuals, the usual sequence of this intron has been largely replaced by the sequence typically found in the related gene, CYP11B1. Such replacement is termed gene conversion, and the alleles at this locus will be referred to as 1 (conversion) and 2 (no conversion) (Fig 1). The genotype at the -344 position was TT in 22 persons, CT in 42, and CC in 20. The distribution is compatible with the Hardy-Weinberg equilibrium. There were no statistically significant differences in sex distribution, body size measurements, heart rate, peripheral arterial resistance, hematocrit or insulin levels, physical activity, smoking, ethanol consumption, or salt intake across the different genotype groups (Table 1). There also were no significant differences in blood pressure.

View this table: [in this window] [in a new window]   Table 1. Characteristics of Subjects in the Different Genotype Groups by Cytosine/Thymidine (C/T) Polymorphism in the Promoter of the Aldosterone Synthase Gene

Table 2 shows the distribution of the CYP11B2 intron 2 conversion genotypes in relation to the -344 C/T promoter genotypes in our study population. The data confirm linkage disequilibrium (ie, nonrandom associations of alleles) between these two polymorphic loci in the CYP11B2 gene; allele 1 in intron 2 was seen only in association with -344T. Intron 2 genotype did not influence any of the factors listed above (not shown).

View this table: [in this window] [in a new window]   Table 2. Distribution of the Promoter -344 C/T Genotypes and Intron 2 Conversion Genotypes1 of CYP11B2 in the Study Population

Associations Between CYP11B2 Genotype and Echocardiographic Measurements
Table 3 summarizes the M-mode and Doppler echocardiographic measurements for the three CYP11B2 promoter genotype groups: -344CC, -344CT, and -344TT. ANOVA revealed a statistically significant main effect of the promoter genotype on left ventricular end-diastolic diameter (Fig 2), end-systolic diameter, early-to-late transmitral velocity ratio, and atrial filling fraction. The data on left ventricular diameters, mass, and atrial filling fraction were consistent with a gene dosage effect, such that these parameters increased in a linear relationship with the number of -344C alleles carried by each subject.

View this table: [in this window] [in a new window]   Table 3. M-Mode and Doppler Echocardiographic Measurements in the Different Genotype Groups by Cytosine/Thymidine (C/T) Polymorphism in the Promoter of the Aldosterone Synthase Gene

View larger version (20K): [in this window] [in a new window]   Figure 2. Individual data on left ventricular end-diastolic diameter in relation to the -344 C/T polymorphism in the promoter of CYP11B2. Short horizontal lines indicate group mean values.

Stepwise multiple regression analyses also were performed. Table 4 lists the factors selected into the multivariate models. The CYP11B2 promoter polymorphism was the single most important statistical predictor of left ventricular diameters and also independently predicted left ventricular mass. The result was the same if weight, height, body mass index, or the second or third power of height were substituted for body surface area or if sex was forced into the equation (data not shown). In sex-specific analyses, the CYP11B2 promoter polymorphism was independently associated with left ventricular end-diastolic diameter (ß=.43, P=.007), end-systolic diameter (ß=.34, P=.036), and mass (ß=.28, P=.036) in men and with end-diastolic diameter (ß=.43, P=.0006) and end-systolic diameter (ß=.41, P=.003), but not mass, in women.

View this table: [in this window] [in a new window]   Table 4. Multiple Regression Equations for the Prediction of Left Ventricular Diameters and Mass

In the regression model for left ventricular mass (see Table 4), a statistically significant interaction was observed between the CYP11B2 promoter polymorphism and salt intake (P=.001). Added to the equation, the product term "salt intake*CYP11B2 polymorphism" increased the R² (predictive power) of the model from .65 to .70. Fig 3 illustrates the association of left ventricular mass with salt intake in relation to the CYP11B2 promoter genotype. The plots show that the regression of left ventricular mass on salt intake was strong and statistically highly significant in the -344CC group, intermediate in the -344CT group, and nonexistent in the -344TT group. We previously reported an interaction between systolic blood pressure and salt intake on left ventricular mass in the present study population.¹⁶ The interaction between salt intake and CYP11B2 promoter polymorphism remained statistically significant (P=.045) even after the term "systolic blood pressure*salt intake" was added to the model; R² rose to .73. No interaction between salt intake and CYP11B2 promoter genotype was observed in the models predicting left ventricular diameters.

View larger version (15K): [in this window] [in a new window]   Figure 3. The association of left ventricular mass with sodium intake in relation to the CYP11B2 promoter polymorphism. A through C, Plots for the -344TT, -344CT, and -344CC genotype groups, respectively. The left ventricular mass data are adjusted for body surface area to remove any spurious association resulting from the fact that both left ventricular mass and sodium intake are related to body size.

Analyses of the echocardiographic data using the same covariates as with the promoter polymorphism showed that intron 2 polymorphism (expressed as the number of nonconversion alleles) was an independent predictor of left ventricular end-diastolic diameter (ß=.29, P=.002) and mass (ß=.18, P=.010) and was associated with differences in the peak early diastolic transmitral velocity (P=.025). The associations with other echocardiographic measurements did not reach statistical significance.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
CYP11B2 Genotype Influences Left Ventricular Size
This study shows that polymorphic variations in the CYP11B2 gene are associated with left ventricular size, mass, and, to some extent, diastolic function in persons free of clinical cardiovascular disease. The influence of CYP11B2 gene polymorphism is statistically independent of constitutional and environmental factors that also predict left ventricular measurements. We believe these observations represent genuine associations because the nature of the study population makes a selection bias unlikely, because we used validated and reproducible methods for echocardiography and CYP11B2 genotype assessment, and because the investigators responsible for the respective analyses were blinded to each other's work. The results are extremely unlikely to be due to unsuspected admixture of populations in our study sample because the population of Helsinki is ethnically highly homogeneous and the allele frequencies obtained in the present study are identical to those of Caucasian populations in the United States and the United Kingdom (unpublished observations). To the best of our knowledge, CYP11B2 genotype is the only genetic factor identified thus far that affects heart size in young adults.

The apparent effect of the CYP11B2 promoter polymorphism on left ventricular size and mass is of considerable magnitude. The data on left ventricular diameters (see Table 2) suggest that homozygotes for the -344C allele (ie, -344CC genotype) average, by cubic approximation, 28% larger end-diastolic volumes and 21% greater mass than homozygotes for the -344T allele (-344TT). The Doppler indexes of left ventricular diastolic function fit logically with the size measurements in that the genotype group with the smallest left ventricular mass (-344TT) has the "best" preserved diastolic function as indicated by the highest early-to-late transmitral velocity ratio and the lowest atrial filling fraction.

Possible Explanations for CYP11B2 Genotype Effects
The mechanism of the association of left ventricular size and mass with the CYP11B2 promoter polymorphism is unknown at present. The M-mode echocardiographic data on left ventricular size (Table 3) are compatible with an increased volume load on the left ventricle in persons with -344CC and, to a lesser extent, with -344CT compared with the -344TT genotype. The measurements also suggest that the increase of left ventricular mass with the number of -344C alleles reflects increasing ventricular volume rather than differences in wall thickness. Previous echocardiographic studies in humans have demonstrated that increases or decreases in dietary sodium result in corresponding changes in left ventricular volumes and mass.^{28 29} Thus, differences in the body's sodium balance and intravascular volume related to the CYP11B2 genotype are a plausible mechanism for our observations. This idea is supported by the interaction between the effects of salt intake and CYP11B2 promoter genotype on left ventricular mass.

In addition to indirect cardiovascular effects, aldosterone has had direct actions on the heart in animal studies, including induction of myocardial hypertrophy and fibrosis.^{30 31} These effects are probably mediated via mineralocorticoid receptors in the myocardium. Although the mineralocorticoid receptor itself binds both mineralocorticoids and glucocorticoids, mineralocorticoid target tissues express an enzyme, 11ß-hydroxysteroid dehydrogenase, that oxidizes glucocorticoids and prevents them from occupying the mineralocorticoid receptor. Although it was originally thought that the heart did not express this enzyme,^{32 33} more recent studies have confirmed that the human heart does express the same isozyme as the kidney and other mineralocorticoid target tissues.^{34 35} This permits mineralocorticoids to have direct effects on the heart.

It is not yet known whether the polymorphisms that we studied actually affect aldosterone levels in young adults. Although dietary sodium intake is known in our subjects, renin and aldosterone levels and urinary sodium excretion values are not available. Unpublished studies in other populations have thus far yielded inconsistent results, with a trend toward higher urinary aldosterone excretion associated with the -344C allele in healthy white US schoolchildren but a statistically significant association in the opposite direction in a cohort of Finnish men who were slightly older (mean, 45 years) than the group in the present study. To rigorously determine the effects of CYP11B2 genotype on aldosterone secretion, it would be most useful to examine a population in whom blood aldosterone levels or 24-hour urinary aldosterone excretion were measured under controlled conditions of diet and activity.

The -344 position in the CYP11B2 promoter is immediately adjacent to a binding site for a transcription factor, SF-1, that is thought to be essential for expression of steroid biosynthetic enzymes in the adrenal cortex.³⁶ In vitro, the -344C allele binds SF-1 approximately four times as strongly as does the -344T allele (unpublished observations), which is consistent with an effect on expression of CYP11B2. However, in cultured human adrenocortical cells, another SF-1 site downstream in the promoter is much more important for transcriptional control, and the site near the -344 polymorphism can be entirely deleted without affecting transcription.³⁷ It remains possible that the -344 site is important for developmental regulation of CYP11B2 in the adrenal or in extra-adrenal sites.

It also remains possible that the polymorphisms we examined are merely markers for one or more additional nearby polymorphisms that actually mediate the observed effects on heart size. There might be a nonrandom association between the "large heart size" allele of such a hypothetical locus and the -344C allele of CYP11B2, a condition termed genetic linkage disequilbrium. Indeed, the -344 and intron 2 polymorphisms are in linkage disequilibrium, and similar associations have been documented between polymorphisms in CYP11B2 and CYP11B1.^{22 38} It is even theoretically possible that polymorphisms in CYP11B1 are responsible for our observations. However, the -344 promoter polymorphism is a much better predictor of left ventricular size than is the intron 2 gene conversion polymorphism. Because the degree of linkage disequilibrium between loci is usually directly proportional to their proximity, it is more likely that the -344 polymorphism is close or identical to the polymorphism that is responsible for the observed effects on heart size.

Comparisons With Previous Studies
The design of the present study differs in important respects from other studies of genetic influences on left ventricular characteristics. Our study population was relatively young and homogeneous for age. Moreover, our population was almost completely free of hypertension and other cardiovascular disease, whereas other studies examined patients from cardiology clinics or individuals with ECG evidence of left ventricular hypertrophy. Thus, studies of our population should only detect factors that affect left ventricular size or function in young, healthy adults. Conversely, although the present study demonstrates that CYP11B2 genotype has major effects on heart size in normal individuals, it cannot answer the question of whether CYP11B2 genotype is, like ACE, a possible risk factor for the development of cardiovascular pathology such as myocardial infarction. Case-control studies of patients with cardiovascular disease would be the best way to answer this question.

	Acknowledgments

 
This work was supported in part by grants from the Foundation for Alcohol Research and the Signe and Ane Gyllenberg Foundation, Helsinki, Finland, and grants DK42169 and DK37867 from the National Institutes of Health.

	Footnotes

 
Reprint requests to Perrin C. White, MD, Division of Pediatric Endocrinology, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd, Dallas, TX 75235-9063.

Received March 12, 1997; revision received September 18, 1997; accepted October 20, 1997.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Levy D, Garrison RJ, Savage DD, Kannel WB, Castelli WP. Prognostic implications of echocardiographically determined left ventricular mass in the Framingham Heart Study. N Engl J Med. 1990;322:1561–1566.[Abstract]

2. Lauer MS, Evans JC, Levy D. Prognostic implications of subclinical left ventricular dilatation and systolic dysfunction in men free of overt cardiovascular disease (the Framingham Heart Study). Am J Cardiol. 1992;70:1180–1184.[Medline] [Order article via Infotrieve]

3. Galderisi M, Anderson KM, Wilson PW, Levy D. Echocardiographic evidence for the existence of a distinct diabetic cardiomyopathy (the Framingham Heart Study). Am J Cardiol. 1991;68:85–89.[Medline] [Order article via Infotrieve]

4. Manolio TA, Levy D, Garrison RJ, Castelli WP, Kannel WB. Relation of alcohol intake to left ventricular mass: the Framingham Study. J Am Coll Cardiol. 1991;17:717–721.[Abstract]

5. Levy D, Anderson KM, Savage DD, Kannel WB, Christiansen JC, Castelli WP. Echocardiographically detected left ventricular hypertrophy: prevalence and risk factors: the Framingham Heart Study. Ann Intern Med. 1988;108:7–13.

6. Liebson PR, Grandits G, Prineas R, Dianzumba S, Flack JM, Cutler JA, Grimm R, Stamler J. Echocardiographic correlates of left ventricular structure among 844 mildly hypertensive men and women in the Treatment of Mild Hypertension Study (TOMHS). Circulation. 1993;87:476–486.[Abstract/Free Full Text]

7. Adams TD, Yanowitz FG, Fisher AG, Ridges JD, Nelson AG, Hagan AD, Williams RR, Hunt SC. Heritability of cardiac size: an echocardiographic and electrocardiographic study of monozygotic and dizygotic twins. Circulation. 1985;71:39–44.[Abstract/Free Full Text]

8. Harshfield GA, Grim CE, Hwang C, Savage DD, Anderson SJ. Genetic and environmental influences on echocardiographically determined left ventricular mass in black twins. Am J Hypertens. 1990;3:538–543.[Medline] [Order article via Infotrieve]

9. Bielen E, Fagard R, Amery A. Inheritance of heart structure and physical exercise capacity: a study of left ventricular structure and exercise capacity in 7-year-old twins. Eur Heart J. 1990;11:7–16.[Abstract/Free Full Text]

10. Verhaaren HA, Schieken RM, Mosteller M, Hewitt JK, Eaves LJ, Nance WE. Bivariate genetic analysis of left ventricular mass and weight in pubertal twins (the Medical College of Virginia Twin Study). Am J Cardiol. 1991;68:661–668.[Medline] [Order article via Infotrieve]

11. White PC. Disorders of aldosterone biosynthesis and action. N Engl J Med. 1994;331:250–258.[Free Full Text]

12. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest. 1990;86:1343–1346.

13. Cambien F, Poirier O, Lecerf L, Evans A, Cambou JP, Arveiler D, Luc G, Bard JM, Bara L, Ricard S. Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature. 1992;359:641–644.[Medline] [Order article via Infotrieve]

14. Schunkert H, Hense HW, Holmer SR, Stender M, Perz S, Keil U, Lorell BH, Riegger GA. Association between a deletion polymorphism of the angiotensin-converting-enzyme gene and left ventricular hypertrophy. N Engl J Med. 1994;330:1634–1638.[Abstract/Free Full Text]

15. Iwai N, Ohmichi N, Nakamura Y, Kinoshita M. DD genotype of the angiotensin-converting enzyme gene is a risk factor for left ventricular hypertrophy. Circulation. 1994;90:2622–2628.[Abstract/Free Full Text]

16. Kupari M, Perola M, Koskinen P, Virolainen J, Karhunen PJ. Left ventricular size, mass, and function in relation to angiotensin-converting enzyme gene polymorphism in humans. Am J Physiol. 1994;267:H1107–H1111.[Abstract/Free Full Text]

17. Lindpaintner K, Lee MA, Larson MG, Rao US, Pfeffer MA, Ordovas JM, Schaefer EJ, Wilson AF, Wilson PW, Vasan RS, Myers RH, Levy D. Absence of association or genetic linkage between the angiotensin-converting-enzyme gene and left ventricular mass. N Engl J Med. 1996;334:1023–1028.[Abstract/Free Full Text]

18. Curnow KM, Tusie-Luna MT, Pascoe L, Natarajan R, Gu JL, Nadler JL, White PC. The product of the CYP11B2 gene is required for aldosterone biosynthesis in the human adrenal cortex. Mol Endocrinol. 1991;5:1513–1522.[Abstract/Free Full Text]

19. Mornet E, Dupont J, Vitek A, White PC. Characterization of two genes encoding human steroid 11 beta-hydroxylase (P-450(11) beta). J Biol Chem. 1989;264:20961–20967.[Abstract/Free Full Text]

20. Pascoe L, Curnow KM, Slutsker L, Rosler A, White PC. Mutations in the human CYP11B2 (aldosterone synthase) gene causing corticosterone methyloxidase II deficiency. Proc Natl Acad Sci U S A. 1992;89:4996–5000.[Abstract/Free Full Text]

21. Lifton RP, Dluhy RG, Powers M, Rich GM, Cook S, Ulick S, Lalouel JM. A chimaeric 11 beta-hydroxylase/aldosterone synthase gene causes glucocorticoid-remediable aldosteronism and human hypertension. Nature. 1992;355:262–265.[Medline] [Order article via Infotrieve]

22. Lifton RP, Dluhy RG, Powers M, Rich GM, Gutkin M, Fallo F, Gill JR Jr, Feld L, Ganguly A, Laidlaw JC, Murnaghan DJ, Kaufman C, Stockigt JR, Ulick S, Lalouel JM. Hereditary hypertension caused by chimaeric gene duplications and ectopic expression of aldosterone synthase. Nat Genet. 1992;2:66–74.[Medline] [Order article via Infotrieve]

23. Pascoe L, Curnow KM, Slutsker L, Connell JM, Speiser PW, New MI, White PC. Glucocorticoid-suppressible hyperaldosteronism results from hybrid genes created by unequal crossovers between CYP11B1 and CYP11B2. Proc Natl Acad Sci U S A. 1992;89:8327–8331.[Abstract/Free Full Text]

24. White PC, Slutsker L. Haplotype analysis of CYP11B2. Endocr Res. 1995;21:437–442.[Medline] [Order article via Infotrieve]

25. Kupari M, Koskinen P, Virolainen J. Correlates of left ventricular mass in a population sample aged 36 to 37 years: focus on lifestyle and salt intake. Circulation. 1994;89:1041–1050.[Abstract/Free Full Text]

26. Kupari M, Koskinen P, Hynynen M, Salmenpera M, Ventila M. Acute effects of ethanol on left ventricular diastolic function. Br Heart J. 1990;64:129–132.[Abstract/Free Full Text]

27. Kupari M. Reproducibility of M-mode echocardiographic assessment of left ventricular function: significance of the temporal range of measurements. Eur Heart J. 1984;5:412–418.[Abstract/Free Full Text]

28. Sullivan JM, Ratts TE, Schoenberger AA, Samaha JK, Palmer ET. The effect of diet on echocardiographic left ventricular dimensions in normal man. Am J Clin Nutr. 1979;32:2410–2415.[Abstract/Free Full Text]

29. Ferrara LA, de Simone G, Pasanisi F, Mancini M. Left ventricular mass reduction during salt depletion in arterial hypertension. Hypertension. 1984;6:755–759.[Abstract/Free Full Text]

30. Brilla CG, Matsubara LS, Weber KT. Anti-aldosterone treatment and the prevention of myocardial fibrosis in primary and secondary hyperaldosteronism. J Mol Cell Cardiol. 1993;25:563–575.[Medline] [Order article via Infotrieve]

31. Young M, Fullerton MJ, Dilley R, Funder JW. Mineralocorticoids, hypertension and cardiac fibrosis. J Clin Invest. 1994;93:2578–2583.

32. Edwards CR, Stewart PM, Burt D, Brett L, McIntyre MA, Sutanto WS, de Kloet ER, Monder C. Localisation of 11 beta-hydroxysteroid dehydrogenase–tissue specific protector of the mineralocorticoid receptor. Lancet. 1988;2:986–989.[Medline] [Order article via Infotrieve]

33. Funder JW, Pearce PT, Smith R, Smith AI. Mineralocorticoid action: target tissue specificity is enzyme, not receptor, mediated. Science. 1988;242:583–585.[Abstract/Free Full Text]

34. Lombes M, Alfaidy N, Eugene E, Lessana A, Farman N, Bonvalet JP. Prerequisite for cardiac aldosterone action: mineralocorticoid receptor and 11 beta-hydroxysteroid dehydrogenase in the human heart. Circulation. 1995;92:175–182.[Abstract/Free Full Text]

35. Slight S, Ganjam VK, Gomez-Sanchez CE, Zhou MY, Weber KT. High affinity NAD⁺-dependent 11ß-hydroxysteroid dehydrogenase in the human heart. J Mol Cell Cardiol. 1996;28:781–787.[Medline] [Order article via Infotrieve]

36. Lala DS, Rice DA, Parker KL. Steroidogenic factor I, a key regulator of steroidogenic enzyme expression, is the mouse homolog of fushi tarazu-factor I. Mol Endocrinol. 1992;6:1249–1258.[Abstract/Free Full Text]

37. Clyne CD, Zhang Y, Slutsker L, Mathis JM, White PC, Rainey WE. Angiotensin II and potassium regulate human CYP11B2 transcription through common cis elements. Mol Endocrinol. 1997;11:638–649.[Abstract/Free Full Text]

38. Globerman H, Rosler A, Theodor R, New MI, White PC. An inherited defect in aldosterone biosynthesis caused by a mutation in or near the gene for steroid 11-hydroxylase. N Engl J Med. 1988;319:1193–1197.[Abstract]

This article has been cited by other articles:

				A. GLUBA, M. BANACH, D. P. MIKHAILIDIS, and J. RYSZ Genetic Determinants of Cardiovascular Disease: The Renin-Angiotensin-Aldosterone System, Paraoxonases, Endothelin-1, Nitric Oxide Synthase and Adrenergic Receptors In Vivo, September 1, 2009; 23(5): 797 - 812. [Abstract] [Full Text] [PDF]

				R. S. Vasan, N. L. Glazer, J. F. Felix, W. Lieb, P. S. Wild, S. B Felix, N. Watzinger, M. G. Larson, N. L. Smith, A. Dehghan, et al. Genetic Variants Associated With Cardiac Structure and Function: A Meta-analysis and Replication of Genome-wide Association Data JAMA, July 8, 2009; 302(2): 168 - 178. [Abstract] [Full Text] [PDF]

				S Sookoian, T F Gianotti, and C J Pirola Role of the C-344T aldosterone synthase gene variant in left ventricular mass and left ventricular structure-related phenotypes Heart, July 1, 2008; 94(7): 903 - 910. [Abstract] [Full Text] [PDF]

				S. de Denus, M. Zakrzewski-Jakubiak, M.-P. Dube, F. Belanger, S. Lepage, M.-H. Leblanc, D. Gossard, A. Ducharme, N. Racine, L. Whittom, et al. Effects of AGTR1 A1166C Gene Polymorphism in Patients with Heart Failure Treated with Candesartan Ann. Pharmacother., July 1, 2008; 42(7): 925 - 932. [Abstract] [Full Text] [PDF]

				M. Barr, S. M. MacKenzie, E. C. Friel, C. D. Holloway, D. M. Wilkinson, N. J.R. Brain, M. C. Ingram, R. Fraser, M. Brown, N. J. Samani, et al. Polymorphic Variation in the 11{beta}-Hydroxylase Gene Associates With Reduced 11-Hydroxylase Efficiency Hypertension, January 1, 2007; 49(1): 113 - 119. [Abstract] [Full Text] [PDF]

				D. M. McNamara, S. W. Tam, M. L. Sabolinski, P. Tobelmann, K. Janosko, A. L. Taylor, J. N. Cohn, A. M. Feldman, and M. Worcel Aldosterone Synthase Promoter Polymorphism Predicts Outcome in African Americans With Heart Failure: Results From the A-HeFT Trial J. Am. Coll. Cardiol., September 19, 2006; 48(6): 1277 - 1282. [Abstract] [Full Text] [PDF]

				M. J. Perkins, S. L. Van Driest, E. G. Ellsworth, M. L. Will, B. J. Gersh, S. R. Ommen, and M. J. Ackerman Gene-specific modifying effects of pro-LVH polymorphisms involving the renin-angiotensin-aldosterone system among 389 unrelated patients with hypertrophic cardiomyopathy Eur. Heart J., November 2, 2005; 26(22): 2457 - 2462. [Abstract] [Full Text] [PDF]

				H. Tanahashi, T. Mune, Y. Takahashi, M. Isaji, T. Suwa, H. Morita, N. Yamakita, K. Yasuda, T. Deguchi, P. C. White, et al. Association of Lys173Arg Polymorphism with CYP11B2 Expression in Normal Adrenal Glands and Aldosterone-Producing Adenomas J. Clin. Endocrinol. Metab., November 1, 2005; 90(11): 6226 - 6231. [Abstract] [Full Text] [PDF]

				P. Meneton, X. Jeunemaitre, H. E. de Wardener, and G. A. Macgregor Links Between Dietary Salt Intake, Renal Salt Handling, Blood Pressure, and Cardiovascular Diseases Physiol Rev, April 1, 2005; 85(2): 679 - 715. [Abstract] [Full Text] [PDF]

				P. C. White and W. E. Rainey Polymorphisms in CYP11B Genes and 11-Hydroxylase Activity J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1252 - 1255. [Full Text] [PDF]

				B. Keavney, B. Mayosi, N. Gaukrodger, H. Imrie, M. Baker, R. Fraser, M. Ingram, H. Watkins, M. Farrall, E. Davies, et al. Genetic Variation at the Locus Encompassing 11-{beta} Hydroxylase and Aldosterone Synthase Accounts for Heritability in Cortisol Precursor (11-Deoxycortisol) Urinary Metabolite Excretion J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1072 - 1077. [Abstract] [Full Text] [PDF]

				F. K Shieh, E. Kotlyar, and F. Sam Aldosterone and cardiovascular remodelling: focus on myocardial failure Journal of Renin-Angiotensin-Aldosterone System, March 1, 2004; 5(1): 3 - 13. [Abstract] [PDF]

				P. Stella, G. Bigatti, L. Tizzoni, C. Barlassina, C. Lanzani, G. Bianchi, and D. Cusi Association between aldosterone synthase (CYP11B2) polymorphism and left ventricular mass in human essential hypertension J. Am. Coll. Cardiol., January 21, 2004; 43(2): 265 - 270. [Abstract] [Full Text] [PDF]

				N. Kosachunhanun, S. C. Hunt, P. N. Hopkins, R. R. Williams, X. Jeunemaitre, P. Corvol, C. Ferri, R. M. Mortensen, N. K. Hollenberg, and G. H. Williams Genetic Determinants of Nonmodulating Hypertension Hypertension, November 1, 2003; 42(5): 901 - 908. [Abstract] [Full Text] [PDF]

				P. C. White Aldosterone: Direct Effects on and Production by the Heart J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2376 - 2383. [Full Text] [PDF]

				J Song, I Narita, S Goto, N Saito, K Omori, F Sato, J Ajiro, D Saga, D Kondo, M Sakatsume, et al. Gender specific association of aldosterone synthase gene polymorphism with renal survival in patients with IgA nephropathy J. Med. Genet., May 1, 2003; 40(5): 372 - 376. [Full Text] [PDF]

				L. Swan, D.H. Birnie, S. Padmanabhan, G. Inglis, J.M.C. Connell, and W.S. Hillis The genetic determination of left ventricular mass in healthy adults Eur. Heart J., March 2, 2003; 24(6): 577 - 582. [Abstract] [Full Text] [PDF]

				E Takai, H Akita, K Kanazawa, N Shiga, M Terashima, Y Matsuda, C Iwai, Y Miyamoto, H Kawai, A Takarada, et al. Association between aldosterone synthase (CYP11B2) gene polymorphism and left ventricular volume in patients with dilated cardiomyopathy Heart, December 1, 2002; 88(6): 649 - 650. [Full Text] [PDF]

				P. O. Lim, T. M. Macdonald, C. Holloway, E. Friel, N. H. Anderson, E. Dow, R. T. Jung, E. Davies, R. Fraser, and J. M. C. Connell Variation at the Aldosterone Synthase (CYP11B2) Locus Contributes to Hypertension in Subjects with a Raised Aldosterone-to-Renin Ratio J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4398 - 4402. [Abstract] [Full Text] [PDF]

				J R Ortlepp, H P Vosberg, S Reith, F Ohme, N G Mahon, D Schroder, H G Klues, P Hanrath, and W J McKenna Genetic polymorphisms in the renin-angiotensin-aldosterone system associated with expression of left ventricular hypertrophy in hypertrophic cardiomyopathy: a study of five polymorphic genes in a family with a disease causing mutation in the myosin binding protein C gene Heart, March 1, 2002; 87(3): 270 - 275. [Abstract] [Full Text] [PDF]

				C. Delles, J. Erdmann, J. Jacobi, K. F. Hilgers, E. Fleck, V. Regitz-Zagrosek, and R. E. Schmieder Aldosterone synthase (CYP11B2) -344 C/T polymorphism is associated with left ventricular structure in human arterial hypertension J. Am. Coll. Cardiol., March 1, 2001; 37(3): 878 - 884. [Abstract] [Full Text] [PDF]

				N. Padmanabhan, S. Padmanabhan, and J. M. Connell Genetic basis of cardiovascular disease -- the renin-angiotensin-aldosterone system as a paradigm Journal of Renin-Angiotensin-Aldosterone System, December 1, 2000; 1(4): 316 - 324. [PDF]

				Y. Tsujita, N. Iwai, S. Tamaki, Y. Nakamura, M. Nishimura, and M. Kinoshita Genetic mapping of quantitative trait loci influencing left ventricular mass in rats Am J Physiol Heart Circ Physiol, November 1, 2000; 279(5): H2062 - H2067. [Abstract] [Full Text] [PDF]

				A. K. Agarwal, G. Giacchetti, G. Lavery, H. Nikkila, M. Palermo, M. Ricketts, C. McTernan, G. Bianchi, P. Manunta, P. Strazzullo, et al. CA-Repeat Polymorphism in Intron 1 of HSD11B2 : Effects on Gene Expression and Salt Sensitivity Hypertension, August 1, 2000; 36(2): 187 - 194. [Abstract] [Full Text] [PDF]

				P. Mulatero, D. Schiavone, F. Fallo, F. Rabbia, C. Pilon, L. Chiandussi, L. Pascoe, and F. Veglio CYP11B2 Gene Polymorphisms in Idiopathic Hyperaldosteronism Hypertension, March 1, 2000; 35(3): 694 - 698. [Abstract] [Full Text] [PDF]

				C. Hengstenberg, S. R. Holmer, B. Mayer, H. Lowel, S. Engel, H.-W. Hense, G. A. J. Riegger, and H. Schunkert Evaluation of the Aldosterone Synthase (CYP11B2) Gene Polymorphism in Patients With Myocardial Infarction Hypertension, March 1, 2000; 35(3): 704 - 709. [Abstract] [Full Text] [PDF]

				L. Tiret, C. Mallet, O. Poirier, V. Nicaud, A. Millaire, J.-B. Bouhour, G.e. Roizes, M. Desnos, R. Dorent, K. Schwartz, et al. Lack of association between polymorphisms of eight candidate genes and idiopathic dilated cardiomyopathy: The CARDIGENE study J. Am. Coll. Cardiol., January 1, 2000; 35(1): 29 - 35. [Abstract] [Full Text] [PDF]

				A. Ylitalo, K. E. J. Airaksinen, A. Hautanen, M. Kupari, M. Carson, J. Virolainen, M. Savolainen, H. Kauma, Y. A. Kesaniemi, P. C. White, et al. Baroreflex sensitivity and variants of the renin angiotensin system genes J. Am. Coll. Cardiol., January 1, 2000; 35(1): 194 - 200. [Abstract] [Full Text] [PDF]

				A. Hautanen, P. Toivanen, M. Manttari, L. Tenkanen, M. Kupari, V. Manninen, K. M. Kayes, S. Rosenfeld, and P. C. White Joint Effects of an Aldosterone Synthase (CYP11B2) Gene Polymorphism and Classic Risk Factors on Risk of Myocardial Infarction Circulation, November 30, 1999; 100(22): 2213 - 2218. [Abstract] [Full Text] [PDF]

				C. Delcayre and J.-S. Silvestre Aldosterone and the heart: towards a physiological function? Cardiovasc Res, July 1, 1999; 43(1): 7 - 12. [Full Text] [PDF]

				H. Schunkert, C. Hengstenberg, S. R. Holmer, U. Broeckel, A. Luchner, M. W. Muscholl, S. Kurzinger, A. Doring, H.-W. Hense, and G. A. J. Riegger Lack of Association Between a Polymorphism of the Aldosterone Synthase Gene and Left Ventricular Structure Circulation, May 4, 1999; 99(17): 2255 - 2260. [Abstract] [Full Text] [PDF]

				Y. Takeda, K. Furukawa, S. Inaba, I. Miyamori, and H. Mabuchi Genetic Analysis of Aldosterone Synthase in Patients with Idiopathic Hyperaldosteronism J. Clin. Endocrinol. Metab., May 1, 1999; 84(5): 1633 - 1637. [Abstract] [Full Text]

				E. Davies, C. D. Holloway, M. C. Ingram, G. C. Inglis, E. C. Friel, C. Morrison, N. H. Anderson, R. Fraser, and J. M. C. Connell Aldosterone Excretion Rate and Blood Pressure in Essential Hypertension Are Related to Polymorphic Differences in the Aldosterone Synthase Gene CYP11B2 Hypertension, February 1, 1999; 33(2): 703 - 707. [Abstract] [Full Text] [PDF]

				S. Tamaki, N. Iwai, Y. Tsujita, and M. Kinoshita Genetic Polymorphism of CYP11B2 Gene and Hypertension in Japanese Hypertension, January 1, 1999; 33(1): 266 - 270. [Abstract] [Full Text] [PDF]

				S. A. Lloyd-MacGilp, L. Torielli, S. Bechtel, G. Tripodi, C. E. Gomez-Sanchez, L. Zagato, R. Bernhardt, and C. J. Kenyon Mutations in aldosterone synthase gene of Milan hypertensive rats: phenotypic consequences Am J Physiol Endocrinol Metab, March 1, 2002; 282(3): E608 - E617. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kupari, M. Articles by White, P. C. Search for Related Content PubMed PubMed Citation Articles by Kupari, M. Articles by White, P. C.