This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Van Belle, E. Articles by Isner, J. M. Search for Related Content PubMed PubMed Citation Articles by Van Belle, E. Articles by Isner, J. M.

(Circulation. 1998;97:381-390.)
© 1998 American Heart Association, Inc.

Basic Science Reports

Potentiated Angiogenic Effect of Scatter Factor/Hepatocyte Growth Factor via Induction of Vascular Endothelial Growth Factor

The Case for Paracrine Amplification of Angiogenesis

Eric Van Belle, MD, PhD; Bernhard Witzenbichler, MD; Donghui Chen, MD; Marcy Silver, BS; Ling Chang, PhD; Ralph Schwall, PhD; ; Jeffrey M. Isner, MD

From the Departments of Medicine (Cardiology) and Biomedical Research, St Elizabeth's Medical Center, Tufts University School of Medicine, Boston, Mass (E.V.B., B.W., D.C., M.S., J.M.I.) and Genentech Inc, South San Francisco, Calif (L.C., R.S.).

Correspondence to Jeffrey M. Isner, MD, St Elizabeth's Medical Center, 736 Cambridge St, Boston, MA 02135. E-mail jisner{at}opal.tufts.edu

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background—Scatter factor/hepatocyte growth factor (SF/HGF) is a pleiotropic growth factor that stimulates proliferation and migration of endothelial cells (ECs) via the c-Met receptor, present on ECs as well as other cell types, including smooth muscle cells (SMCs). We studied the effects of recombinant human (rh) SF/HGF in vitro and in vivo in a rabbit model of hindlimb ischemia. We further compared these effects with those of recombinant human vascular endothelial growth factor (rhVEGF₁₆₅), an EC–specific mitogen.

Methods and Results—In vitro, rhSF/HGF and rhVEGF₁₆₅ exhibited similar effects on proliferation and migration of ECs. When both cytokines were administered together, the result was an additive effect on EC proliferation and a synergistic effect on EC migration. Application of rhSF/HGF to cultures of human SMCs resulted in the induction of VEGF mRNA and protein. In vivo, administration of rhSF/HGF (500 µgx3) was associated with significant improvements in collateral formation (P<.001) and regional blood flow (P<.0005) and with a significant reduction in muscle atrophy (P<.0001). These effects were significantly more pronounced than those of rhVEGF₁₆₅ administered according to the same protocol (P<.05). Neither remote angiogenesis nor other pathological sequelae were observed with either rhSF/HGF or rhVEGF₁₆₅.

Conclusions—The pleiotropic effects of certain growth factors may potentiate angiogenesis via a combination of direct effects on EC proliferation and migration and indirect effects that result in the generation of other potent EC mitogens from non-EC populations. The synergistic effects demonstrated when SF/HGF and VEGF are administered together in vitro may be reproduced in vivo by SF/HGF-induced upregulation of VEGF in vascular SMCs.

Key Words: growth substances • angiogenesis • collateral circulation • endothelium

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Angiogenesis involves activation, migration, and proliferation of ECs¹ and is regulated by certain growth factors.² Exogenous administration of growth-regulating molecules that stimulate angiogenesis has potential utility for the treatment of tissue ischemia not amenable to conventional revascularization techniques. This strategy, referred to as "therapeutic angiogenesis," has been validated in various animal models of limb or myocardial ischemia^{3 4 5 6 7 8} and more recently in patients treated with plasmid DNA encoding for VEGF.^{9 10}

SF/HGF is a recently characterized growth factor^{11 12} that has a disulfide-linked heterodimer structure and an apparent molecular weight of 80 kD.¹¹ Its receptor has been identified as the c-Met proto-oncogene product, a transmembrane tyrosine kinase.¹² Synthesis of SF/HGF by mesenchymal cells (eg, fibroblasts and SMCs), coupled with demonstrated effects on epithelial cells and ECs, suggests a paracrine mode of action.¹³ SF/HGF is considered to be a principal mediator of mesenchymal-epithelial/endothelial interactions that contribute to embryogenesis, organ regeneration, wound healing, and angiogenesis.^{13 14 15 16}

Indeed, previous investigations have established that SF/HGF directly stimulates proliferation and migration of cultured ECs,^{17 18} promotes development of capillary-like structures in vitro,^{18 19} and stimulates blood vessel formation in Matrigel plugs and normal cornea.^{16 18} Furthermore, SF/HGF has been shown to be induced in skeletal muscle after ischemic injury.¹⁴ More recently, SF/HGF has been implicated in capillary EC regeneration in the ischemically injured myocardium.²⁰

Previous studies from our laboratory and others have established that certain cytokines, such as platelet-derived growth factor-BB and transforming growth factor-ß₁, can upregulate VEGF expression in vascular SMCs and thereby exert indirect angiogenic effects,²¹ even though they are nonmitogenic or even inhibitory for EC proliferation in vitro.^{22 23} Because the c-Met receptor for SF/HGF is expressed on both ECs and vascular SMCs,²⁴ we considered the possibility that SF/HGF could also upregulate VEGF expression in SMCs. Thus, the angiogenic potency of SF/HGF in vivo might be enhanced through coordinately regulated direct and indirect effects.

The present series of experiments demonstrates that the direct effect of SF/HGF on EC proliferation and migration is similar to that of VEGF; the combination of SF/HGF and VEGF, however, is shown to produce an additive effect on EC proliferation and a synergistic effect on EC migration. Moreover, in vitro administration of SF/HGF to HVSMCs induces upregulated expression of both VEGF mRNA and protein. In vivo, angiographic, physiological, and histological findings indicate that SF/HGF-induced angiogenesis is superior to that achieved with VEGF. SF/HGF is thus a potent agent for strategies designed to promote therapeutic angiogenesis, possibly as a result of the combination of direct effects of SF/HGF on ECs and the indirect effects, including paracrine upregulation of VEGF on SMCs, as demonstrated in vitro.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
rhSF/HGF and rhVEGF₁₆₅
rhSF/HGF was produced in Chinese hamster ovary cells transfected with a plasmid encoding the full-length, natural human SF/HGF sequence. The rhSF/HGF was then converted into the bioactive, heterodimer form by a modification of the method described by Naka et al²⁵ and purified by conventional chromatography, as previously described.²⁶ The 165-amino-acid homodimeric species of rhVEGF₁₆₅ was purified from transfected Chinese hamster ovary cells as previously described.²⁷ The purity of the material was assessed by a silver-stained SDS-PAGE gel and the presence of a single NH₂-terminal amino acid sequence.

Cell Culture
HUVECs were prepared from umbilical cord vein as previously described²⁸ and grown in medium 199 (M199) (GIBCO BRL) supplemented with 20% FBS, EC growth supplement (100 µg/mL), and heparin (50 U/mL). HVSMCs were cultured by explant outgrowth from unused portions of internal mammary arteries obtained at coronary artery bypass graft surgery as previously described.²⁹ Cells were cultured in DMEM supplemented with 10% FBS.

Northern Blot Analysis in Cultured HVSMCs
Confluent HVSMCs (passages 3 to 5) were growth-arrested in filtered DMEM containing 0.5% FBS for 48 hours before each experiment. The cells were then treated with rhSF/HGF for various time intervals and different concentrations as indicated. Stimulation of HVSMCs with PMA (Sigma Chemical Co) was used as a positive control for VEGF gene expression.³⁰ Total RNA from HVSMCs was isolated by phenol/chloroform extraction,³¹ and Northern blot analysis was performed as previously described.²¹ The DNA probe for human VEGF was a 675-bp EcoRI/Bgl II fragment (gift of N. Ferrara, Genentech Inc).

RT-PCR Analysis in Cultured HVSMCs
First-strand cDNA synthesis and PCR analysis were performed according to standard procedures.^{32 33} The primer chosen for human VEGF (Genbank accession number M32977) was, for sense, (5'-3') GAACTTTCTGCTGTCTTGGG and, for antisense, (5'-3') TCACCGCCTCGGCTTGTCAC. PCR resulted in three bands (438, 570, and 642 bp) corresponding to the three principal VEGF isoforms, 121, 165, and 189, respectively, expressed in HVSMCs.³⁰ For human GAPDH (X01677), the following primers were used: sense, (5'-3') TGAAGGTCGGAGTCAACGGATTTG and antisense, (5'-3') CATGTGGGCCATGAGGTCCACCAC. PCR resulted in a 983-bp band. The linear phase of the exponential range amplification was determined for each primer set to allow semiquantitative PCR analysis.³⁴ The number of cycles was then chosen in the linear phase of amplification: 29 cycles for VEGF and 20 cycles for GAPDH. Ten microliters of each PCR reaction mixture was electrophoresed in a 1.5% agarose gel, and bands were visualized by ethidium bromide staining. Bands were quantified densitometrically by scanning and analyzing with Eagle's Eye II software. To normalize signals for VEGF₁₆₅, the value was divided by the signal for GAPDH, a widely invariant and highly expressed gene. The data presented as relative values (VEGF₁₆₅/GAPDH) were plotted against time. The results represent three independent amplifications from two separate studies.

Analysis of VEGF Protein Expression in Cultured HVSMCs
For analysis of VEGF protein expression in SMCs by Western blotting, cells were lysed by addition of 1 mL RIPA buffer (1% NP-40, 0.5% sodium deoxycholic acid, 0.1% SDS in PBS, pH 7.4; 1 µmol/L leupeptin; 5 µmol/L aprotinin; 1 mmol/L PMSF; and 1 µmol/L pepstatin, all Sigma Chemical Co) per 100-mm plate. Protein extracts (100 µg) were separated on a 10% SDS-PAGE and transferred to a 0.2-µm PVDF membrane (Bio Rad). The membranes were blocked in 10% nonfat dry milk/0.2% Tween-20 in PBS, pH 7.4, then immunoblotted with a rabbit polyclonal anti-human VEGF antibody (1:200; Santa Cruz) overnight at 4°C. Blots were washed with 0.2% Tween-20 in PBS and incubated with horseradish peroxidase–linked goat anti-rabbit antibody (1:7500; Santa Cruz) for 45 minutes. Immunoreactive bands were visualized with ECL reagent (Amersham).

EC Proliferation Assay
For evaluation of proliferation, the colorimetric MTT assay was performed as previously described.³⁵ Briefly, HUVECs were seeded in a 96-well plate (5000 cells/well) in 0.2 mL M199 (GIBCO BRL) containing 5% FBS. MTT was dissolved in PBS at 5 mg/mL to constitute a stock solution. After the incubation of HUVECs with rhSF/HGF, rhVEGF₁₆₅, or a combination of the two for 48 hours, the MTT solution was added to each well (10 µL/100 µL medium), and plates were incubated at 37°C for 4 hours. The medium was decanted, and DMSO was added to all wells to dissolve the dark blue crystals. Plates were read on an SLT EAR 400 AT automatic plate reader (SLT Labinstruments) with a test wavelength of 560 nm and a reference wavelength of 650 nm. All experiments were performed in quadruplicate.

EC Migration Assay
EC migration assays were performed in a 48-well microchemotaxis chamber (Neuroprobe Inc).³⁶ PVP-free polycarbonate filters with a pore size of 8 µm (Nuclepore Corp) were coated with 0.1% gelatin for at least 6 hours at room temperature and dried under sterile air. Test substances were diluted to appropriate concentrations in M199 supplemented with 1% FBS, and 25 µL of the final dilution was placed in the lower chamber of the modified Boyden apparatus. Subconfluent, early-passage^{2 3 4 5 6} HUVEC cultures were washed and trypsinized for the minimum time required to achieve cell detachment. After the filter was placed between the lower and upper chambers, 2.5x10⁵ cells suspended in 50 µL M199 containing 1% FBS were seeded in the upper compartment. The apparatus was then incubated for 5 hours at 37°C in a humidified chamber with 5% CO₂ to allow cell migration. After the incubation period, the filter was removed, and the upper side of the filter with the nonmigrated cells was scraped with a rubber policeman. The filters were fixed with methanol and stained with a Giemsa solution (Diff-Quick, Baxter). Migration was quantified by counting cells of three random high-power fields (x100) in each well, and all experiments were performed in quadruplicate.

Animal Model
The physiological response to administration of rhVEGF₁₆₅ and rhSF/HGF was investigated in a previously described rabbit ischemic hindlimb model.³⁷ All protocols were approved by the St Elizabeth's Institutional Animal Care and Use Committee. Twenty-seven male New Zealand White rabbits (3.5 to 4.0 kg) (Pine Acre Rabbitry, Norton, Mass) were anesthetized with a mixture of amine (50 mg/kg) and acepromazine (0.8 mg/kg) after premedication with xylazine (2 mg/kg). They underwent surgical removal of one femoral artery by a previously described technique.³⁷ In this model, the excision of the femoral artery results in retrograde propagation of thrombus and occlusion of the external iliac artery. Consequently, blood flow to the ischemic limb is dependent on collateral vessels originating from the internal iliac artery.³⁷

Design of the In Vivo Experiment
The dose of rhVEGF₁₆₅ used in the present experiment (500 µg) has previously been shown to induce an optimal angiogenic effect of rhVEGF₁₆₅ with a single bolus administration protocol.^{3 38} To ensure a maximum effect of rhVEGF165 alone, we administered three separate injections of 500 µg: the first dose locally (intra-arterially into the ischemic limb) and then two additional doses intravenously; the latter has also been shown to achieve a reliable biological effect.³⁹ Because the dose-response curves observed with rhVEGF₁₆₅ and rhSF/HGF on migration and proliferation of cultured ECs were similar (see "Results"), the same dose of SF/HGF (500 µg per injection) was chosen for comparison.

Ten days after surgery (day 0) and after measurement of baseline body weight as well as baseline noninvasive and invasive hemodynamic parameters (see below), animals received a single intra-arterial bolus of rhSF/HGF (500 µg, n=9), rhVEGF₁₆₅ (500 µg, n=9), or vehicle solution (3 mL saline with 0.1% rabbit serum albumin [Sigma], n=9) administered as a bolus over 1 minute through a 3F end-hole infusion catheter (Tracker-18, Target Therapeutics) positioned in the internal iliac artery of the ischemic limb. On days 2 and 4, the same dose of drug (or placebo) was administered intravenously.

On day 30, all the measurements were repeated, and the animals were killed. The liver, kidney, and hindlimb muscles were weighed, and specimens of each were obtained for histological analysis. Muscle and kidney samples were also retrieved for microsphere analysis of tissue flow.

Lower Limb Calf Blood Pressure Index
Calf blood pressure was measured at days 0 and 30 in both hindlimbs with a Doppler flowmeter (model 1050, Parks Medical Electronics) and a cuff connected to a pressure manometer.^{37 40} The calf blood pressure index was defined for each rabbit as the ratio of systolic pressure of the ischemic limb to systolic pressure of the normal limb (x100).

Angiography and Doppler Guidewire Measurements
Angiography and intra-arterial Doppler guidewire measurement of flow velocity were performed on day 0 and day 30 by previously described techniques.^{37 40}

In addition to measurements performed at rest, endothelium-dependent and endothelium-independent responses were evaluated with intra-arterial administration of acetylcholine chloride and nitroprusside (Sigma) over 2 minutes via a constant infusion pump (1 mL/min). Each drug was administered into the iliac artery of the ischemic limb at a dose of 1.5 µg · min^-1 · kg^-1.

Doppler-Derived Blood Flow in the Ischemic Hindlimb
The luminal diameter of the internal iliac artery was determined by angiography at the site of the Doppler sample volume, at rest and after drug infusion, with an automated edge-detection system (Quantum 2000I; QCS) as previously described.³⁷ Doppler-derived flow was calculated as Q_D=(d²/4)(0.5xAPV), where Q_D is Doppler-derived time-averaged flow, d is vessel diameter, and APV is time average of the spectral peak velocity.⁴¹ The mean velocity was estimated as 0.5xAPV by assuming a time-averaged parabolic velocity profile across the vessel. The Doppler-derived flow calculated in this fashion has previously been validated in vivo.⁴¹ In the ischemic hindlimb, the internal iliac artery supplied blood flow for the entire hindlimb.³⁷

Angiographic Analysis of Collateral Vessels
Morphometric analysis of collateral vessel development in the ischemic limb was performed by use of the 4-second angiograms recorded after injection of contrast media into the internal iliac artery. A grid overlay composed of 2.5-mm-diameter circles arranged in rows spaced 5 mm apart was placed over the angiogram at the level of the medial thigh. The number of contrast-opacified arteries crossing over circles and the total number of circles encompassing the medial thigh area were counted in single-blind fashion. An angiographic score was calculated as the ratio of crossing opacified arteries divided by the total number of circles in the ischemic thigh. This angiographic score reflects vascular density in the medial thigh.^{40 42}

Measurement of Muscle, Renal, and Hepatic Blood Flow
Blood flow to hindlimb muscles and kidneys was evaluated by use of colored polystyrene spheres 15 µm in diameter.^{40 42} Quantification of microspheres is based on analysis of a linear relationship between spectrophotometrically determined absorbance of dye and number of microspheres. Thus, after the invasive measurements described above were completed, two different sets of 3x10⁶ Dye-Trak colored microspheres (Triton Technology) were injected through a 3F Teflon catheter into the left ventricle at days 0 and 30. At each time point, the first injection of the set was performed under baseline conditions and the second after a nitroprusside infusion (15 µg · min^-1 · kg^-1) into the abdominal aorta. Each time, a reference blood sample was withdrawn with a syringe pump (Sage 351, Orion Research) to collect microspheres at a constant rate of 1.2 mL/min from a peripheral artery (central ear artery). When the animals were killed, a total of 14 tissue samples (2 g each) from seven different muscles (tensor fasciae latae, vastus lateralis, vastus medialis, adductor, semimembranosus, gastrocnemius, and tibialis anterior) in each hindlimb (ischemic and nonischemic) were retrieved. Samples from right and left kidneys and from the liver were also collected and used (1) to control for right-left homogeneity of blood microsphere content and (2) to evaluate the effect of administered angiogenic factors on blood flow to nonischemic tissues. After tissue and blood sample digestion with potassium hydroxide, microsphere extraction by filtering, and complete dye removal with dimethyl formamide, each sample was analyzed by a conventional spectrophotometer (model 8452A, Hewlett Packard).^{40 42} From the optical density (OD) measurements, the muscle perfusion expressed in mL · min^-1 · 100 g^-1 was calculated from the following equation: blood flow of muscle sample (mL · min^-1 · g^-1)=(OD of tissue sample/OD of reference blood sample)x[withdrawal rate of reference blood sample (mL/min)/weight of tissue sample (g)].

Blood flow of muscle sample (mL · min^-1 · g^-1)=(OD of tissue sample/OD of reference blood sample)x[withdrawal rate of reference blood sample (mL/min)/weight of tissue sample (g)].

Muscle blood flow in each hindlimb was expressed as the mean of the 14 samples. For each animal, muscle blood flow in the ischemic hindlimb was also expressed as a percentage of muscle blood flow in the nonischemic hindlimb.

Capillary Density
The extent of vascularity was further examined by measurement of the number of capillaries in light microscopic sections retrieved from ischemic and nonischemic hindlimbs, as previously described.⁴⁰ Tissue specimens were obtained as transverse sections from the adductor muscles and the semimembranosus muscles at the time of euthanization (day 30). Frozen sections were stained for alkaline phosphatase with an indoxyl tetrazolium method to detect capillary ECs and then were counterstained with eosin.⁴³ A total of 20 different fields under an x20 objective from the two muscles were randomly selected, and the number of capillaries were counted to determine the capillary density (mean number of capillaries per square millimeter). To ensure that analysis of capillary density was not overestimated because of muscle atrophy, capillary density was also evaluated as a function of the number of muscle fibers in the histological section.

Muscle Weight
For each hindlimb, muscles were divided into three groups: external thigh, internal thigh, and calf. At the time the animals were killed, the weight of each group (including the samples used for microsphere and histological analyses) was measured in each hindlimb. In each animal, an index of muscle atrophy was calculated for each group of muscles and for the entire hindlimb as follows: index of muscle atrophy=[1-(muscle weight in ischemic hindlimb/muscle weight in nonischemic hindlimb)]x100.

Histological Examination of Liver and Kidneys
To evaluate potential systemic effects of administered angiogenic factors, tissue samples from liver and kidney were systematically harvested, weighed, and cut into 5-mm slices to allow inspection for morphological abnormalities.

Statistical Analysis
Results were expressed as mean±SEM. Statistical significance was evaluated by unpaired Student's t test for comparisons between two means, ANOVA followed by Scheffé's procedure for more than two means, and two-way ANOVA to test for interaction. A value of P<.05 was interpreted to denote statistical significance.

	Results

Top Abstract Introduction Methods Results Discussion References

 
SF/HGF Induces VEGF mRNA and Protein Expression in Cultured HVSMCs
Administration of 25 ng/mL rhSF/HGF to cultured HVSMCs resulted in time-dependent induction of VEGF mRNA expression, as demonstrated by Northern blot analysis (Fig 1A). Whereas the level of VEGF mRNA was low to nondetectable among quiescent SMCs maintained in low-serum medium, induction of VEGF mRNA was already pronounced 3 hours after stimulation, peaked at 6 hours, and persisted for at least 24 hours. Induction of VEGF mRNA expression was dose dependent, with a maximal effect between 25 and 50 ng/mL rhSF/HGF (Fig 1B). To exclude nonspecific effects, BSA was added to SMCs and yielded no change in VEGF mRNA baseline expression (Fig 1C). PMA was used as a positive control. RT-PCR analysis (Fig 2A) disclosed equivalent induction of all three major VEGF isoforms, and semiquantitative evaluation of the VEGF₁₆₅ PCR product confirmed that peak induction occurred 6 hours after stimulation with rhSF/HGF (2.9±0.13-fold increase compared with unstimulated controls). After 18 and 24 hours, VEGF₁₆₅ mRNA decreased to 2.4±0.16 and 2.3±0.11-fold, respectively (Fig 2B).

View larger version (23K): [in this window] [in a new window]   Figure 1. Northern blot analysis showing induction of VEGF mRNA expression in SMCs stimulated by rhSF/HGF. A, Time course of VEGF mRNA expression in SMCs stimulated by rhSF/HGF. Stimulation of HVSMCs with 50 ng/mL rhSF/HGF disclosed time-dependent induction of VEGF mRNA expression. Whereas quiescent SMCs contained very low or nondetectable levels of VEGF mRNA, an increase was visible 3 hours after stimulation, peaked at 6 hours, and persisted through 24 hours. B, Northern blot analysis of VEGF mRNA at 4 hours, with concentrations of rhSF/HGF as indicated. Induction of VEGF mRNA was dose-dependent, achieving a maximal effect between 25 and 100 ng/mL rhSF/HGF. C, To exclude nonspecific effects, 50 ng/mL BSA was added to HVSMCs and showed no change in VEGF mRNA expression. PMA was used as positive control.

View larger version (25K): [in this window] [in a new window]   Figure 2. RT-PCR showing simultaneous induction of mRNA for three principal VEGF isoforms by rhSF/HGF. A, RT-PCR analysis disclosed that mRNA for all three principal VEGF isoforms (121, 165, 189) generated by alternative splicing are simultaneously induced after administration of rhSF/HGF. B, Quantitative analysis of RT-PCR products confirmed that expression of VEGF165 mRNA peaks at 6 hours. Quantification of PCR products by scanning and normalizing by calculating VEGF/GAPDH ratios confirmed that peak induction occurs 6 hours after stimulation (2.9±0.2-fold increase compared with control for VEGF165). After 12 and 24 hours, VEGF165 mRNA decreases to 2.7±0.1- and 2.4±0.1-fold, respectively.

Western blotting confirmed the effect of rhSF/HGF on VEGF expression at the protein level (Fig 3).

View larger version (13K): [in this window] [in a new window]   Figure 3. Induction of VEGF protein by rhSF/HGF. Western blot showing time course of VEGF protein production in HVSMCs stimulated by 50 ng/mL rhSF/HGF.

In Vitro Effects of rhSF/HGF and rhVEGF₁₆₅, Alone and Together, on EC Migration and Proliferation
The impact of rhSF/HGF and rhVEGF₁₆₅ on proliferation and migration of cultured HUVECs is shown in Fig 4. No statistical difference was detected in the response of ECs to the two cytokines over a concentration range of 0.1 to 1000 ng/mL. For rhSF/HGF, maximal effect (expressed as percent of baseline) on HUVEC proliferation was 139.1±13.4% and for rhVEGF₁₆₅, 158.2±7.6%, P=NS (Fig 4A). Similarly, the maximal effect of rhSF/HGF and rhVEGF₁₆₅ on HUVEC migration was 233.9±6.4% and 278.1±6.7%, respectively, P=NS (Fig 4B).

View larger version (15K): [in this window] [in a new window]   Figure 4. Effects of rhSF/HGF and rhVEGF on EC proliferation and migration. A, Proliferation assay using MTT shows no difference in dose response of HUVECs to rhSF/HGF and rhVEGF when two cytokines are administered individually. Additive effect is observed when two cytokines are combined (P<.01). B, Migration assay performed in modified Boyden apparatus shows no difference in dose response of HUVECs when rhSF/HGF and rhVEGF are administered individually. Additive effect is observed when two are combined (P<.0001), and at doses inducing a submaximal response (1, 10, 50, and 100 ng/mL), a synergistic effect is observed (two-way ANOVA; P<.0001 for interaction).

The combined effect of rhSF/HGF and rhVEGF₁₆₅ administered together was at least additive for both EC proliferation (P<.01, Fig 4A) and migration (P<.0001, Fig 4B). In addition, when submaximal concentrations (1, 10, 50, and 100 ng/mL) were used, a synergistic effect of the two cytokines was observed on EC migration (P<.0001). At 10 ng/mL, for example, rhSF/HGF+rhVEGF₁₆₅250.3% of baseline versus an expected additive value of +178.9% (rhSF/HGF alone76.3% and rhVEGF₁₆₅ alone102.6%; P<.0001).

Representative examples of the EC migration assay performed at a growth factor concentration of 10 ng/mL are shown in Fig 5. Similar results were obtained with human microvascular ECs (data not shown).

View larger version (59K): [in this window] [in a new window]   Figure 5. Photomicrographs of EC migration. Photomicrographs of representative membranes retrieved from modified Boyden apparatus used to perform migration assay after nonmigrating HUVECs were removed from upper side of membrane and stained with Giemsa solution (x100). A, negative control (no cytokine added to lower chamber); B, rhVEGF165 (10 ng/mL); C, rhSF/HGF (10 ng/mL); D, rhVEGF165 (10 ng/mL)+rhSF/HGF (10 ng/mL). Insert, Cells migrated through membrane pores (8 µm) at a higher magnification (x400).

Effect of rhSF/HGF and rhVEGF₁₆₅ on Collateral Vessel Development in Ischemic Hindlimb
On the basis of the above results showing similar direct effects of both cytokines on ECs in vitro, we choose the same doses of rhSF/HGF and rhVEGF₁₆₅ to evaluate their respective effects on angiogenesis in vivo, using the ischemic hindlimb model. We speculated that in addition to the direct effect of SF/HGF on EC proliferation and the synergistic effect, when administered with VEGF, on EC migration, the potential for SF/HGF to induce VEGF synthesis in SMCs could yield a superior effect, relative to rhVEGF₁₆₅ alone, on angiogenesis in vivo.

The quantitative analysis of collateral blood vessel development in the medial thigh of rabbits with hindlimb ischemia is summarized in Fig 6A. Before treatment (day 0), angiographic scores did not differ significantly among the experimental groups. By day 30, the angiographic score in both rhVEGF₁₆₅- and rhSF/HGF-treated groups exceeded (P<.001) that of the control group (control=0.55±0.03; rhVEGF₁₆₅=0.71±0.04; rhSF/HGF=0.89±0.04). Moreover, the angiographic score for the rhSF/HGF group was significantly higher than that of the rhVEGF₁₆₅ group (P=.02).

View larger version (20K): [in this window] [in a new window]   Figure 6. Angiographic and histological evidence of angiogenesis. A, Angiographic score obtained by quantification of angiographically visible vessels in medial thigh of ischemic hindlimb (see "Methods") at days 0 and 30. At day 0, there are no differences among groups. At day 30, number of vessels is significantly greater in rhVEGF- and rhSF/HGF-treated groups. Response to rhSF/HGF is significantly more pronounced than response to rhVEGF (P=.02). *P<.001 vs control; #P<.05 vs VEGF. B, Capillary density evaluated at day 30 in histological sections of medial thigh muscles of nonischemic and ischemic limbs. In nonischemic limb, capillary density is not different among groups. In ischemic limb, rhVEGF and rhSF/HGF significantly increase capillary density. Effect of rhSF/HGF is significantly more pronounced than effect of VEGF (P=.018). *P<.001 vs control; #P<.05 vs VEGF.

Fig 7 shows representative internal iliac angiograms recorded on day 30 from control and rhVEGF₁₆₅- and rhSF/HGF-treated animals. In the rhVEGF₁₆₅- and rhSF/HGF-treated groups, collateral artery development was more marked.

View larger version (64K): [in this window] [in a new window]   Figure 7. Representative angiographic findings. Selective internal iliac angiography at day 30 of control (A), rhVEGF165-treated (B), and rhSF/HGF-treated (C) rabbits showing collateral vessel formation. Rabbits treated with rhSF/HGF (500 µgx3, C) showed more numerous angiographically visible collateral vessels than controls (A) and rhVEGF165-treated animals (500 µgx3, B).

The impact of rhSF/HGF and rhVEGF₁₆₅ on vascular density was also investigated at the capillary level, with light microscopy used to quantify capillaries/mm² in tissue sections harvested at necropsy from the medial thigh muscles of the ischemic and nonischemic limbs. Morphometric analysis revealed that capillary density was significantly higher (P<.001) in the rhVEGF₁₆₅- and rhSF/HGF-treated groups than in the control group (control=153±10/mm²; rhVEGF₁₆₅=231±14/mm²; and rhSF/HGF=288±18/mm²). Capillary density in the rhSF/HGF group was also significantly higher than in the rhVEGF₁₆₅ group (P=.02) (Fig 6B). Analysis of the ratio of capillaries to muscle fiber yielded similar results (control=0.41±0.03; rhVEGF₁₆₅=0.65±0.04; and rhSF/HGF=0.84±0.05).

Analysis of capillary density and ratio of capillaries to muscle fiber in sections from medial thigh muscles of the nonischemic limb showed no differences among groups (control=201±8; rhVEGF₁₆₅=204±8; and rhSF/HGF=210±9; P=NS) (Fig 6B).

Representative examples of histological sections stained for alkaline phosphatase to identify capillary density in the three experimental groups are shown in Fig 8.

View larger version (76K): [in this window] [in a new window]   Figure 8. Representative histological findings. Representative examples of histological sections stained for alkaline phosphatase in three experimental groups: control (A), rhVEGF165 (B), and rhSF/HGF (C). Animals treated with rhSF/HGF showed increase in capillary density compared with two other groups.

Effect of rhSF/HGF and rhVEGF₁₆₅ on Pressure Perfusion Ratio
Calf blood pressure ratio was similar in all groups at day 0. By day 30, the blood pressure ratio had improved in all groups; in the rhVEGF₁₆₅- and rhSF/HGF-treated groups, however, the blood pressure ratio was higher (P<.01) than in the control group (control=0.51±0.05; rhVEGF₁₆₅=0.71±0.04; and rhSF/HGF=0.88±0.04). The blood pressure ratio observed in the rabbits treated with rhSF/HGF was significantly higher than that observed in rabbits treated with rhVEGF₁₆₅ (P<.05).

Effect of rhSF/HGF and rhVEGF₁₆₅ on Iliac Arterial Blood Flow
Blood flow parameters were measured from the Doppler-tipped guidewire positioned in the internal iliac artery of the ischemic limb at days 0 and 30 (Fig 9A). At day 0, there were no differences among groups in resting or maximum flow. At day 30, flow at rest was higher in rhVEGF- (P<.05) and rhSF/HGF-treated animals (P.005) than in controls (control=17.9±0.9 mL/min; rhVEGF₁₆₅=21.2±0.7 mL/min; and rhSF/HGF=23.9±1.2 mL/min). Maximum flow after nitroprusside infusion was significantly higher (P<.004) in both rhVEGF₁₆₅- and rhSF/HGF-treated groups, compared with the maximum flow in the control group (control=36.1±2.3 mL/min; rhVEGF₁₆₅=48.0±2.7 mL/min; and rhSF/HGF=59.4±3.7 mL/min). Maximum flow in the rhSF/HGF-treated animals was higher than in the rhVEGF₁₆₅-treated animals (P=.02). The significant increase in maximum flow in the rhVEGF₁₆₅- and rhSF/HGF-treated rabbits resulted in a significantly higher (P<.005) flow reserve than in the control group (control=2.01±0.06; rhVEGF₁₆₅=2.26±0.06; and rhSF/HGF=2.47±0.05). The flow reserve in the rhSF/HGF-treated animals was also significantly higher than that of the rhVEGF₁₆₅-treated animals (P=.016).

View larger version (21K): [in this window] [in a new window]   Figure 9. Analysis of iliac blood flow and skeletal muscle perfusion. A, Blood flow in internal iliac artery of ischemic limb measured at days 0 and 30. At day 0, there are no differences among groups either at rest or after nitroprusside ("Maximum"). At day 30, resting flow is increased by SF/HGF (P=.0012), whereas maximum blood flow is increased by both VEGF (P=.0039) and SF/HGF (P<.0001). Maximum blood flow is significantly higher in SF/HGF- than in VEGF-treated group (P=.02). *P<.05 vs control; #P<.05 vs VEGF. B, Skeletal muscle perfusion in ischemic limb (expressed as percentage of perfusion in nonischemic limb) measured at days 0 and 30. At day 0, there are no differences among groups either at rest or after stimulation with nitroprusside. At day 30, muscle blood flow measured at rest is increased by VEGF (P=.002) and SF/HGF (P<.0001). A similar effect is observed after stimulation (VEGF, P=.0004 and SF/HGF, P<.0001), with a more pronounced effect for SF/HGF (P=.01). *P<.005 vs control; #P<.01 vs VEGF.

Effect of rhSF/HGF and rhVEGF₁₆₅ on Muscle Blood Flow
Muscle blood flow, assessed with colored microspheres, was determined for days 0 and 30 (Fig 9B). In each animal, the muscle blood flow in the ischemic limb was expressed as a percentage of the muscle flow measured in the nonischemic limb (see above). The homogeneity of microsphere distribution was verified by measurement of blood flow to the right and left kidneys (r=.99; slope=0.97±0.04, intercept=0.14±0.10).

At day 0, there were no differences among groups for muscle flow index measured at rest (control=65.6±3.9%; rhVEGF₁₆₅=62.9±4.2%; and rhSF/HGF=64.6±3.7%; P=NS) or after administration of nitroprusside (control=45.4±3.0%; rhVEGF₁₆₅=44.4±3.7%; and rhSF/HGF=39.8±2.9%; P=NS). At day 30, muscle flow index at rest was higher in rhVEGF₁₆₅- and rhSF/HGF-treated animals (P<.002) than in controls (control=71.1±2.3%; rhVEGF₁₆₅=87.6±3.7%; and rhSF/HGF=99.1±3.4%). The muscle flow index measured after nitroprusside was significantly higher (P<.0005) in both rhVEGF₁₆₅- and rhSF/HGF-treated groups than in the control group (control=49.1±3.9%; rhVEGF₁₆₅=66.9±3.7%; and rhSF/HGF=80.3±3.3%). The muscle flow index after nitroprusside was also higher for the rhSF/HGF-treated than in the rhVEGF₁₆₅-treated animals (P=.01).

Effect of rhSF/HGF and rhVEGF₁₆₅ on Muscle Atrophy
Muscle atrophy, evaluated by the muscle atrophy index (as described above), was significantly reduced in animals that received rhVEGF₁₆₅ or rhSF/HGF (P<.01) compared with controls (control=28.67±2.47%; rhVEGF₁₆₅=14.25±2.52%; and rhSF/HGF=4.27±2.65%). The effect observed in the rhSF/HGF group was significantly greater than that observed in the rhVEGF₁₆₅ group (P=.013) (Table 1).

View this table: [in this window] [in a new window]   Table 1. Effect of rhSF/HGF and rhVEGF165 on the Index of Muscle Atrophy in the Ischemic Hindlimb

Systemic Effects of rhSF/HGF and rhVEGF₁₆₅ )
Although a trend toward greater weight gain was observed in rhVEGF₁₆₅- and rhSF/HGF-treated animals, there were no significant differences among groups. Similarly, neither the weight nor the regional blood flow in liver or kidney differed among the groups. Blinded examination of microscopic sections from remote organ sites disclosed no pathological findings (Table 2).

View this table: [in this window] [in a new window]   Table 2. Effects of rhSF/HGF and of rhVEGF165 on Liver, Kidney, and Total Body Weight and on Liver and Kidney Blood Flow

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
SF/HGF is a pleiotropic growth factor; its receptor, c-Met, is widely expressed on different cell populations, including both ECs and vascular SMCs.²⁴ Cells transfected with full-length met cDNA respond to SF/HGF with a wide spectrum of biological effects.⁴⁴ We therefore considered the possibility that SF/HGF could also upregulate VEGF expression in SMCs. In our first series of in vitro experiments, we could in fact demonstrate that SF/HGF upregulates VEGF expression in HVSMCs. Induction of VEGF mRNA by SF/HGF has previously been suggested by results obtained with implanted Matrigel.⁴⁵ In that previous report, neither the identity of the cells responsible for the increase in VEGF mRNA nor the possibility of an increase in VEGF at the protein level was investigated. The present results establish that SMCs increase both VEGF mRNA and protein production after stimulation by SF/HGF. Furthermore, expression of all three principal VEGF isoforms was augmented.

The second series of in vitro experiments indicates that the effect of SF/HGF on EC migration and proliferation is similar to that induced by VEGF. When SF/HGF and VEGF are administered together, however, the mitogenic and chemotactic response of cultured ECs exceeds that achieved with either cytokine alone. Taken together, these findings suggest that in a milieu in which both ECs and SMCs are present, as is the case in vivo, SF/HGF may exert a potent combination of direct and indirect effects, including direct effects on ECs and indirect effects mediated via an increase in the production of VEGF. The consequence of such combined effects would be expected to be a potent means for stimulating angiogenesis in vivo.

The results of the in vivo experiments, in fact, confirm this notion. Experiments performed in the rabbit ischemic hindlimb model established that SF/HGF may be used therapeutically to augment collateral vessel development and blood flow to ischemic tissue. Previous investigators have evaluated the effect of SF/HGF in alternative in vivo assays, including Matrigel plug and cornea pocket assays.^{16 18} The present observations extend these previous results by showing that the neovasculature that develops in response to SF/HGF is functional, as indicated by the concomitant increase in arterial blood flow in the ischemic hindlimb, improvement in skeletal muscle perfusion, and a significant reduction in muscle atrophy.

The demonstration of a potent therapeutic effect of exogenously administered SF/HGF on angiogenesis in this ischemic hindlimb model is consistent with previous descriptions of transient expression in skeletal muscle during embryogenesis and after ischemic injury,¹⁴ in contrast to absent expression in normal adult muscle.^{13 14} The possibility that SF/HGF may play a key role in modulating angiogenesis that develops in response to ischemia is further supported by the recent finding that expression of SF/HGF is enhanced after myocardial ischemia and reperfusion.²⁰

The present in vivo studies also indicate that SF/HGF-induced neovascularity exceeds that achieved with VEGF. Despite a similar dose-response relationship in vitro and the same schedule of administration (500 µgx3) in vivo, angiographic as well as histological evidence of angiogenesis in animals receiving SF/HGF was more marked than that in those treated with VEGF. These in vivo results extend our in vitro findings by suggesting that the ability of SF/HGF to induce angiogenesis by direct effects on EC proliferation and migration may be potentiated in vivo by the ability to induce angiogenesis indirectly by upregulating one or more cytokines, as shown here for VEGF.

Direct comparison of SF/HGF and VEGF carried out in these in vivo studies suggests that EC specificity is not necessarily an advantageous feature for cytokines designed to promote angiogenesis. In fact, from the standpoint of bioactivity, the in vivo results suggest that the pleiotropic effects of nonspecific EC mitogens such as SF/HGF may constitute an important means of optimizing neovascularization of ischemic tissues. The potential liability of pleiotropic effects associated with a non–EC-specific mitogen is the risk of stimulating superfluous cell populations. In this regard, it is noteworthy that no pathological consequences were observed with the dose and protocol of administration of SF/HGF used for these experiments. In particular, body weight was not altered and no evidence of angiogenesis or increased blood flow was observed in nonischemic tissues. In addition, whereas previous reports have suggested that SF/HGF administration is associated with a growth-promoting effect on liver and kidney,^{15 46 47 48} no such effect was observed in our study. It is important to point out, however, that in these previous reports, growth-promoting effects of SF/HGF were demonstrated in the case of injured organs^{15 46 47} and/or continuous administration of the angiogenic cytokine.^{47 48}

The absence of accompanying pathological effects in the present series of experiments as well as in other reported work⁴⁶ is consistent with the suggestion that the in vivo response to SF/HGF is facilitated by a priming stimulus. Indeed, similar site specificity has been demonstrated for basic fibroblast growth factor.⁷ The above-cited work of Ono et al²⁰ suggested that local upregulation of the c-Met receptor acts to regulate the extent of SF/HGF bioactivity. A similar paradigm has been described for VEGF, in which site specificity appears to be due in part to paracrine upregulation of the KDR receptor by factors derived from hypoxic myocytes.⁴⁹ It is also worth noting that previous studies have established that stimulation of the c-Met receptor in vascular SMCs does not evoke a proliferative response.^{24 49} Moreover, the risk of potentially unwanted effects in noninjured organs may be avoided by a protocol of restricted administration. In this regard, it is fortuitous that the time interval required for neovascularization of ischemic tissues in animals^{3 39 50} and patients^{9 10} is typically <30 days.

	Selected Abbreviations and Acronyms

 

EC = endothelial cell HUVEC = human endothelial cell HVSMC = human vascular smooth muscle cell PMA = phorbol-12-myristate 13-acetate rh = recombinant human RT-PCR = reverse transcription–polymerase chain reaction SF/HGF = scatter factor/hepatocyte growth factor SMC = smooth muscle cell VEGF = vascular endothelial growth factor

	Acknowledgments

 
This study was supported in part by grants HL-40518, HL-53354, and HL-57516 and an Academic Award in Vascular Medicine (HL-02824) from the National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Md. Dr Van Belle is the recipient of a Fellowship from the French government "Bourse Lavoisier."

	Footnotes

 
Drs Van Belle and Witzenbichler contributed equally to this work.

Received August 26, 1997; revision received October 30, 1997; accepted November 13, 1997.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. D'Amore PA, Thompson RW. Mechanisms of angiogenesis. Annu Rev Physiol. 1987;49:453–464.[Medline] [Order article via Infotrieve]

2. Folkman J, Shing Y. Angiogenesis. J Biol Chem. 1992;267:10931–10934.[Free Full Text]

3. Takeshita S, Zheng LP, Brogi E, Kearney M, Pu LQ, Bunting S, Ferrara N, Symes JF, Isner JM. Therapeutic angiogenesis: a single intra-arterial bolus of vascular endothelial growth factor augments revascularization in a rabbit ischemic hindlimb model. J Clin Invest. 1994;93:662–670.

4. Banai S, Jaklitsch MT, Shou M, Lazarous DF, Scheinowitz M, Biro S, Epstein SE, Unger EF. Angiogenic-induced enhancement of collateral blood flow to ischemic myocardium by vascular endothelial growth factor in dogs. Circulation. 1994;89:2183–2189.[Abstract/Free Full Text]

5. Pearlman JD, Hibberd MG, Chuang ML, Harada K, Lopez JJ, Gladston SR, Friedman M, Sellke FW, Simons M. Magnetic resonance mapping demonstrates benefits of VEGF-induced myocardial angiogenesis. Nat Med. 1995;1:1085–1089.[Medline] [Order article via Infotrieve]

6. Hariawala M, Horowitz JR, Esakof D, Sheriff DD, Walter DH, Chaudhry GM, Desai V, Keyt B, Isner JM, Symes JF. VEGF improves myocardial blood flow but produces EDRF-mediated hypotension in porcine hearts. J Surg Res. 1996;63:77–82.[Medline] [Order article via Infotrieve]

7. Giordano FJ, Ping P, McKirnan D, Nozaki S, DeMaria AN, Dillmann WH, Mathieu-Costello O, Hammond HK. Intracoronary gene transfer of fibroblast growth factor-5 increases blood flow and contractile function in an ischemic region of the heart. Nat Med. 1996;2:534–539.[Medline] [Order article via Infotrieve]

8. Harada K, Grossman W, Friedman M, Edelman ER, Prasad PV, Keighlcy CS, Manning WJ, Selke FW, Simons M. Basic fibroblast growth factor improves myocardial function in chronically ischemic porcine hearts. J Clin Invest. 1994;94:623–630.

9. Isner JM, Pieczek A, Schainfeld R, Blair R, Haley L, Asahara T, Rosenfield K, Razvi S, Walsh K, Symes J. Clinical evidence of angiogenesis following arterial gene transfer of phVEGF₁₆₅. Lancet. 1996;348:370–374.[Medline] [Order article via Infotrieve]

10. Baumgartner I, Pieczek A, Manor O, Blair R, Isner JM. Evidence of therapeutic angiogenesis in patients with critical limb ischemia after intramuscular phVEGF₁₆₅ gene transfer. Circulation. 1997;96(suppl I):I-32. Abstract.

11. Nakamura T, Nishizawa T, Hagiya M, Scki T, Shimonishi A, Sugimura A, Tashiro K, Schimizu S. Modular cloning and expression of human hepatocyte growth factor. Nature. 1989;342:440–443.[Medline] [Order article via Infotrieve]

12. Gherardi E, Stroker M. Hepatocyte growth factor-scatter factor: mitogen, motogen and met. Cancer Cells. 1991;3:227–232.[Medline] [Order article via Infotrieve]

13. Sonnenberg E, Meyer D, Weidner KM, Birchmeier C. Scatter factor/hepatocyte growth factor and its receptor, the c-met tyrosine kinase, can mediate a signal exchange between mesenchyme and epithelia during mouse development. J Cell Biol. 1993;123:223–235.[Abstract/Free Full Text]

14. Jennische E, Ekberg S, Matejka GL. Expression of hepatocyte growth factor in growing and regenerating rat skeletal muscle. Am J Physiol. 1993;265:C122–C128.[Abstract/Free Full Text]

15. Igawa T, Matsumoto K, Kanda S, Saito Y, Nakamura T. Hepatocyte growth factor may act as a renotropic factor for regeneration in rats with acute renal injury. Am J Physiol. 1993;265:F61–F69.[Abstract/Free Full Text]

16. Grant SD, Kleinman HK, Goldberg ID, Bhargava MM, Nickoloff BJ, Kinsella JL, Polverini P, Rosen EM. Scatter factor induces blood vessel formation in vivo. Proc Natl Acad Sci U S A. 1993;90:1937–1941.[Abstract/Free Full Text]

17. Morimoto A, Okamura K, Hamanaka R, Sato Y, Shima N, Higashio K, Kuwano M. Hepatocyte growth factor modulates migration and proliferation of human microvascular endothelial cells in culture. Biochem Biophys Res Commun. 1991;179:1042–1049.[Medline] [Order article via Infotrieve]

18. Bussolino F, DiRenzo MF, Ziche M, Bocchietto E, Olivero M, Naldini L, Gaudino G, Tamagnone L, Coffer A, Comoglio PM. Hepatocyte growth factor is a potent angiogenic factor which stimulates endothelial cell mobility and growth. J Cell Biol. 1992;119:629–641.[Abstract/Free Full Text]

19. Sato Y, Okamura K, Morimoto A, Hamanaka R, Hamanaguchi K, Shimado T, Ono M, Kohno K, Sakata T, Kuwano M. Indispensable role of tissue-type plasminogen activator in growth factor-dependent tube formation of human microvascular endothelial cells in vitro. Exp Cell Res. 1993;204:223–229.[Medline] [Order article via Infotrieve]

20. Ono K, Matsumori A, Shioi T, Furukawa U, Sasayama S. Enhanced expression of hepatocyte growth factor/c-Met by myocardial ischemia and reperfusion in a rat model. Circulation. 1997;95:2552–2558.[Abstract/Free Full Text]

21. Brogi E, Wu T, Namiki A, Isner JM. Indirect angiogenic cytokines upregulate VEGF and bFGF gene expression in vascular smooth muscle cells, while hypoxia upregulates VEGF expression only. Circulation. 1994;90:649–652.[Abstract/Free Full Text]

22. Pepper MS, Vassalli JD, Orci L, Montesano R. Biphasic effect of transforming growth factor-ß1 on in vitro angiogenesis. Exp Cell Res. 1993;204:356–363.[Medline] [Order article via Infotrieve]

23. D'Amore P, Smith SR. Growth factor effects on cells of the vascular wall: a survey. Growth Factors. 1993;8:61–75.[Medline] [Order article via Infotrieve]

24. Nakamura Y, Morishita R, Higaki J, Kida I, Aoki M, Moriguchi A, Yamada K, Hayashi S, Yo Y, Matsumoto K, Nakamura T, Ogihara T. Expression of local hepatocyte growth factor system in vascular tissues. Biochem Biophys Res Commun. 1995;215:483–488.[Medline] [Order article via Infotrieve]

25. Naka D, Ishii T, Yoshiyama Y, Miyazzawa K, Hara H, Hishida T, Kidamura N. Activation of hepatocyte growth factor by proteolytic conversion of a single chain form to a heterodimer. J Biol Chem. 1992;267:20114–20119.[Abstract/Free Full Text]

26. Zioncheck TF, Richardson L, Liu J, Chang L, King KL, Bennett GL, Fugedi P, Chamow SM, Schwall RH, Stack RJ. Sulfated oligosaccharides promote hepatocyte growth factor association and govern its mitogenic activity. J Biol Chem. 1995;270:16871–16878.[Abstract/Free Full Text]

27. Ferrara N, Leung DW, Cachianes G, Winer J, Henzel WJ. Purification and cloning of vascular endothelial growth factor secreted by pituitary follicolostellate cells. Methods Enzymol. 1991;198:391–404.[Medline] [Order article via Infotrieve]

28. Jaffe EA, Nachman RL, Becker CG, Minick CR. Culture of human endothelial cells derived from umbilical veins. J Clin Invest. 1973;52:2745–2756.

29. Pickering JG, Weir L, Rosenfield K, Stetz J, Jekanowski J, Isner JM. Smooth muscle cell outgrowth from human atherosclerotic plaque: implications for the assessment of lesion biopsy. J Am Coll Cardiol. 1992;20:1430–1439.[Abstract]

30. Tischer E, Mitchell R, Hartmann T, Silva M, Gospodarowicz D, Fiddes J, Abraham J. The human gene for vascular endothelial growth factor: multiple protein forms are encoded through alternative exon splicing. J Biol Chem. 1991;266:11947–11954.[Abstract/Free Full Text]

31. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159.[Medline] [Order article via Infotrieve]

32. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Plainview, NY: Cold Spring Harbor Laboratory Press; 1989.

33. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KG, Ehrlich HA. Primer-directed enzymatic amplification of DNA with thermostable DNA polymerase. Science. 1988;239:487–491.[Abstract/Free Full Text]

34. Wang AM, Doyle MV, Mark DF. Quantification of mRNA by the polymerase chain reaction. Proc Natl Acad Sci U S A. 1989;86:9717–9721.[Abstract/Free Full Text]

35. Mosman T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods. 1983;65:55–63.[Medline] [Order article via Infotrieve]

36. Falk W, Goodwin RH, Leonard EJ. A 48 well micro chemotaxis assembly for rapid and accurate measurement of leukocyte migration. J Immunol Methods. 1980;33:239–247.[Medline] [Order article via Infotrieve]

37. Bauters C, Asahara T, Zheng LP, Takeshita S, Bunting S, Ferrara N, Symes JF, Isner JM. Physiologic assessment of augmented vascularity induced by VEGF in ischemic rabbit hindlimb. Am J Physiol. 1994;267:H1263–H1271.[Abstract/Free Full Text]

38. Takeshita S, Pu L-Q, Zheng L, Ferrara N, Stein LA, Sniderman AD, Isner JM, Symes JF. Vascular endothelial growth factor induces dose-dependent revascularization in a rabbit model of persistent limb ischemia. Circulation. 1994;90(suppl II):II-228-II-234.

39. Bauters C, Asahara T, Zheng LP, Takeshita S, Bunting S, Ferrara N, Symes JF, Isner JM. Site-specific therapeutic angiogenesis following systemic administration of vascular endothelial growth factor. J Vasc Surg. 1995;21:314–325.[Medline] [Order article via Infotrieve]

40. Walter DH, Hink U, Asahara T, Van Belle E, Horowitz J, Tsurumi Y, Vandlen R, Heinsohn H, Keyt B, Ferrara N, Symes JF, Isner JM. The in vivo bioactivity of vascular endothelial growth factor/vascular permeability factor is independent of N-linked glycosylation. Lab Invest. 1996;74:546–556.[Medline] [Order article via Infotrieve]

41. Doucette JW, Corl PD, Payne HM, Flynn AE, Goto M, Nassi M, Segal J. Validation of a Doppler wire for intravascular measurements of coronary artery flow velocity. Circulation. 1992;85:1899–1911.[Abstract/Free Full Text]

42. Kowallik P, Schulz R, Guth BD, Schade A, Paffhausen W, Gross R, Heusch G. Measurement of regional myocardial blood flow with multiple colored microspheres. Circulation. 1991;83:974–982.[Abstract/Free Full Text]

43. Ziada AM, Hudlicka O, Tyler KR, Wright AJ. The effect of long-term vasodilation on capillary growth and performance in rabbit heart and skeletal muscle. Cardiovasc Res. 1984;18:724–732.[Medline] [Order article via Infotrieve]

44. Weidner KM, Sachs M, Birchmeier W. The Met receptor tyrosine kinase transduces motility, proliferation, and morphogenic signals of scatter factor/hepatocyte growth factor in epithelial cells. J Cell Biol. 1993;121:145–154.[Abstract/Free Full Text]

45. Silvagno F, Follenzi A, Arese M, Prat M, Giraudo E, Gaudino G, Camussi G, Comoglio PM, Bussolino F. In vivo activation of met tyrosine kinase by heterodimeric hepatocyte growth factor molecule promotes angiogenesis. Arterioscler Thromb Vasc Biol. 1995;15:1857–1865.[Abstract/Free Full Text]

46. Webber EM, Godowski PJ, Fausto N. In vivo response of hepatocytes to growth factors requires an initial priming stimulus. Hepatology. 1994;14:489–497.

47. Fujiwara K, Nagoshi S, Ohno A, Hirata K, Ohta Y, Mochida S, Tomiya T, Highashio K, Kurokawa K. Stimulation of liver growth by exogenous human hepatocyte growth factor in normal and partially hepatectomized rats. Hepatology. 1993;18:1443–1449.[Medline] [Order article via Infotrieve]

48. Roos F, Ryan AM, Chamow SM, Bennett GL, Schwall RH. Induction of liver growth in normal mice by infusion of hepatocyte growth factor/scatter factor. Am J Physiol. 1995;268:G380–G386.[Abstract/Free Full Text]

49. Brogi E, Schatteman G, Wu T, Kim EA, Varticovski L, Keyt B, Isner JM. Hypoxia-induced paracrine regulation of VEGF receptor expression. J Clin Invest.. 1996;97:469–476.[Medline] [Order article via Infotrieve]

50. Hayashi S, Morishita R, Higaki J, Aoki M, Moriguchi A, Kida I, Yoshiki S, Matsumoto K, Nakamura T, Kaneda Y, Ogihara T. Autocrine-paracrine effects of overexpression of hepatocyte growth factor gene on growth of endothelial cells. Biochem Biophys Res Commun. 1996;220:539–545.[Medline] [Order article via Infotrieve]

51. Tabata H, Silver M, Isner JM. Arterial gene transfer of acidic fibroblast growth factor for therapeutic angiogenesis in vivo: critical role of secretion signal in use of naked DNA. Cardiovasc Res. 1997;35:470–479.[Abstract/Free Full Text]

This article has been cited by other articles:

				Y. Yamamoto, T. Matsuura, G. Narazaki, M. Sugitani, K. Tanaka, A. Maeda, G. Shiota, K. Sato, A. Yoshida, and I. Hisatome Synergistic effects of autologous cell and hepatocyte growth factor gene therapy for neovascularization in a murine model of hindlimb ischemia Am J Physiol Heart Circ Physiol, October 1, 2009; 297(4): H1329 - H1336. [Abstract] [Full Text] [PDF]

				R. P. Rhoads, R. M. Johnson, C. R. Rathbone, X. Liu, C. Temm-Grove, S. M. Sheehan, J. B. Hoying, and R. E. Allen Satellite cell-mediated angiogenesis in vitro coincides with a functional hypoxia-inducible factor pathway Am J Physiol Cell Physiol, June 1, 2009; 296(6): C1321 - C1328. [Abstract] [Full Text] [PDF]

				M. Okada, T. R. Payne, B. Zheng, H. Oshima, N. Momoi, K. Tobita, B. B. Keller, J. A. Phillippi, B. Peault, and J. Huard Myogenic Endothelial Cells Purified From Human Skeletal Muscle Improve Cardiac Function After Transplantation Into Infarcted Myocardium J. Am. Coll. Cardiol., December 2, 2008; 52(23): 1869 - 1880. [Abstract] [Full Text] [PDF]

				E. I. Ager, J. Neo, and C. Christophi The renin-angiotensin system and malignancy Carcinogenesis, September 1, 2008; 29(9): 1675 - 1684. [Abstract] [Full Text] [PDF]

				R. J. Powell, M. Simons, F. O. Mendelsohn, G. Daniel, T. D. Henry, M. Koga, R. Morishita, and B. H. Annex Results of a Double-Blind, Placebo-Controlled Study to Assess the Safety of Intramuscular Injection of Hepatocyte Growth Factor Plasmid to Improve Limb Perfusion in Patients With Critical Limb Ischemia Circulation, July 1, 2008; 118(1): 58 - 65. [Abstract] [Full Text] [PDF]

				H. Jin, R. Yang, Z. Zheng, M. Romero, J. Ross, H. Bou-Reslan, R. A.D. Carano, I. Kasman, E. Mai, J. Young, et al. MetMAb, the One-Armed 5D5 Anti-c-Met Antibody, Inhibits Orthotopic Pancreatic Tumor Growth and Improves Survival Cancer Res., June 1, 2008; 68(11): 4360 - 4368. [Abstract] [Full Text] [PDF]

				E. Sulpice, J. Plouet, M. Berge, D. Allanic, G. Tobelem, and T. Merkulova-Rainon Neuropilin-1 and neuropilin-2 act as coreceptors, potentiating proangiogenic activity Blood, February 15, 2008; 111(4): 2036 - 2045. [Abstract] [Full Text] [PDF]

				L. N. Bell, L. Cai, B. H. Johnstone, D. O. Traktuev, K. L. March, and R. V. Considine A central role for hepatocyte growth factor in adipose tissue angiogenesis Am J Physiol Endocrinol Metab, February 1, 2008; 294(2): E336 - E344. [Abstract] [Full Text] [PDF]

				S. V. Sharma and J. Settleman Oncogene addiction: setting the stage for molecularly targeted cancer therapy Genes & Dev., December 15, 2007; 21(24): 3214 - 3231. [Abstract] [Full Text] [PDF]

				J.-W. Lin, W. H.-H. Sheu, W.-J. Lee, Y.-T. Chen, T.-J. Liu, C.-T. Ting, and W.-L. Lee Circulating Hepatocyte Growth Factor Level but Not Basic Fibroblast Growth Factor Level Is Elevated in Angiography-Proven Symptomatic Peripheral Artery Disease Angiology, September 1, 2007; 58(4): 420 - 428. [Abstract] [PDF]

				L. Vona-Davis and D. P Rose Adipokines as endocrine, paracrine, and autocrine factors in breast cancer risk and progression Endocr. Relat. Cancer, June 1, 2007; 14(2): 189 - 206. [Abstract] [Full Text] [PDF]

				E. S. Colombo, G. Menicucci, P. G. McGuire, and A. Das Hepatocyte Growth Factor/Scatter Factor Promotes Retinal Angiogenesis through Increased Urokinase Expression Invest. Ophthalmol. Vis. Sci., April 1, 2007; 48(4): 1793 - 1800. [Abstract] [Full Text] [PDF]

				T. Martens, N.-O. Schmidt, C. Eckerich, R. Fillbrandt, M. Merchant, R. Schwall, M. Westphal, and K. Lamszus A Novel One-Armed Anti-c-Met Antibody Inhibits Glioblastoma Growth In vivo. Clin. Cancer Res., October 15, 2006; 12(20): 6144 - 6152. [Abstract] [Full Text] [PDF]

				N. Lasagna, O. Fantappie, M. Solazzo, L. Morbidelli, S. Marchetti, G. Cipriani, M. Ziche, and R. Mazzanti Hepatocyte growth factor and inducible nitric oxide synthase are involved in multidrug resistance-induced angiogenesis in hepatocellular carcinoma cell lines. Cancer Res., March 1, 2006; 66(5): 2673 - 2682. [Abstract] [Full Text] [PDF]

				H. McKinnon, E. Gherardi, M. Reidy, and D. Bowyer Hepatocyte Growth Factor/Scatter Factor and MET Are Involved in Arterial Repair and Atherogenesis Am. J. Pathol., January 1, 2006; 168(1): 340 - 348. [Abstract] [Full Text] [PDF]

				S. Susen, K. Sautiere, F. Mouquet, F. Cuilleret, A. Chmait, E. P. McFadden, B. Hennache, F. Richard, P. de Groote, J.-M. Lablanche, et al. Serum hepatocyte growth factor levels predict long-term clinical outcome after percutaneous coronary revascularization Eur. Heart J., November 2, 2005; 26(22): 2387 - 2395. [Abstract] [Full Text] [PDF]

				R. Abounader and J. Laterra Scatter factor/hepatocyte growth factor in brain tumor growth and angiogenesis Neuro-oncol, October 1, 2005; 7(4): 436 - 451. [Abstract] [PDF]

				A. Hiratsuka, H. Adachi, Y. Fujiura, S.-I. Yamagishi, Y. Hirai, M. Enomoto, A. Satoh, A. Hino, K. Furuki, and T. Imaizumi Strong Association between Serum Hepatocyte Growth Factor and Metabolic Syndrome J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 2927 - 2931. [Abstract] [Full Text] [PDF]

				T. Nakamura, K. Matsumoto, S. Mizuno, Y. Sawa, H. Matsuda, and T. Nakamura Hepatocyte growth factor prevents tissue fibrosis, remodeling, and dysfunction in cardiomyopathic hamster hearts Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2131 - H2139. [Abstract] [Full Text] [PDF]

				R. Morishita, M. Aoki, and T. Ogihara Does gene therapy become pharmacotherapy? Exp Physiol, May 1, 2005; 90(3): 307 - 313. [Abstract] [Full Text] [PDF]

				M. E. Gerritsen HGF and VEGF: A Dynamic Duo Circ. Res., February 18, 2005; 96(3): 272 - 273. [Full Text] [PDF]

				J.-K. Min, Y.-M. Lee, J. H. Kim, Y.-M. Kim, S. W. Kim, S.-Y. Lee, Y. S. Gho, G. T. Oh, and Y.-G. Kwon Hepatocyte Growth Factor Suppresses Vascular Endothelial Growth Factor-Induced Expression of Endothelial ICAM-1 and VCAM-1 by Inhibiting the Nuclear Factor-{kappa}B Pathway Circ. Res., February 18, 2005; 96(3): 300 - 307. [Abstract] [Full Text] [PDF]

				Y. Cao, A. Hong, H. Schulten, and M. J. Post Update on therapeutic neovascularization Cardiovasc Res, February 15, 2005; 65(3): 639 - 648. [Abstract] [Full Text] [PDF]

				D. J. Hicklin and L. M. Ellis Role of the Vascular Endothelial Growth Factor Pathway in Tumor Growth and Angiogenesis J. Clin. Oncol., February 10, 2005; 23(5): 1011 - 1027. [Abstract] [Full Text] [PDF]

				K. Komamura, R. Tatsumi, J.-i. Miyazaki, K. Matsumoto, E. Yamato, T. Nakamura, Y. Shimizu, T. Nakatani, S. Kitamura, H. Tomoike, et al. Treatment of Dilated Cardiomyopathy With Electroporation of Hepatocyte Growth Factor Gene Into Skeletal Muscle Hypertension, September 1, 2004; 44(3): 365 - 371. [Abstract] [Full Text] [PDF]

				R. Morishita, M. Aoki, N. Hashiya, H. Makino, K. Yamasaki, J. Azuma, Y. Sawa, H. Matsuda, Y. Kaneda, and T. Ogihara Safety Evaluation of Clinical Gene Therapy Using Hepatocyte Growth Factor to Treat Peripheral Arterial Disease Hypertension, August 1, 2004; 44(2): 203 - 209. [Abstract] [Full Text] [PDF]

				N. Hashiya, N. Jo, M. Aoki, K. Matsumoto, T. Nakamura, Y. Sato, N. Ogata, T. Ogihara, Y. Kaneda, and R. Morishita In Vivo Evidence of Angiogenesis Induced by Transcription Factor Ets-1: Ets-1 Is Located Upstream of Angiogenesis Cascade Circulation, June 22, 2004; 109(24): 3035 - 3041. [Abstract] [Full Text] [PDF]

				J. Rehman, D. Traktuev, J. Li, S. Merfeld-Clauss, C. J. Temm-Grove, J. E. Bovenkerk, C. L. Pell, B. H. Johnstone, R. V. Considine, and K. L. March Secretion of Angiogenic and Antiapoptotic Factors by Human Adipose Stromal Cells Circulation, March 16, 2004; 109(10): 1292 - 1298. [Abstract] [Full Text] [PDF]

				N. Tokunaga, N. Nagaya, M. Shirai, E. Tanaka, H. Ishibashi-Ueda, M. Harada-Shiba, M. Kanda, T. Ito, W. Shimizu, Y. Tabata, et al. Adrenomedullin Gene Transfer Induces Therapeutic Angiogenesis in a Rabbit Model of Chronic Hind Limb Ischemia: Benefits of a Novel Nonviral Vector, Gelatin Circulation, February 3, 2004; 109(4): 526 - 531. [Abstract] [Full Text] [PDF]

				K. Hiraoka, H. Koike, S. Yamamoto, N. Tomita, C. Yokoyama, T. Tanabe, T. Aikou, T. Ogihara, Y. Kaneda, and R. Morishita Enhanced Therapeutic Angiogenesis by Cotransfection of Prostacyclin Synthase Gene or Optimization of Intramuscular Injection of Naked Plasmid DNA Circulation, November 25, 2003; 108(21): 2689 - 2696. [Abstract] [Full Text] [PDF]

				S. J. Kim, M. Johnson, K. Koterba, M. H. Herynk, H. Uehara, and G. E. Gallick Reduced c-Met Expression by an Adenovirus Expressing a c-Met Ribozyme Inhibits Tumorigenic Growth and Lymph Node Metastases of PC3-LN4 Prostate Tumor Cells in an Orthotopic Nude Mouse Model Clin. Cancer Res., November 1, 2003; 9(14): 5161 - 5170. [Abstract] [Full Text] [PDF]

				T. Merkulova-Rainon, P. England, S. Ding, C. Demerens, and G. Tobelem The N-terminal Domain of Hepatocyte Growth Factor Inhibits the Angiogenic Behavior of Endothelial Cells Independently from Binding to the c-met Receptor J. Biol. Chem., September 26, 2003; 278(39): 37400 - 37408. [Abstract] [Full Text] [PDF]

				V. Chhokar and A. L. Tucker Angiogenesis: Basic Mechanisms and Clinical Applications Seminars in Cardiothoracic and Vascular Anesthesia, September 1, 2003; 7(3): 253 - 280. [Abstract] [PDF]

				S. Ding, T. Merkulova-Rainon, Z. C. Han, and G. Tobelem HGF receptor up-regulation contributes to the angiogenic phenotype of human endothelial cells and promotes angiogenesis in vitro Blood, June 15, 2003; 101(12): 4816 - 4822. [Abstract] [Full Text] [PDF]

				P. O. Bonetti, D. R. Holmes Jr, A. Lerman, and G. W. Barsness Enhanced external counterpulsation for ischemic heart disease: What's behind the curtain? J. Am. Coll. Cardiol., June 4, 2003; 41(11): 1918 - 1925. [Abstract] [Full Text] [PDF]

				J. Rehman, R. V. Considine, J. E. Bovenkerk, J. Li, C. A. Slavens, R. M. Jones, and K. L. March Obesity is associated with increased levels of circulating hepatocyte growth factor J. Am. Coll. Cardiol., April 16, 2003; 41(8): 1408 - 1413. [Abstract] [Full Text] [PDF]

				N. Tomita, R. Morishita, Y. Taniyama, H. Koike, M. Aoki, H. Shimizu, K. Matsumoto, T. Nakamura, Y. Kaneda, and T. Ogihara Angiogenic Property of Hepatocyte Growth Factor Is Dependent on Upregulation of Essential Transcription Factor for Angiogenesis, ets-1 Circulation, March 18, 2003; 107(10): 1411 - 1417. [Abstract] [Full Text] [PDF]

				N. Wajih and D. C. Sane Angiostatin selectively inhibits signaling by hepatocyte growth factor in endothelial and smooth muscle cells Blood, March 1, 2003; 101(5): 1857 - 1863. [Abstract] [Full Text] [PDF]

				C. Heeschen, S. Dimmeler, C. W. Hamm, E. Boersma, A. M. Zeiher, M. L. Simoons, and on Behalf of the CAPTURE (c7E3 Anti-Platelet Thera Prognostic Significance of Angiogenic Growth Factor Serum Levels in Patients With Acute Coronary Syndromes Circulation, February 4, 2003; 107(4): 524 - 530. [Abstract] [Full Text] [PDF]

				K. Reisinger, R. Kaufmann, and J. Gille Increased Sp1 phosphorylation as a mechanism of hepatocyte growth factor (HGF/SF)-induced vascular endothelial growth factor (VEGF/VPF) transcription J. Cell Sci., January 15, 2003; 116(2): 225 - 238. [Abstract] [Full Text] [PDF]

				S. Sengupta, E. Gherardi, L. A. Sellers, J. M. Wood, R. Sasisekharan, and T.-P. D. Fan Hepatocyte Growth Factor/Scatter Factor Can Induce Angiogenesis Independently of Vascular Endothelial Growth Factor Arterioscler Thromb Vasc Biol, January 1, 2003; 23(1): 69 - 75. [Abstract] [Full Text] [PDF]

				T. Funatsu, Y. Sawa, S. Ohtake, T. Takahashi, G. Matsumiya, N. Matsuura, T. Nakamura, and H. Matsuda Therapeutic angiogenesis in the ischemic canine heart induced by myocardial injection of naked complementary DNA plasmid encoding hepatocyte growth factor J. Thorac. Cardiovasc. Surg., December 1, 2002; 124(6): 1099 - 1105. [Abstract] [Full Text]

				M. Onimaru, Y. Yonemitsu, M. Tanii, K. Nakagawa, I. Masaki, S. Okano, H. Ishibashi, K. Shirasuna, M. Hasegawa, and K. Sueishi Fibroblast Growth Factor-2 Gene Transfer Can Stimulate Hepatocyte Growth Factor Expression Irrespective of Hypoxia-Mediated Downregulation in Ischemic Limbs Circ. Res., November 15, 2002; 91(10): 923 - 930. [Abstract] [Full Text] [PDF]

				J. Borawski and M. Mysliwiec Serum hepatocyte growth factor is associated with viral hepatitis, cardiovascular disease, erythropoietin treatment, and type of heparin in haemodialysis patients Nephrol. Dial. Transplant., April 1, 2002; 17(4): 637 - 644. [Abstract] [Full Text] [PDF]

				Y. Taniyama, R. Morishita, K. Hiraoka, M. Aoki, H. Nakagami, K. Yamasaki, K. Matsumoto, T. Nakamura, Y. Kaneda, and T. Ogihara Therapeutic Angiogenesis Induced by Human Hepatocyte Growth Factor Gene in Rat Diabetic Hind Limb Ischemia Model: Molecular Mechanisms of Delayed Angiogenesis in Diabetes Circulation, November 6, 2001; 104(19): 2344 - 2350. [Abstract] [Full Text] [PDF]

				H. Ueda, T. Nakamura, K. Matsumoto, Y. Sawa, H. Matsuda, and T. Nakamura A potential cardioprotective role of hepatocyte growth factor in myocardial infarction in rats Cardiovasc Res, July 1, 2001; 51(1): 41 - 50. [Abstract] [Full Text] [PDF]

				B. Cao, Y. Su, M. Oskarsson, P. Zhao, E. J. Kort, R. J. Fisher, L.-M. Wang, and G. F. Vande Woude Neutralizing monoclonal antibodies to hepatocyte growth factor/scatter factor (HGF/SF) display antitumor activity in animal models PNAS, June 19, 2001; 98(13): 7443 - 7448. [Abstract] [Full Text] [PDF]

				S. Tateno, M. Terai, K. Niwa, T. Jibiki, H. Hamada, K. Yasukawa, T. Honda, S. Oana, and Y. Kohno Alleviation of Myocardial Ischemia After Kawasaki Disease by Heparin and Exercise Therapy Circulation, May 29, 2001; 103(21): 2591 - 2597. [Abstract] [Full Text] [PDF]

				D. Simovic, J. M. Isner, A. H. Ropper, A. Pieczek, and D. H. Weinberg Improvement in Chronic Ischemic Neuropathy After Intramuscular phVEGF165 Gene Transfer in Patients With Critical Limb Ischemia Arch Neurol, May 1, 2001; 58(5): 761 - 768. [Abstract] [Full Text] [PDF]

				X. Xin, S. Yang, G. Ingle, C. Zlot, L. Rangell, J. Kowalski, R. Schwall, N. Ferrara, and M. E. Gerritsen Hepatocyte Growth Factor Enhances Vascular Endothelial Growth Factor-Induced Angiogenesis in Vitro and in Vivo Am. J. Pathol., March 1, 2001; 158(3): 1111 - 1120. [Abstract] [Full Text] [PDF]

				D. C. Bowers, S. Fan, K. A. Walter, R. Abounader, J. A. Williams, E. M. Rosen, and J. Laterra Scatter Factor/Hepatocyte Growth Factor Protects against Cytotoxic Death in Human Glioblastoma via Phosphatidylinositol 3-Kinase- and AKT-dependent Pathways Cancer Res., August 1, 2000; 60(15): 4277 - 4283. [Abstract] [Full Text]

				S. Yasuda, Y. Goto, T. Baba, T. Satoh, H. Sumida, S. Miyazaki, and H. Nonogi Enhanced secretion of cardiac hepatocyte growth factor from an infarct region is associated with less severe ventricular enlargement and improved cardiac function J. Am. Coll. Cardiol., July 1, 2000; 36(1): 115 - 121. [Abstract] [Full Text] [PDF]

				W. Cai, S. L. Rook, Z. Y. Jiang, N. Takahara, and L. P. Aiello Mechanisms of Hepatocyte Growth Factor-Induced Retinal Endothelial Cell Migration and Growth Invest. Ophthalmol. Vis. Sci., June 1, 2000; 41(7): 1885 - 1893. [Abstract] [Full Text]

				O. Benzakour and C. Kanthou The anticoagulant factor, protein S, is produced by cultured human vascular smooth muscle cells and its expression is up-regulated by thrombin Blood, March 15, 2000; 95(6): 2008 - 2014. [Abstract] [Full Text] [PDF]

				M. O Hiltunen, M. P Turunen, M. Laitinen, and S. Yla-Herttuala Insights into the molecular pathogenesis of atherosclerosis and therapeutic strategies using gene transfer Vascular Medicine, February 1, 2000; 5(1): 41 - 48. [Abstract] [PDF]

				M. A. Castilla, M. V. A. Arroyo, E. Aceituno, P. Aragoncillo, F. R. Gonzalez-Pacheco, E. Texeiro, R. Bragado, and C. Caramelo Disruption of Cadherin-Related Junctions Triggers Autocrine Expression of Vascular Endothelial Growth Factor in Bovine Aortic Endothelial Cells : Effects on Cell Proliferation and Death Resistance Circ. Res., December 3, 1999; 85(12): 1132 - 1138. [Abstract] [Full Text] [PDF]

				B.-Q. Shen, D. Y. Lee, and T. F. Zioncheck Vascular Endothelial Growth Factor Governs Endothelial Nitric-oxide Synthase Expression via a KDR/Flk-1 Receptor and a Protein Kinase C Signaling Pathway J. Biol. Chem., November 12, 1999; 274(46): 33057 - 33063. [Abstract] [Full Text] [PDF]

				J.-E. Fabre, A. Rivard, M. Magner, M. Silver, and J. M. Isner Tissue Inhibition of Angiotensin-Converting Enzyme Activity Stimulates Angiogenesis In Vivo Circulation, June 15, 1999; 99(23): 3043 - 3049. [Abstract] [Full Text] [PDF]

				Y. Osuga, O. Tsutsumi, R. Okagaki, Y. Takai, A. Fujimoto, A. Suenaga, M. Maruyama, M. Momoeda, T. Yano, and Y. Taketani Hepatocyte growth factor concentrations are elevated in peritoneal fluid of women with endometriosis Hum. Reprod., June 1, 1999; 14(6): 1611 - 1613. [Abstract] [Full Text] [PDF]

				S. Yasuda, Y. Goto, H. Sumida, T. Noguchi, T. Baba, S. Miyazaki, and H. Nonogi Angiotensin-Converting Enzyme Inhibition Restores Hepatocyte Growth Factor Production in Patients With Congestive Heart Failure Hypertension, June 1, 1999; 33(6): 1374 - 1378. [Abstract] [Full Text] [PDF]

				R. Morishita, S. Nakamura, S.-i. Hayashi, Y. Taniyama, A. Moriguchi, T. Nagano, M. Taiji, H. Noguchi, S. Takeshita, K. Matsumoto, et al. Therapeutic Angiogenesis Induced by Human Recombinant Hepatocyte Growth Factor in Rabbit Hind Limb Ischemia Model as Cytokine Supplement Therapy Hypertension, June 1, 1999; 33(6): 1379 - 1384. [Abstract] [Full Text] [PDF]

				C. N. Lynch, Y. C. Wang, J. K. Lund, Y.-W. Chen, J. A. Leal, and S. R. Wiley TWEAK Induces Angiogenesis and Proliferation of Endothelial Cells J. Biol. Chem., March 26, 1999; 274(13): 8455 - 8459. [Abstract] [Full Text] [PDF]

				A. Rivard, M. Silver, D. Chen, M. Kearney, M. Magner, B. Annex, K. Peters, and J. M. Isner Rescue of Diabetes-Related Impairment of Angiogenesis by Intramuscular Gene Therapy with Adeno-VEGF Am. J. Pathol., February 1, 1999; 154(2): 355 - 363. [Abstract] [Full Text] [PDF]

				A. Rivard, J.-E. Fabre, M. Silver, D. Chen, T. Murohara, M. Kearney, M. Magner, T. Asahara, and J. M. Isner Age-Dependent Impairment of Angiogenesis Circulation, January 12, 1999; 99(1): 111 - 120. [Abstract] [Full Text] [PDF]

				K.-G. Shyu, O. Manor, M. Magner, G. D. Yancopoulos, and J. M. Isner Direct Intramuscular Injection of Plasmid DNA Encoding Angiopoietin-1 but not Angiopoietin-2 Augments Revascularization in the Rabbit Ischemic Hindlimb Circulation, November 10, 1998; 98(19): 2081 - 2087. [Abstract] [Full Text] [PDF]

				B.-Q. Shen, D. Y. Lee, H.-P. Gerber, B. A. Keyt, N. Ferrara, and T. F. Zioncheck Homologous Up-regulation of KDR/Flk-1 Receptor Expression by Vascular Endothelial Growth Factor in Vitro J. Biol. Chem., November 6, 1998; 273(45): 29979 - 29985. [Abstract] [Full Text] [PDF]

				N. Wajih, J. Walter, and D. C. Sane Vascular Origin of a Soluble Truncated Form of the Hepatocyte Growth Factor Receptor (c-met) Circ. Res., January 11, 2002; 90(1): 46 - 52. [Abstract] [Full Text] [PDF]

				Q. Zhao, K. Egashira, S. Inoue, M. Usui, S. Kitamoto, W. Ni, M. Ishibashi, K.-i. Hiasa, T. Ichiki, M. Shibuya, et al. Vascular Endothelial Growth Factor Is Necessary in the Development of Arteriosclerosis by Recruiting/Activating Monocytes in a Rat Model of Long-Term Inhibition of Nitric Oxide Synthesis Circulation, March 5, 2002; 105(9): 1110 - 1115. [Abstract] [Full Text] [PDF]

				R. Morishita, M. Sakaki, K. Yamamoto, S. Iguchi, M. Aoki, K. Yamasaki, K. Matsumoto, T. Nakamura, R. Lawn, T. Ogihara, et al. Impairment of Collateral Formation in Lipoprotein(a) Transgenic Mice: Therapeutic Angiogenesis Induced by Human Hepatocyte Growth Factor Gene Circulation, March 26, 2002; 105(12): 1491 - 1496. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Van Belle, E. Articles by Isner, J. M. Search for Related Content PubMed PubMed Citation Articles by Van Belle, E. Articles by Isner, J. M.