Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 1998;97:1766-1772

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O'Donnell, C. J.
Right arrow Articles by Levy, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O'Donnell, C. J.
Right arrow Articles by Levy, D.

(Circulation. 1998;97:1766-1772.)
© 1998 American Heart Association, Inc.


Clinical Investigation and Reports

Evidence for Association and Genetic Linkage of the Angiotensin-Converting Enzyme Locus With Hypertension and Blood Pressure in Men but Not Women in the Framingham Heart Study

Christopher J. O'Donnell, MD, MPH; Klaus Lindpaintner, MD; Martin G. Larson, ScD; Valluri S. Rao, PhD; Jose M. Ordovas, PhD; Ernst J. Schaefer, MD; Richard H. Myers, PhD; ; Daniel Levy, MD

From the National Heart, Lung, and Blood Institute's Framingham Heart Study (C.J.O., M.G.L., D.L.), Framingham, Mass; the Cardiac Unit (C.J.O.), Department of Medicine, Massachusetts General Hospital, the Divisions of Cardiology and Clinical Epidemiology, Beth Israel Hospital (D.L.), the Department of Cardiology, Children's Hospital (K.L.), and the Cardiovascular Division, Department of Medicine, Brigham and Women's Hospital (K.L., V.S.R.), Harvard Medical School, Boston, Mass; the Molecular Biology Section, Lipid Metabolism Laboratory, Jean Mayer US Department of Agriculture Human Nutrition Research Center on Aging at Tufts University (J.M.O., E.J.S.), Boston, Mass; the Departments of Neurology (R.H.M.), Preventive Medicine and Epidemiology (M.G.L., D.L.), Boston University School of Medicine, Boston, Mass; and the National Heart, Lung, and Blood Institute, National Institutes of Health (C.J.O., D.L.), Bethesda, Md.

Correspondence to Christopher J. O'Donnell, MD, MPH, Framingham Heart Study, 5 Thurber St, Framingham, MA 01701. E-mail chris{at}fram.nhlbi.nih.gov


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background—There is controversy regarding the association of the angiotensin-converting enzyme deletion-insertion (ACE D/I) polymorphism with systemic hypertension and with blood pressure. We investigated these relations in a large population-based sample of men and women by using association and linkage analyses.

Methods and Results—The study sample consisted of 3095 participants in the Framingham Heart Study. Blood pressure measurements were obtained at regular examinations. The ACE D/I polymorphism was identified by using a polymerase chain reaction assay. In logistic regression analysis, the adjusted odds ratios for hypertension among men for the DD and DI genotypes were 1.59 (95% confidence interval [CI], 1.13 to 2.23) and 1.18 (95% CI, 0.87 to 1.62), respectively, versus II ({chi}2 P=.02). In women, adjusted odds ratios for the DD and DI genotypes were 1.00 (95% CI, 0.70 to 1.44) and 0.78 (95% CI, 0.56 to 1.09), respectively (P=.14). In linear regression analysis, there was an association of the ACE DD genotype with increased diastolic blood pressure in men (age-adjusted P=.03, multivariate-adjusted P=.14) but not women. Quantitative trait linkage analyses in 1044 pairs of siblings, by using both ACE D/I and a nearby microsatellite polymorphism of the human growth hormone gene, supported a role of the ACE locus in influencing blood pressure in men but not in women.

Conclusions—In our large, population-based sample, there is evidence for association and genetic linkage of the ACE locus with hypertension and with diastolic blood pressure in men but not women. Our data support the hypothesis that ACE, or a nearby gene, is a sex-specific candidate gene for hypertension. Confirmatory studies in other large population-based samples are warranted.


Key Words: angiotensin • trials • genetics • genes • hormones • hypertension • blood pressure


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Hypertension is a major risk factor for cardiovascular disease in adults and is present in approximately two thirds of all persons over age 65 years.1 2 Whereas aging, obesity, and environmental factors such as alcohol consumption contribute to the onset of hypertension, genetic factors also determine a substantial proportion of the variance of blood pressure in the general population.3 The deletion/insertion (D/I) polymorphism in intron 16 of the angiotensin-converting enzyme (ACE) gene accounts for approximately half the variance in ACE plasma levels, and ACE has been postulated as a candidate gene for blood pressure regulation. However, existing data from case-control studies of the association of ACE D/I and blood pressure are conflicting,4 5 6 7 8 9 10 11 12 13 and prior sib-pair linkage studies have failed to demonstrate genetic linkage between the ACE locus and hypertension.14 There also is uncertainty regarding the hypothesis raised by animal data15 16 that the effects of ACE D/I on ACE levels and blood pressure may be present in males but not females. It is possible that many prior studies have had inadequate power to detect the modest contribution that might be expected from an individual genetic factor to complex traits such as blood pressure. In addition, discordant results among different studies may arise from differences in either the genetic makeup or the environmental exposure status of different populations.

The Framingham Heart Study is a large, prospective, population-based study containing >2000 extended families ranging in size from 2 to 25 members, so it is possible to test hypotheses regarding candidate gene loci for hypertension by using both association analyses and pedigree-based linkage analyses. We therefore studied the association of ACE D/I with blood pressure level and with hypertension status in men and women in the Framingham Heart Study.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Study Sample
The selection criteria and study design of the Framingham Heart Study have been detailed previously.17 18 Starting in 1948, 5209 subjects between ages 28 and 62 years were enrolled in the original cohort study,17 and starting in 1971, 5124 cohort offspring and their spouses were enrolled.18 Participants were invited to attend regular cycles of follow-up examinations (every 2 years for the cohort study, every 4 years for the offspring study). Blood samples for DNA were collected during examination cycles in the period from June 1987 to February 1991. For the current study, the index examination was defined as the examination at which DNA was collected. Of 5545 subjects who attended an examination during the period of DNA collection, 2450 were excluded for the following reasons: DNA samples not collected (n=505), not accessible for genotyping (n=1848), not able to be adequately genotyped (n=17), congestive heart failure (n=47), or severe aortic stenosis (n=33). We excluded persons with these clinical conditions because they are associated with low blood pressure. After these exclusions, 3095 subjects (1445 men and 1650 women) with genotyping of the ACE D/I polymorphism were eligible for the present study.

Measurements
Information regarding blood pressure and other clinical characteristics was obtained at study entry (baseline) and at each follow-up examination, including the index examination. Systolic and diastolic blood pressure values were the means of two physician-obtained measurements (recorded >=5 minutes apart) determined by the first and the fifth Korotkoff phases, respectively, in the left arm of the seated subject with a mercury column sphygmomanometer. The pulse pressure was the difference between the systolic and diastolic blood pressures. Body height and weight were used to calculate body mass index (weight in kilograms divided by height in meters squared). Data were collected on clinical variables including age, cigarette smoking, alcohol consumption, blood glucose concentration and the presence of diabetes, ischemic heart disease, and antihypertensive drug therapy.

Definitions of Hypertension
Hypertension was defined as systolic blood pressure of >=140 mm Hg or diastolic blood pressure of >=90 mm Hg or current use of antihypertensive medication.19 In a secondary analysis, moderate to severe hypertension was defined as systolic blood pressure of >=160 mm Hg or diastolic blood pressure of >=100 mm Hg or use of two or more antihypertensive medications.

Determination of the ACE Genotype
The methods of DNA extraction, amplification, and determination of the ACE genotype have been described previously.20 DNA was extracted from blood samples according to standard protocols.21 22 Briefly, 5 µL ({approx}5 to 20 ng) of genomic DNA was covered with oil, denatured at 95°C for 3 minutes, and cooled to 80°C before the addition of 10 µL of polymerase chain reaction (PCR) master mix23 containing 0.15 U of Taq DNA polymerase. The primers used, the thermocycling protocol, the approach to electrophoresis, the method for retesting of DD homozygotes and replicate scoring, and the procedures for quality control have been described previously.23

Determination of the Genotypes for the Human Growth Hormone (hGH) Gene Polymorphism
The highly polymorphic microsatellite associated with the hGH gene was also selected for study because of its close proximity to the ACE gene and the resultant low rate of recombination. The method of determination of the hGH microsatellite genotype has been described previously.20 The hGH genotype was determined in 1039 pairs of siblings. Genomic DNA was amplified during a 35-cycle, two-step PCR protocol (95°C for 15 seconds and 72°C for 2 minutes), with a reaction mix that differed from the one used for the determination of ACE genotype in the concentration of magnesium chloride (2.5 mmol/L), deoxynucleosidase triphosphates (200 µL each of adenosine triphosphate, cytidine triphosphate, thymidine triphosphate, and guanosine triphosphate), and primers (100 nmol/L). One of the two primers (sense, 5'ACTGCACTCCAGCCTCGGAGA GAG3'; reverse, 5'AGAGCAGGGGTGTGGTGCTACTC3') was labeled at the 5' end with [32P]{gamma}-ATP. Reaction products were resolved over sequencing gels containing 6% polyacrylamide, 8 mol/L urea, and 30% formamide and visualized by autoradiography. Parallel sequencing ladders were used for size standardization. Scoring was carried out as previously described.23

Statistical Methods and Association Analyses
Evidence for familial aggregation of quantitative blood pressure measures was demonstrated for diastolic blood pressure, systolic blood pressure, and pulse pressure by calculating intraclass correlations in pairs of siblings, consistent with previously published data from Framingham showing familial aggregation of hypertension.3 Next, we studied correlations among the quantitative blood pressure measures. There was a high correlation between systolic blood pressure and diastolic blood pressure (r=.63) and between systolic blood pressure and pulse pressure (r=.83), but there was a low correlation between diastolic blood pressure and pulse pressure (r=.09). Therefore, our primary quantitative variables were prespecified to be diastolic blood pressure and pulse pressure, although analyses were also conducted by using systolic blood pressure.

Because the prevalence of hypertension increases with age, all analyses were adjusted for age. The age-adjusted analyses were performed separately for men and women. The prevalence of hypertension was compared among the three ACE genotypes (DD, DI, and II). With multivariable unconditional logistic regression,24 analyses were performed to compare the prevalence of hypertension among the three ACE genotypes and the prevalence of moderate to severe hypertension among the three ACE genotypes (reference group, II genotype). Analyses were performed without and with adjustment for other covariates (body mass index, diabetes mellitus, cigarette smoking, alcohol consumption, and the presence of ischemic heart disease). A {chi}2 test statistic was calculated to compare for differences among the three genotypes. With multiple linear regression,25 the mean values of diastolic blood pressure and pulse pressure were compared among subjects with the DD, DI, and II genotypes. Linear regression analyses were performed without and with other covariates (use of antihypertensive treatment, body mass index, diabetes mellitus, cigarette smoking, alcohol consumption, and the presence of ischemic heart disease). Because family members are more likely to share identical alleles than randomly selected subjects, we repeated the analyses by using generalized estimating equations to account for the possible nonindependence of blood pressure observations.26 For the association of ACE D/I with dichotomous (hypertension) and continuous (blood pressure) measures, secondary analyses were carried out to test for dominant, recessive, and additive modes of inheritance.

The SAS System (Release 11, SAS Institute Inc, Cary, NC) was used to perform all statistical analysis with the procedures REG and LOGISTIC.27 All statistical tests were two sided, and a value of P<.05 was considered statistically significant.

Linkage Analyses
Linkage analysis to investigate the linkage of the ACE D/I polymorphism and blood pressure was performed on 484 families with at least two siblings (329, 107, 33, 9, 5 families, and 1 family with 2, 3, 4, 5, 6, and 7 siblings, respectively). These families contained a total of 1044 sibling pairs available for analysis. Linkage analysis was performed on 1039 sibling pairs who also had hGH genotyping. Quantitative trait sib-pair analyses of the ACE and hGH genotypes were performed separately for each of the continuous measures, diastolic blood pressure and pulse pressure, and for the deviance residuals of the dichotomous hypertension variable. The SAGE SIBPAL programs were used to perform all linkage analyses.28

Linkage was evaluated by the regression of the squared sib-pair difference on the estimated proportion of alleles shared by the sib-pair at the ACE or hGH locus. We estimated the regression coefficient, ß1, as follows: ß1=-2(1 to 2{theta})2 {varsigma}2, where {theta} is the recombination frequency between the marker locus and the trait, and {varsigma}2 is the genetic variance of the trait. ß1 is 0 if {theta} equals 0.5 (no linkage) or {varsigma}2 equals 0 (no genetic variance), and ß1 will be negative if {theta} is <0.5 and {varsigma}2 is >0. Sex-specific linkage analyses were also performed. The regression models for continuous blood pressure measures were adjusted for age, body mass index, diabetes mellitus, cigarette smoking, alcohol consumption, the presence of ischemic heart disease, and use of antihypertensive treatment; models for the dichotomous hypertension variable did not include antihypertensive treatment as a covariate.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Clinical Characteristics and ACE Genotype Allele Frequencies
The overall frequencies of the genotypes DD, DI, and II were 30.3, 49.8, and 19.9, respectively, in men and 29.8, 51.2, and 19.0, respectively, in women. The individual allele frequencies for D and I were 55.3 and 44.7, respectively, in the entire sample. The observed genotype frequencies are in agreement with frequencies predicted by Hardy-Weinberg equilibrium. In further analyses restricted to one member per nuclear family, genotype frequencies did not differ from those in the overall group.

Intraclass (sibling-sibling) correlation coefficients were calculated with generalized estimating equations. These coefficients were 0.12, 0.10, and 0.13 for systolic blood pressure, diastolic blood pressure, and pulse pressure, respectively.

Table 1Down summarizes the clinical characteristics of men (n=1445) and women (n=1650) at the index examination according to ACE genotype. Body mass index, alcohol consumption, and the prevalence of ischemic heart disease and diabetes mellitus tended to be greater in men than in women. There were no significant differences among men or women across the three genotypes with regard to age, body mass index, presence of diabetes mellitus, cigarette smoking, alcohol consumption, or presence of ischemic heart disease. Among women, 1138 (69%) were postmenopausal and 115 (7%) were taking hormone replacement therapy. There were no significant differences among women in menopausal status across the three genotypes.


View this table:
[in this window]
[in a new window]
 
Table 1. Characteristics of Male and Female Subjects by ACE Genotype

Odds of Hypertension According to ACE Genotype
The prevalence of hypertension according to ACE genotypes at the time of DNA collection was evaluated in sex-stratified logistic regression analyses (Table 2Down). There were 689 men and 705 women with hypertension. In men, the age-adjusted odds ratio (OR) of hypertension in the DD and DI groups were 1.67 (95% confidence interval [CI], 1.21 to 2.31) and 1.19 (95% CI, 0.88 to 1.61), respectively (Table 2Down and Fig 1Down), with the II genotype used as the reference group ({chi}2 P=.004). After adjustment for other covariates (body mass index, diabetes mellitus, cigarette smoking, alcohol consumption, and the presence of ischemic heart disease), the ORs for hypertension were 1.59 (95% CI, 1.13 to 2.23) and 1.18 (95% CI, 0.87 to 1.62) for the DD and DI groups, respectively (P=.02). Secondary testing in men favored an additive (P=.006) or a recessive (P=.009) mode of inheritance. In women, there was no relation of ACE genotype with hypertension in either the unadjusted or adjusted models (Table 2Down and Fig 2Down). The multivariable adjusted ORs were 1.00 (95% CI, 0.70 to 1.44) and 0.78 (95% CI, 0.56 to 1.09) for the DD and DI groups, respectively (P=.14). The results of adjusted models with generalized estimating equations were not materially different (Table 2Down).


View this table:
[in this window]
[in a new window]
 
Table 2. Odds of the Presence of Hypertension in Men and Women by ACE Genotype



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Odds ratios for hypertension according to ACE genotype in men.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. Odds ratios for hypertension according to ACE genotype in women.

There were 276 men and 333 women with moderate to severe hypertension. In the secondary analysis of moderate to severe hypertension, the direction and magnitude of effect were consistent with an association of hypertension with ACE genotype in men but not women (see Figs 1Up and 2Up). For men, the adjusted ORs of DD and DI for moderate to severe hypertension were 1.43 (95% CI, 0.94 to 2.17) and 1.25 (95% CI, 0.85 to 1.85), but differences among genotypes were not statistically significant (P=.24). For women, the corresponding adjusted ORs for DD and DI were 1.06 (95% CI, 0.69 to 1.61) and 1.04 (95% CI, 0.71 to 1.52), respectively (P=.97).

Measured Blood Pressure According to ACE Genotype
In Table 3Down, blood pressure measures at the time of DNA collection are compared in unadjusted and multivariable models (adjusting for age, body mass index, diabetes mellitus, cigarette smoking, alcohol consumption, and the presence of ischemic heart disease) across the ACE genotypes. In men, there was a consistent and statistically significant increase in age-adjusted diastolic blood pressure with increasing number of D alleles: mean diastolic blood pressure was 81.6 (±0.5), 80.9 (±0.4), and 79.6 (±0.6) mm Hg for DD, DI, and II genotypes, respectively (P=.03). The association was no longer statistically significant after adjustment for use of antihypertensive treatment or other covariates (Table 3Down). The results of adjusted models with generalized estimating equations were not materially different (Table 3Down). Secondary tests for dominant, recessive, or additive modes of inheritance were of borderline statistical significance. There was no association of ACE genotype with pulse pressure or systolic blood pressure in men or with diastolic blood pressure, pulse pressure, or systolic blood pressure in women. There was no evidence for an interaction of age with ACE genotype (for diastolic blood pressure, P=.77 for men and P=.18 for women). The addition of menopausal status and use of hormone replacement therapy to the multivariable models for diastolic blood pressure, systolic blood pressure, and pulse pressure had a negligible effect on the calculated probability values.


View this table:
[in this window]
[in a new window]
 
Table 3. Diastolic Blood Pressure, Systolic Blood Pressure, and Pulse Pressure in Men and Women by ACE Genotype and Sex

Linkage Analyses
Quantitative trait sib-pair linkage analyses for the ACE and hGH genotypes were performed with blood pressure data at the time of DNA collection with adjustment for covariates (age, body mass index, diabetes mellitus, cigarette smoking, alcohol consumption, presence of ischemic heart disease, and use of antihypertensive treatment). These analyses provide support for linkage of ACE D/I with diastolic blood pressure. In SIBPAL linkage analyses restricted to male siblings only (n=271 male sibling pairs), there was evidence of linkage with diastolic blood pressure in men for ACE1=-1.34, P=.02) and hGH 1=-0.75, P=.04). There was no evidence of linkage with pulse pressure for either ACE or hGH. In analyses of siblings restricted to women only (n=274 female sibling pairs), there was no evidence of linkage between measures of blood pressure (diastolic or pulse pressure) and either ACE or hGH. In further sex-pooled linkage analyses with diastolic blood pressure (n=1044 total sibling pairs), the ß1 values were -0.984 (P=.003) for ACE and -0.423 (P=.03) for hGH, respectively.

For linkage analysis of ACE with hypertension status, the ß1 was -1.266 (P=.047) in the men-only analysis, 1.64 (P=.99) in the women-only analysis, and 0.415 (P=.87) in the sex-pooled analysis.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
In our large, population-based sample, the frequencies of the D and I alleles of ACE were similar to those reported in other Caucasian populations. We found consistent evidence in men but not in women of association and genetic linkage of the ACE genotype with diastolic blood pressure and of association with hypertension. There was a statistically significant increase in odds of hypertension with the ACE DD genotype, although there was no clear evidence for the precise mode of inheritance.

Hypertension is a complex trait, and among the many potential candidate genes that may mediate its expression are ACE as well as angiotensinogen and other factors related to the renin-angiotensin system. Although there is strong evidence from association and linkage studies that the ACE D allele accounts for almost half the variance in ACE plasma levels,29 30 31 32 there is controversy regarding the association of the ACE locus with blood pressure and hypertension. In humans, a positive association of the ACE D allele has been observed in some4 5 6 7 but not other8 9 10 11 12 13 case-control studies of hypertension. Among the negative case-control studies was a subgroup within the Family Heart Study consisting of 118 subjects with moderate to severe hypertension selected from the Framingham Heart Study.13 In our larger unselected sample, which included 276 men and 333 women with moderate to severe hypertension, we observed a possible but not statistically significant association of ACE D/I with moderate to severe hypertension in men but not women. Negative associations between ACE and blood pressure have also been reported in a number of case-control studies of persons with clinically evident coronary atherosclerosis or myocardial infarction.33 34 35 36 37 38 39 40 41 Although our study sample contained a small number of subjects with clinical evidence of ischemic heart disease, the odds of hypertension and of moderate-to-severe hypertension remained elevated after adjustment for potential confounding factors including the presence of ischemic heart disease.

The case-control design used in many candidate gene association studies is efficient for examination of disease hypotheses, but this methodology may be susceptible to selection bias if there is nonrandom ascertainment and selection of cases or control subjects. We have included all persons within a range of normal and abnormal blood pressures in our study cohort, and we have examined both subjects with and those without evidence of ischemic heart disease. In contrast, it is difficult to estimate in case-control studies the extent to which the case mix has excluded individuals who succumbed to hypertension-related morbidity (eg, stroke or renal failure) or mortality. In the Framingham Heart Study, the high prevalence of hypertension (45%) offers the opportunity to perform robust comparisons of cases and nonhypertensive control subjects in a large sample. In addition, because our sample is drawn from a population-based cohort, there may be less susceptibility to the types of bias that are inherent in case-control studies.

There are a limited number of sib-pair linkage studies relating the ACE gene with blood pressure or hypertension. Using the highly informative hGH microsatellite, there was no evidence of linkage between the ACE locus and hypertension in a population-based sample (n=169 sib-pairs)14 selected from Utah residents under age 60 years with a reported family history of early hypertension.30 Because all subjects were taking antihypertensive medication, linkage with blood pressure was not examined; furthermore, there were no reported sex differences.14 In contrast, in the 1044 sib-pairs from our study sample, we find consistent evidence of linkage between hGH (as well as ACE) and diastolic blood pressure. A recent study of 1488 siblings from a population-based cohort in Minnesota has also found similar evidence for linkage of the ACE gene region to interindividual variation in diastolic blood pressure as well as mean arterial pressure.42 Cases for the Utah cohort included subjects with moderate to severe hypertension,30 and it is possible that enrichment for this more severely hypertensive subgroup or inadvertent bias in selection of cases in the Utah cohort explain, in part, the absence of linkage in that sample. Population differences in genetic makeup or confounding environmental exposures are also plausible explanations.

Our data demonstrate that the ACE DD genotype is associated with increased risk for hypertension, and we provide supportive evidence that ACE is a sex-specific hypertension candidate gene. We emphasize that the existence of association and/or linkage between ACE and hypertension in a population-based sample is necessary but not sufficient evidence for a causal link between the ACE gene and hypertension. It is possible that hGH or other genes in linkage disequilibrium with ACE are responsible for the observed effects on blood pressure and hypertension. In particular, this possibility is raised by the evidence for linkage of hGH with diastolic blood pressure.

Our study provides evidence that the effect of the ACE locus may be male specific. The hypothesis that there are sex differences in the effect of ACE D/I on blood pressure is supported by gene-targeting experiments resulting in functional inactivation of the ACE gene in mice, in which the blood pressure effect predominates in males.15 16 In humans, there is limited evidence of the existence of a male-specific association between ACE levels and blood pressure.43 Although no male-specific effect was noted in previous studies reporting an association between the ACE genotype and blood pressure,4 5 6 7 Fornage et al42 have recently reported that genetic variation in the region of the ACE gene significantly influences interindividual variation in blood pressure in men but not women. The mechanism of this apparent sex specificity is uncertain. We found no evidence of a relation to menopausal status or use of estrogen replacement therapy. Also, in a previous study with direct measurements with M-mode echocardiography, we found no evidence of either association or linkage between ACE genotype and left ventricular hypertrophy in either men or women.20

Our data must be interpreted with caution regarding any potential clinical implications. In our population, the prevalence of the DD genotype is {approx}30% in men, in whom there was a 59% increased risk of hypertension after adjustment for common hypertension risk factors. Our study offers no convincing evidence for an incremental value of screening for ACE genotype compared with blood pressure screening. Because stroke, myocardial infarction, and renal failure are among the most serious sequelae of hypertension, our findings call for further investigation in large populations to clarify the uncertainty regarding the possible association of ACE with these cardiovascular diseases.

There are also other potential limitations to our study. It remains possible that we have not sufficiently controlled for confounding factors that might explain at least some of the residual associations noted in multivariate analyses. Adjustment was not made for dietary factors (salts, electrolytes) and personal habits such as exercise, which may influence blood pressure. It is possible that regression-dilution bias exists due to the use of a mean of only two readings to characterize blood pressure and hypertensive status.44 Furthermore, the categorization of hypertension status based on use of antihypertensive drugs may result in misclassification. However, both types of bias would be expected to reduce the magnitude of effect of the observed associations. It should also be noted that our study sample is largely Caucasian. There may be racial differences in ACE D/I allele frequencies, and in particular there may be little or no variation among black persons in the relation of ACE D/I to ACE levels.45 Thus caution should be exercised in extrapolating our findings to non-Caucasian populations. Although our study subjects were taken from a general population, we recognize that the presence or absence of an observed association in any ethnic, racial, or geographic population may be related to a number of other factors including gene-gene interactions and gene-environment interactions.

In conclusion, in our large, population-based sample, there is an association of the ACE locus with hypertension and with blood pressure level in men but not women, and these associations are further supported by evidence of linkage. Our data support the hypothesis that ACE, or a nearby gene, is a sex-specific candidate gene for hypertension. The discrepancy between our population-based data and those of smaller case-control studies supports the need for further confirmatory studies of association and linkage in large population-based samples.


*    Acknowledgments
 
This work was supported by a Research Career Development Award (K04-HL-03138–01) from the National Heart, Lung, and Blood Institute and by a contract with the National Institutes of Health (N01-HC-38038). Laboratory work was supported through NIH/NHLBI grant HL-54776 and contract 53–3K06–5-10 from the US Department of Agriculture Research Service. The program package SAGE was supported by a US Public Health Service Research Grant (1 P41 RR03655) from the Division of Research Resources.


*    Footnotes
 
Guest editor for this article was Suzanne Oparil, MD, University of Alabama at Birmingham.

Received October 8, 1997; revision received December 27, 1997; accepted January 9, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Stamler J, Stamler R, Neaton JD. Blood pressure, systolic and diastolic, and cardiovascular risks: US population data. Arch Intern Med. 1993;153:598–615.[Abstract/Free Full Text]

2. Whelton PK. Epidemiology of hypertension. Lancet. 1994;344:101–106.[Medline] [Order article via Infotrieve]

3. Havlik RJ, Garrison RJ, Feinleib M, Kannel WB, Castelli WP, McNamara PM. Blood pressure aggregation in families. Am J Epidemiol. 1979;110:304–312.[Abstract/Free Full Text]

4. Barley J, Blackwood A, Miller M, Markandu ND, Carter ND, Jeffery S, Cappuccio FP, MacGregor GA, Sagnella GA. Angiotensin converting enzyme gene I/D polymorphism, blood pressure and the renin-angiotensin system in Caucasian and Afro-Caribbean peoples. J Hum Hypertens. 1996;10:31–35.[Medline] [Order article via Infotrieve]

5. Duru K, Farrow S, Wang JM, Lockette W, Kurtz T. Frequency of a deletion polymorphism in the gene for angiotensin converting enzyme is increased in African-Americans with hypertension. Am J Hypertens. 1994;7:759–762.[Medline] [Order article via Infotrieve]

6. Morise T, Takeuchi Y, Takeda R. Angiotensin-converting enzyme polymorphism and essential hypertension. Lancet. 1994;343:125.

7. Zee RY, Lou YK, Griffiths LR, Morris BJ. Association of a polymorphism of the angiotensin I-converting enzyme gene with essential hypertension. Biochem Biophys Res Commun. 1992;184:9–15.[Medline] [Order article via Infotrieve]

8. Vassilikioti S, Doumas M, Douma S, Petidis K, Karagiannis A, Balaska K, Vyzantiadis A, Zamboulis C. Angiotensin converting enzyme gene polymorphism is not related to essential hypertension in a Greek population. Am J Hypertens. 1996;9:700–702.[Medline] [Order article via Infotrieve]

9. Schmidt S, van Hooft IM, Grobbee DE, Ganten D, Ritz E. Polymorphism of the angiotensin I converting enzyme gene is apparently not related to high blood pressure: Dutch Hypertension and Offspring Study. J Hypertens. 1993;11:345–348.[Medline] [Order article via Infotrieve]

10. Higashimori K, Zhao Y, Higaki J, Kamitani A, Katsuya T, Nakura J, Miki T, Mikami H, Ogihara T. Association analysis of a polymorphism of the angiotensin converting enzyme gene with essential hypertension in the Japanese population. Biochem Biophys Res Commun. 1993;191:399–404.[Medline] [Order article via Infotrieve]

11. Harrap SB, Davidson HR, Connor JM, Soubrier F, Corvol P, Fraser R, Foy CJ, Watt GC. The angiotensin I converting enzyme gene and predisposition to high blood pressure. Hypertension. 1993;21:455–460.[Abstract/Free Full Text]

12. Kiema TR, Kauma H, Rantala AO, Lilja M, Reunanen A, Kesaniemi YA, Savolainen MJ. Variation at the angiotensin-converting enzyme gene and angiotensinogen gene loci in relation to blood pressure. Hypertension. 1996;28:1070–1075.[Abstract/Free Full Text]

13. Borecki IB, Province MA, Ludwig EH, Ellison RC, Folsom AR, Heiss G, Lalouel JM, Higgins M, Rao DC. Associations of candidate loci angiotensinogen and angiotensin-converting enzyme with severe hypertension: the NHLBI Family Heart Study. Ann Epidemiol. 1997;7:13–21.[Medline] [Order article via Infotrieve]

14. Jeunemaitre X, Lifton RP, Hunt SC, Williams RR, Laloue JM. Absence of linkage between the angiotensin converting enzyme locus and human essential hypertension. Nat Genet. 1992;1:72–75.[Medline] [Order article via Infotrieve]

15. Esther CR Jr, Howard TE, Marino EM, Goddard JM, Capecchi MR, Bernstein KE. Mice lacking angiotensin-converting enzyme have low blood pressure, renal pathology, and reduced male fertility. Lab Invest. 1996;74:953–965.[Medline] [Order article via Infotrieve]

16. Krege JH, John SW, Langenbach LL, Hodgin JB, Hagaman JR, Bachman ES, Jennette JC, O'Brien DA, Smithies O. Male-female differences in fertility and blood pressure in ACE-deficient mice. Nature. 1995;375:146–148.[Medline] [Order article via Infotrieve]

17. Dawber TR, Meadors GF, Moore FEJ. Epidemiological approaches to heart disease: the Framingham Study. Am J Public Health. 1951;41:279–286.

18. Kannel WB, Feinleib M, McNamara PM, Garrison RJ, Castelli WP. An investigation of coronary heart disease in families: the Framingham Offspring Study. Am J Epidemiol. 1979;110:281–290.[Abstract/Free Full Text]

19. Anonymous. The fifth report of the Joint National Committee on Detection, Evaluation, and Treatment of High Blood Pressure (JNC V). Arch Intern Med. 1993;153:154–183.[Abstract/Free Full Text]

20. Lindpaintner K, Lee M, Larson MG, Rao VS, Pfeffer MA, Ordovas JM, Schaefer EJ, Wilson AF, Wilson PW, Vasan RS, Myers RH, Levy D. Absence of association or genetic linkage between the angiotensin-converting-enzyme gene and left ventricular mass. N Engl J Med. 1996;334:1023–1028.[Abstract/Free Full Text]

21. Gross-Bellard M, Oudet P, Chambon P. Isolation of high-molecular-weight DNA from mammalian cells. Eur J Biochem. 1973;36:32–38.[Medline] [Order article via Infotrieve]

22. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16:1215.[Free Full Text]

23. Lindpaintner K, Pfeffer MA, Kreutz R, Stampfer MJ, Grodstein F, LaMotte F, Buring J, Hennekens CH. A prospective evaluation of an angiotensin-converting enzyme gene polymorphism and the risk of ischemic heart disease. N Engl J Med. 1995;332:706–711.[Abstract/Free Full Text]

24. Hosmer DW, Lemeshow S. Applied Logistic Regression. New York, NY: Wiley; 1989:25–175.

25. Kleinbaum DG, Kupper LL, Muller KE. Applied Regression Analysis and Other Multivariable Methods. Boston, Mass: PWS-Kent Publishing Co; 1988:102–340.

26. Liang KY, Zeger SL. Longitudinal data analysis using generalized estimating linear models. Biometrika. 1986;73:12–22.

27. SAS Institute Inc. SAS/STAT User's Guide. 4th ed. 1989:1071–1126, 1351–1456.

28. SAGE, Statistical Analysis for Genetic Epidemiology. Release 2.1, SIBPAL version 2.5. Department of Epidemiology and Biostatistics, Rammelkamp Center for Education and Research, Metro Health Campus, Case Western Reserve University, Cleveland, Ohio; 1991.

29. Tiret L, Rigat B, Visvikis S, Breda C, Corvol P, Cambien F, Soubrier F. Evidence from combined segregation and linkage analysis that a variant of the angiotensin I-converting enzyme (ACE) gene controls plasma ACE levels. Am J Hum Genet. 1992;51:197–205.[Medline] [Order article via Infotrieve]

30. Williams RR, Hunt SC, Hopkins PN, Stults BM, Wu LL, Hasstedt SJ, Barlow GK, Stephenson SH, Lalouel JM, Kuida H. Familial dyslipidemic hypertension: evidence from 58 Utah families for a syndrome present in approximately 12% of patients with essential hypertension. JAMA. 1988;259:3579–3586.[Abstract/Free Full Text]

31. Busjahn A, Knoblauch H, Knoblauch M, Bohlender J, Menz M, Faulhaber HD, Becker A, Schuster H, Luft FC. Angiotensin-converting enzyme and angiotensinogen gene polymorphisms, plasma levels, cardiac dimensions: a twin study. Hypertension. 1997;29:165–170.[Abstract/Free Full Text]

32. McKenzie CA, Julier C, Forrester T, McFarlane-Anderson N, Keavney B, Lathrop GM, Ratcliffe PJ, Farrall M. Segregation and linkage analysis of serum angiotensin I-converting enzyme levels: evidence for two quantitative-trait loci. Am J Hum Genet. 1995;57:1426–1435.[Medline] [Order article via Infotrieve]

33. Cambien F, Costerousse O, Tiret L, Poirier O, Lecerf L, Gonzales MF, Evans A, Arveiler D, Cambou JP, Luc G, Rakotovao R, Ducimetiere P, Soubrier F, Alhenc-Gelas F. Plasma level and gene polymorphism of angiotensin-converting enzyme in relation to myocardial infarction. Circulation. 1994;90:669–676.[Abstract/Free Full Text]

34. Cambien F, Poirier O, Lecerf L, Evans A, Cambou JP, Barnes R, Luc G, Bard JM, Bara L, Ricard S, Tiret L, Amouyel P, Alhenc-Gelas F, Soubrier F. Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature. 1992;359:641–644.[Medline] [Order article via Infotrieve]

35. Gardemann A, Weiss T, Schwartz O, Eberbach A, Katz N, Hehrlein FW, Tillmanns H, Waas W, Haberbosch W. Gene polymorphism but not catalytic activity of angiotensin I-converting enzyme is associated with coronary artery disease and myocardial infarction in low-risk patients. Circulation. 1995;92:2796–2799.[Abstract/Free Full Text]

36. Ludwig E, Corneli PS, Anderson JL, Marshall HW, Lalouel JM, Ward RH. Angiotensin-converting enzyme gene polymorphism is associated with myocardial infarction but not with development of coronary stenosis. Circulation. 1995;91:2120–2124.[Abstract/Free Full Text]

37. Mattu RK, Needham EW, Galton DJ, Frangos E, Clark AJ, Caulfield M. A DNA variant at the angiotensin-converting enzyme gene locus associates with coronary artery disease in the Caerphilly Heart Study. Circulation. 1995;91:270–274.[Abstract/Free Full Text]

38. Nakai K, Itoh C, Miura Y, Hotta K, Musha T, Itoh T, Miyakawa T, Iwasaki R, Hiramori K. Deletion polymorphism of the angiotensin I-converting enzyme gene is associated with serum ACE concentration and increased risk for CAD in the Japanese. Circulation. 1994;90:2199–2202.[Abstract/Free Full Text]

39. Nakauchi Y, Suehiro T, Yamamoto M, Yasuoka N, Arii K, Kumon Y, Hamashige N, Hashimoto K. Significance of angiotensin I-converting enzyme and angiotensin II type 1 receptor gene polymorphisms as risk factors for coronary heart disease. Atherosclerosis. 1996;125:161–169.[Medline] [Order article via Infotrieve]

40. Tarnow L, Cambien F, Rossing P, Nielsen FS, Hansen BV, Lecerf L, Poirier O, Danilov S, Boelskifte S, Borch-Johnsen K. Insertion/deletion polymorphism in the angiotensin-I-converting enzyme gene is associated with coronary heart disease in IDDM patients with diabetic nephropathy. Diabetologia. 1995;38:798–803.[Medline] [Order article via Infotrieve]

41. Winkelmann BR, Nauck M, Klein B, Russ AP, Bohm BO, Siekmeier R, Ihnken K, Verho M, Gross W, Marz W. Deletion polymorphism of the angiotensin I-converting enzyme gene is associated with increased plasma angiotensin-converting enzyme activity but not with increased risk for myocardial infarction and coronary artery disease. Ann Intern Med. 1996;125:19–25.[Abstract/Free Full Text]

42. Fornage M, Amos CI, Kardia S, Sing CF, Turner ST, Boerwinkle E. Variation in the region of the angiotensin-converting enzyme gene influences interindividual differences in blood pressure levels in young white males. Circulation. 1998;97:1773–1779.[Abstract/Free Full Text]

43. Schunkert H, Hense HW, Muscholl M, Luchner A, Riegger GA. Association of angiotensin converting enzyme activity and arterial blood pressure in a population-based sample. J Hypertens. 1996;14:571–575.[Medline] [Order article via Infotrieve]

44. MacMahon S, Peto R, Cutler J, Collins R, Sorlie P, Neaton J, Abbott R, Godwin J, Dyer A, Stamler J. Blood pressure, stroke, and coronary heart disease, I: prolonged differences in blood pressure: prospective observational studies corrected for the regression dilution bias. Lancet. 1990;335:765–774.[Medline] [Order article via Infotrieve]

45. Bloem LJ, Manatunga AK, Pratt JH. Racial difference in the relationship of an angiotensin I-converting enzyme gene polymorphism to serum angiotensin I-converting enzyme activity. Hypertension. 1996;27:62–66.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
V. Ramachandran, P. Ismail, J. Stanslas, N. Shamsudin, S. Moin, and R. Mohd Jas
Association of insertion/deletion polymorphism of angiotensin-converting enzyme gene with essential hypertension and type 2 diabetes mellitus in Malaysian subjects
Journal of Renin-Angiotensin-Aldosterone System, December 1, 2008; 9(4): 208 - 214.
[Abstract] [PDF]


Home page
HypertensionHome page
R. Coimbra, L. S. Sanchez, J. M. Potenza, L. V. Rossoni, S. L. Amaral, and L. C. Michelini
Is Gender Crucial for Cardiovascular Adjustments Induced by Exercise Training in Female Spontaneously Hypertensive Rats?
Hypertension, September 1, 2008; 52(3): 514 - 521.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
C. Moreno, M. L. Kaldunski, T. Wang, R. J. Roman, A. S. Greene, J. Lazar, H. J. Jacob, and A. W. Cowley Jr.
Multiple blood pressure loci on rat chromosome 13 attenuate development of hypertension in the Dahl S hypertensive rat
Physiol Genomics, October 19, 2007; 31(2): 228 - 235.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
E.-C. Langberg, H. F Gu, S. Nordman, S. Efendic, and C.-G. Ostenson
Genetic variation in receptor protein tyrosine phosphatase {sigma} is associated with type 2 diabetes in Swedish Caucasians
Eur. J. Endocrinol., October 1, 2007; 157(4): 459 - 464.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
P. Rivera, M. P. Ocaranza, S. Lavandero, and J. E. Jalil
Rho Kinase Activation and Gene Expression Related to Vascular Remodeling in Normotensive Rats With High Angiotensin I Converting Enzyme Levels
Hypertension, October 1, 2007; 50(4): 792 - 798.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
M. Nakhjavani, F. Esfahanian, A. Jahanshahi, A. Esteghamati, A. R. Nikzamir, A. Rashidi, and M. Zahraei
The relationship between the insertion/deletion polymorphism of the ACE gene and hypertension in Iranian patients with type 2 diabetes
Nephrol. Dial. Transplant., September 1, 2007; 22(9): 2549 - 2553.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
N. A. Patsopoulos, A. Tatsioni, and J. P. A. Ioannidis
Claims of Sex Differences: An Empirical Assessment in Genetic Associations
JAMA, August 22, 2007; 298(8): 880 - 893.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
Y. Wang, Y. Zheng, W. Zhang, H. Yu, K. Lou, Y. Zhang, Q. Qin, B. Zhao, Y. Yang, and R. Hui
Polymorphisms of KDR Gene Are Associated With Coronary Heart Disease
J. Am. Coll. Cardiol., August 21, 2007; 50(8): 760 - 767.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
D. K. Arnett, A. E. Baird, R. A. Barkley, C. T. Basson, E. Boerwinkle, S. K. Ganesh, D. M. Herrington, Y. Hong, C. Jaquish, D. A. McDermott, et al.
Relevance of Genetics and Genomics for Prevention and Treatment of Cardiovascular Disease: A Scientific Statement From the American Heart Association Council on Epidemiology and Prevention, the Stroke Council, and the Functional Genomics and Translational Biology Interdisciplinary Working Group
Circulation, June 5, 2007; 115(22): 2878 - 2901.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
T. Nakayama, N. Kuroi, M. Sano, Y. Tabara, T. Katsuya, T. Ogihara, Y. Makita, A. Hata, M. Yamada, N. Takahashi, et al.
Mutation of the Follicle-Stimulating Hormone Receptor Gene 5'-Untranslated Region Associated With Female Hypertension
Hypertension, September 1, 2006; 48(3): 512 - 518.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
N. Franceschini, J. W. MacCluer, H. H.H. Goring, S. A. Cole, K. M. Rose, L. Almasy, V. Diego, S. Laston, E. T. Lee, B. V. Howard, et al.
A Quantitative Trait Loci-Specific Gene-by-Sex Interaction on Systolic Blood Pressure Among American Indians: The Strong Heart Family Study
Hypertension, August 1, 2006; 48(2): 266 - 270.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. Gu, S. Su, D. Ge, S. Chen, J. Huang, B. Li, R. Chen, and B. Qiang
Association Study With 33 Single-Nucleotide Polymorphisms in 11 Candidate Genes for Hypertension in Chinese
Hypertension, June 1, 2006; 47(6): 1147 - 1154.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Y. Wang, W. Zhang, Y. Zhang, Y. Yang, L. Sun, S. Hu, J. Chen, C. Zhang, Y. Zheng, Y. Zhen, et al.
VKORC1 Haplotypes Are Associated With Arterial Vascular Diseases (Stroke, Coronary Heart Disease, and Aortic Dissection)
Circulation, March 28, 2006; 113(12): 1615 - 1621.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
K. Skov, J. K. Madsen, H. E. Hansen, L. Zagato, E. Frandsen, G. Bianchi, and M. J. Mulvany
Renal Haemodynamics are not Related to Genotypes in Offspring of Parents with Essential Hypertension
Journal of Renin-Angiotensin-Aldosterone System, March 1, 2006; 7(1): 47 - 55.
[Abstract] [PDF]


Home page
HypertensionHome page
J. E. Jalil, A. Perez, M. P. Ocaranza, J. Bargetto, A. Galaz, and S. Lavandero
Increased Aortic NADPH Oxidase Activity in Rats With Genetically High Angiotensin-Converting Enzyme Levels
Hypertension, December 1, 2005; 46(6): 1362 - 1367.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
Chunlan Yan, Jinbiao Zhan, and Weihong Feng
Gene Polymorphisms of Angiotensin II Type 1 Receptor and Angiotensin-Converting Enzyme in Two Ethnic Groups Living in Zhejiang Province, China
Journal of Renin-Angiotensin-Aldosterone System, September 1, 2005; 6(3): 132 - 137.
[Abstract] [PDF]


Home page
Hum Mol GenetHome page
P. Catarsi, R. Ravazzolo, F. Emma, D. Fruci, L. Finos, A. Frau, G. Morreale, A. Carrea, and G. M. Ghiggeri
Angiotensin-converting enzyme (ACE) haplotypes and cyclosporine A (CsA) response: a model of the complex relationship between ACE quantitative trait locus and pathological phenotypes
Hum. Mol. Genet., August 15, 2005; 14(16): 2357 - 2367.
[Abstract] [Full Text] [PDF]


Home page
Alcohol AlcoholHome page
M. BEDNARSKA-MAKARUK, M. RODO, C. MARKUSZEWSKI, A. ROZENFELD, M. SWIDERSKA, B. HABRAT, and H. WEHR
POLYMORPHISMS OF APOLIPOPROTEIN E AND ANGIOTENSIN-CONVERTING ENZYME GENES AND CAROTID ATHEROSCLEROSIS IN HEAVY DRINKERS
Alcohol Alcohol., July 1, 2005; 40(4): 274 - 282.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
M R Abdollahi, T R Gaunt, H E Syddall, C Cooper, D I W Phillips, S Ye, and I N M Day
Angiotensin II type I receptor gene polymorphism: anthropometric and metabolic syndrome traits
J. Med. Genet., May 1, 2005; 42(5): 396 - 401.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
Y. Wang, M. C.Y. Ng, W. Y. So, P. C.Y. Tong, R. C.W. Ma, C. C. Chow, C. S. Cockram, and J. C.N. Chan
Prognostic Effect of Insertion/Deletion Polymorphism of the ACE Gene on Renal and Cardiovascular Clinical Outcomes in Chinese Patients With Type 2 Diabetes
Diabetes Care, February 1, 2005; 28(2): 348 - 354.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
J A Lamb, G Barnby, E Bonora, N Sykes, E Bacchelli, F Blasi, E Maestrini, J Broxholme, J Tzenova, D Weeks, et al.
Analysis of IMGSAC autism susceptibility loci: evidence for sex limited and parent of origin specific effects
J. Med. Genet., February 1, 2005; 42(2): 132 - 137.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J. V. Gainer, A. Bellamine, E. P. Dawson, K. E. Womble, S. W. Grant, Y. Wang, L. A. Cupples, C.-Y. Guo, S. Demissie, C. J. O'Donnell, et al.
Functional Variant of CYP4A11 20-Hydroxyeicosatetraenoic Acid Synthase Is Associated With Essential Hypertension
Circulation, January 4, 2005; 111(1): 63 - 69.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
L. Lin, L. Finn, J. Zhang, T. Young, and E. Mignot
Angiotensin-converting Enzyme, Sleep-disordered Breathing, and Hypertension
Am. J. Respir. Crit. Care Med., December 15, 2004; 170(12): 1349 - 1353.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. N. M. Day, X.-h. Chen, T. R. Gaunt, T. H. T. King, A. Voropanov, S. Ye, S. Rodriguez, H. E. Syddall, A. A. Sayer, E. M. Dennison, et al.
Late Life Metabolic Syndrome, Early Growth, and Common Polymorphism in the Growth Hormone and Placental Lactogen Gene Cluster
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5569 - 5576.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. Katzov, A. M. Bennet, P. Kehoe, B. Wiman, M. Gatz, K. Blennow, B. Lenhard, N. L. Pedersen, U. de Faire, and J. A. Prince
A cladistic model of ACE sequence variation with implications for myocardial infarction, Alzheimer disease and obesity
Hum. Mol. Genet., November 1, 2004; 13(21): 2647 - 2657.
[Abstract] [Full Text] [PDF]


Home page
Vasc MedHome page
A. Karagiannis, K. Balaska, K. Tziomalos, T. Gerasimidis, D. Karamanos, A. Papayeoryiou, and C. Zamboulis
Lack of an association between angiotensin converting enzyme gene polymorphism and peripheral arterial occlusive disease
Vascular Medicine, August 1, 2004; 9(3): 189 - 192.
[Abstract] [PDF]


Home page
DiabetesHome page
H. F. Gu, S. Efendic, S. Nordman, C.-G. Ostenson, K. Brismar, A. J. Brookes, and J. A. Prince
Quantitative Trait Loci Near the Insulin-Degrading Enzyme (IDE) Gene Contribute to Variation in Plasma Insulin Levels
Diabetes, August 1, 2004; 53(8): 2137 - 2142.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
C. Newton-Cheh and C. J. O'Donnell
Sex Differences and Genetic Associations With Myocardial Infarction
JAMA, June 23, 2004; 291(24): 3008 - 3010.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. E. Safar, M. Lajemi, A. Rudnichi, R. Asmar, and A. Benetos
Angiotensin-Converting Enzyme D/I Gene Polymorphism and Age-Related Changes in Pulse Pressure in Subjects with Hypertension
Arterioscler Thromb Vasc Biol, April 1, 2004; 24(4): 782 - 786.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
E. J. Samelson, D. P. Kiel, K. E. Broe, Y. Zhang, L. A. Cupples, M. T. Hannan, P. W. F. Wilson, D. Levy, S. A. Williams, and V. Vaccarino
Metacarpal Cortical Area and Risk of Coronary Heart Disease: The Framingham Study
Am. J. Epidemiol., March 15, 2004; 159(6): 589 - 595.
[Abstract] [Full Text] [PDF]


Home page
ANGIOLOGYHome page
D. Petrovic, D. Bregar, B. Guzic-Salobir, E. Skof, M. Span, R. Terzic, M. G. Petrovic, I. Keber, M. Letonja, M. Zorc, et al.
Sex Difference in the Effect of ACE-DD Genotype on the Risk of Premature Myocardial Infarction
Angiology, March 1, 2004; 55(2): 155 - 158.
[Abstract] [PDF]


Home page
HypertensionHome page
S. Levesque, J.-M. Moutquin, C. Lindsay, M.-C. Roy, and F. Rousseau
Implication of an AGT Haplotype in a Multigene Association Study With Pregnancy Hypertension
Hypertension, January 1, 2004; 43(1): 71 - 78.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
I Narita, S Goto, N Saito, J Song, K Omori, D Kondo, M Sakatsume, and F Gejyo
Renoprotective efficacy of renin-angiotensin inhibitors in IgA nephropathy is influenced by ACE A2350G polymorphism
J. Med. Genet., December 1, 2003; 40(12): e130 - 130.
[Full Text]


Home page
Physiol. GenomicsHome page
C. Moreno, P. Dumas, M. L. Kaldunski, P. J. Tonellato, A. S. Greene, R. J. Roman, Q. Cheng, Z. Wang, H. J. Jacob, and A. W. Cowley Jr
Genomic map of cardiovascular phenotypes of hypertension in female Dahl S rats
Physiol Genomics, November 11, 2003; 15(3): 243 - 257.
[Abstract] [Full Text] [PDF]


Home page
ANN INTERN MEDHome page
S. Oparil, M. A. Zaman, and D. A. Calhoun
Pathogenesis of Hypertension
Ann Intern Med, November 4, 2003; 139(9): 761 - 776.
[Full Text] [PDF]


Home page
HypertensionHome page
N. Kosachunhanun, S. C. Hunt, P. N. Hopkins, R. R. Williams, X. Jeunemaitre, P. Corvol, C. Ferri, R. M. Mortensen, N. K. Hollenberg, and G. H. Williams
Genetic Determinants of Nonmodulating Hypertension
Hypertension, November 1, 2003; 42(5): 901 - 908.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. A. Haiman, S. O. Henderson, P. Bretsky, L. N. Kolonel, and B. E. Henderson
Genetic Variation in Angiotensin I-Converting Enzyme (ACE) and Breast Cancer Risk: The Multiethnic Cohort
Cancer Res., October 15, 2003; 63(20): 6984 - 6987.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
X. Zhu, Y.-P. C. Chang, D. Yan, A. Weder, R. Cooper, A. Luke, D. Kan, and A. Chakravarti
Associations Between Hypertension and Genes in the Renin-Angiotensin System
Hypertension, May 1, 2003; 41(5): 1027 - 1034.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
C. M. Kammerer, D. L. Rainwater, J. L. Schneider, L. A. Cox, M. C. Mahaney, J. Rogers, and J. F. VandeBerg
Two Loci Affect Angiotensin I-Converting Enzyme Activity in Baboons
Hypertension, March 1, 2003; 41(3): 854 - 859.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
C. Barlassina, C. Lanzani, P. Manunta, and G. Bianchi
Genetics of Essential Hypertension: From Families to Genes
J. Am. Soc. Nephrol., November 1, 2002; 13(90003): S155 - 164.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
R. D. Hockett, S. C. Kirkwood, B. H. Mitlak, and W. H. Dere
Pharmacogenomics in Endocrinology
J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2495 - 2499.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Fischer, A. Baessler, and H. Schunkert
Renin angiotensin system and gender differences in the cardiovascular system
Cardiovasc Res, February 15, 2002; 53(3): 672 - 677.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
N J Mayer, A Forsyth, S Kantachuvesiri, J J Mullins, and S Fleming
Association of the D allele of the angiotensin I converting enzyme polymorphism with malignant vascular injury
Mol. Pathol., February 1, 2002; 55(1): 29 - 33.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
C. Sierra, A. Coca, E. Gomez-Angelats, E. Poch, J. Sobrino, and A. de la Sierra
Renin-Angiotensin System Genetic Polymorphisms and Cerebral White Matter Lesions in Essential Hypertension
Hypertension, February 1, 2002; 39(2): 343 - 347.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S-Y Wu, C S J Fann, Y-S Jou, J-W Chen, and W-H Pan
Association between markers in chromosomal region 17q23 and young onset hypertension: a TDT study
J. Med. Genet., January 1, 2002; 39(1): 42 - 44.
[Full Text] [PDF]


Home page
HypertensionHome page
E. Poch, D. Gonzalez, V. Giner, E. Bragulat, A. Coca, and A. de la Sierra
Molecular Basis of Salt Sensitivity in Human Hypertension: Evaluation of Renin-Angiotensin-Aldosterone System Gene Polymorphisms
Hypertension, November 1, 2001; 38(5): 1204 - 1209.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
K. Ranade, K.-D. Wu, C.-M. Hwu, C.-T. Ting, D. Pei, R. Pesich, J. Hebert, Y.-D. I. Chen, R. Pratt, R. Olshen, et al.
Genetic variation in the human urea transporter-2 is associated with variation in blood pressure
Hum. Mol. Genet., September 1, 2001; 10(19): 2157 - 2164.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
C. Oliveri, M. P. Ocaranza, X. Campos, S. Lavandero, and J. E. Jalil
Angiotensin I-Converting Enzyme Modulates Neutral Endopeptidase Activity in the Rat
Hypertension, September 1, 2001; 38(3): 650 - 654.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
A Jeron, C Hengstenberg, S Engel, H Lowel, G.A.J Riegger, H Schunkert, and S Holmer
The D-allele of the ACE polymorphism is related to increased QT dispersion in 609 patients after myocardial infarction
Eur. Heart J., April 2, 2001; 22(8): 663 - 668.
[Abstract] [PDF]


Home page
Drug Metab. Dispos.Home page
F. C. Luft
Molecular Genetics of Salt-Sensitivity and Hypertension
Drug Metab. Dispos., April 1, 2001; 29(4): 500 - 504.
[Abstract] [Full Text]


Home page
Am. J. Respir. Crit. Care Med.Home page
R. J. van SUYLEN, W. M. AARTSEN, J. F. M. SMITS, and M. J. A. P. DAEMEN
Dissociation of Pulmonary Vascular Remodeling and Right Ventricular Pressure in Tissue Angiotensin-converting Enzyme-deficient Mice Under Conditions of Chronic Alveolar Hypoxia
Am. J. Respir. Crit. Care Med., April 1, 2001; 163(5): 1241 - 1245.
[Abstract] [Full Text]


Home page
J. Am. Soc. Nephrol.Home page
S. HADJADJ, R. BELLOUM, B. BOUHANICK, Y. GALLOIS, G. GUILLOTEAU, G. CHATELLIER, F. ALHENC-GELAS, and M. MARRE
Prognostic Value of Angiotensin-I Converting Enzyme I/D Polymorphism for Nephropathy in Type 1 Diabetes Mellitus: A Prospective Study
J. Am. Soc. Nephrol., March 1, 2001; 12(3): 541 - 549.
[Abstract] [Full Text]


Home page
Int J EpidemiolHome page
J. Cruickshank, J. Mbanya, R Wilks, B Balkau, N McFarlane-Anderson, and T Forrester
Sick genes, sick individuals or sick populations with chronic disease? The emergence of diabetes and high blood pressure in African-origin populations
Int. J. Epidemiol., February 1, 2001; 30(1): 111 - 117.
[Abstract] [Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
N. Padmanabhan, S. Padmanabhan, and J. M. Connell
Genetic basis of cardiovascular disease -- the renin-angiotensin-aldosterone system as a paradigm
Journal of Renin-Angiotensin-Aldosterone System, December 1, 2000; 1(4): 316 - 324.
[PDF]


Home page
HypertensionHome page
C. J. Clark, E. Davies, N. H. Anderson, R. Farmer, E. C. Friel, R. Fraser, and J. M. C. Connell
{{alpha}}-Adducin and Angiotensin I-Converting Enzyme Polymorphisms in Essential Hypertension
Hypertension, December 1, 2000; 36(6): 990 - 994.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Rice, T. Rankinen, M. A. Province, Y. C. Chagnon, L. Perusse, I. B. Borecki, C. Bouchard, and D. C. Rao
Genome-Wide Linkage Analysis of Systolic and Diastolic Blood Pressure : The Quebec Family Study
Circulation, October 17, 2000; 102(16): 1956 - 1963.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. Levy, A. L. DeStefano, M. G. Larson, C. J. O'Donnell, R. P. Lifton, H. Gavras, L. A. Cupples, and R. H. Myers
Evidence for a Gene Influencing Blood Pressure on Chromosome 17 : Genome Scan Linkage Results for Longitudinal Blood Pressure Phenotypes in Subjects From the Framingham Heart Study
Hypertension, October 1, 2000; 36(4): 477 - 483.
[Abstract] [Full Text] [PDF]


Home page
QJMHome page
G. Emilien, M. Ponchon, C. Caldas, O. Isacson, and J.-M. Maloteaux
Impact of genomics on drug discovery and clinical medicine
QJM, July 1, 2000; 93(7): 391 - 423.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
W.-C. Hsueh, B. D. Mitchell, J. L. Schneider, M. J. Wagner, C. J. Bell, E. Nanthakumar, and A. R. Shuldiner
QTL Influencing Blood Pressure Maps to the Region of PPH1 on Chromosome 2q31-34 in Old Order Amish
Circulation, June 20, 2000; 101(24): 2810 - 2816.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
M. A. v. Dijk, M. H. Breuning, D. J. M. Peters, and P. C. Chang
The ACE insertion/deletion polymorphism has no influence on progression of renal function loss in autosomal dominant polycystic kidney disease
Nephrol. Dial. Transplant., June 1, 2000; 15(6): 836 - 839.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J. Higaki, S. Baba, T. Katsuya, N. Sato, K. Ishikawa, T. Mannami, J. Ogata, and T. Ogihara
Deletion Allele of Angiotensin-Converting Enzyme Gene Increases Risk of Essential Hypertension in Japanese Men : The Suita Study
Circulation, May 2, 2000; 101(17): 2060 - 2065.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
A. D Paterson and A. Petronis
Age and sex based genetic locus heterogeneity in type 1 diabetes
J. Med. Genet., March 1, 2000; 37(3): 186 - 191.
[Abstract] [Full Text]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
B. Agerholm-Larsen, B. G. Nordestgaard, and A. Tybjarg-Hansen
ACE Gene Polymorphism in Cardiovascular Disease : Meta-Analyses of Small and Large Studies in Whites
Arterioscler Thromb Vasc Biol, February 1, 2000; 20(2): 484 - 492.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
N. Liyou, L. Simons, and A. Johnson
Insertion/Deletion Polymorphism of the Angiotensin-Converting Enzyme Gene and Hypertension
Circulation, October 26, 1999; 100 (17): e85 - e85.
[Full Text] [PDF]


Home page
CirculationHome page
A.H.J. Danser and H. Schunkert
Renin-Angiotensin System and Blood Pressure
Circulation, October 26, 1999; 100 (17): 85e - e86.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. August
Hypertension in Men
J. Clin. Endocrinol. Metab., October 1, 1999; 84(10): 3451 - 3454.
[Full Text] [PDF]


Home page
HypertensionHome page
S. T. Turner, E. Boerwinkle, and C. F. Sing
Context-Dependent Associations of the ACE I/D Polymorphism With Blood Pressure
Hypertension, October 1, 1999; 34(4): 773 - 778.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
E. G. BURCHARD, E. K. SILVERMAN, L. J. ROSENWASSER, L. BORISH, C. YANDAVA, A. PILLARI, S. T. WEISS, J. HASDAY, C. M. LILLY, J. G. FORD, et al.
Association Between a Sequence Variant in the IL-4 Gene Promoter and FEV1 in Asthma
Am. J. Respir. Crit. Care Med., September 1, 1999; 160(3): 919 - 922.
[Abstract] [Full Text]


Home page
J. Am. Soc. Nephrol.Home page
M. A. VAN DIJK, D. J.M. PETERS, M. H. BREUNING, and P. C. CHANG
The Angiotensin-Converting Enzyme Genotype and Microalbuminuria in Autosomal Dominant Polycystic Kidney Disease
J. Am. Soc. Nephrol., September 1, 1999; 10(9): 1916 - 1920.
[Abstract] [Full Text]


Home page
HypertensionHome page
J. Baima, M. Nicolaou, F. Schwartz, A. L. DeStefano, A. Manolis, I. Gavras, C. Laffer, F. Elijovich, L. Farrer, C. T. Baldwin, et al.
Evidence for Linkage Between Essential Hypertension and a Putative Locus on Human Chromosome 17
Hypertension, July 1, 1999; 34(1): 4 - 7.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
F. Perticone, R. Maio, C. Cosco, R. Ceravolo, S. Iacopino, M. Chello, P. Mastroroberto, D. Tramontano, and P. L Mattioli
Hypertensive left ventricular remodeling and ACE-gene polymorphism
Cardiovasc Res, July 1, 1999; 43(1): 192 - 199.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
R. J. van SUYLEN, E. F. WOUTERS, H. J. PENNINGS, E. C. CHERIEX, P. E. van POL, A. W. AMBERGEN, A.-M. VERMELIS, and M. J. DAEMEN
The DD Genotype of the Angiotensin Converting Enzyme Gene Is Negatively Associated with Right Ventricular Hypertrophy In Male Patients with Chronic Obstructive Pulmonary Disease
Am. J. Respir. Crit. Care Med., June 1, 1999; 159(6): 1791 - 1795.
[Abstract] [Full Text]


Home page
HypertensionHome page
C. J. O'Donnell and W. B. Kannel
Is There a Racial Predisposition to Hypertension?
Hypertension, November 1, 1998; 32(5): 817 - 819.
[Full Text] [PDF]


Home page
Journal Watch CardiologyHome page
ACE Gene for Hypertension May Be Sex-Specific
Journal Watch Cardiology, July 10, 1998; 1998(710): 5 - 5.
[Full Text]


Home page
JWatch Women's HealthHome page
ACE Gene for Hypertension May Be Sex-Specific
Journal Watch Women's Health, July 1, 1998; 1998(701): 5 - 5.
[Full Text]


Home page
CirculationHome page
F. Soubrier
Blood Pressure Gene at the Angiotensin I–Converting Enzyme Locus : Chronicle of a Gene Foretold
Circulation, May 19, 1998; 97(18): 1763 - 1765.
[Full Text] [PDF]


Home page
CirculationHome page
M. Fornage, C. I. Amos, S. Kardia, C. F. Sing, S. T. Turner, and E. Boerwinkle
Variation in the Region of the Angiotensin-Converting Enzyme Gene Influences Interindividual Differences in Blood Pressure Levels in Young White Males
Circulation, May 19, 1998; 97(18): 1773 - 1779.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O'Donnell, C. J.
Right arrow Articles by Levy, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O'Donnell, C. J.
Right arrow Articles by Levy, D.