Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 1998;97:1375-1381

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bryant, D.
Right arrow Articles by Giroir, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bryant, D.
Right arrow Articles by Giroir, B.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Cardiomyopathy
*Heart Failure

(Circulation. 1998;97:1375-1381.)
© 1998 American Heart Association, Inc.


Basic Science Reports

Cardiac Failure in Transgenic Mice With Myocardial Expression of Tumor Necrosis Factor-{alpha}

Debora Bryant, BS; Lisa Becker, BS; James Richardson, DVM, PhD; John Shelton, BS; Fatima Franco, MD; Ronald Peshock, MD; Marita Thompson, MD; ; Brett Giroir, MD

From the Departments of Pediatrics (D.B., L.B., M.T., B.G.), Pathology (J.R., J.S.), and Radiology (F.F., R.P.), The University of Texas Southwestern Medical Center, Dallas.

Correspondence to Brett P. Giroir, MD, UT Southwestern Medical Center, 5323 Harry Hines Blvd, Dallas, TX 75235-9063. E-mail bgiroi{at}mednet.swmed.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background—Tumor necrosis factor-{alpha} (TNF-{alpha}) is a multifunctional cytokine that has been detected in several human cardiac-related conditions, including congestive heart failure and septic cardiomyopathy. In these conditions, the origin of TNF-{alpha} secretion is, at least in part, cardiac myocytes.

Methods and Results—To determine the consequences of TNF-{alpha} production by cardiac myocytes in vivo, we developed transgenic mice in which expression of a murine TNF-{alpha} coding sequence was driven by the murine {alpha}-myosin heavy chain promoter. Four transgenic founders developed an identical illness consisting of tachypnea, decreased activity, and hunched posture. In vivo, ECG-gated MRI of symptomatic transgenic mice documented a severe impairment of cardiac function evidenced by biventricular dilatation and depressed ejection fractions. All transgenic mice died prematurely. Pathological examination of affected animals revealed a globular dilated heart, bilateral pleural effusions, myocyte apoptosis, and transmural myocarditis in both the right and left ventricular free walls, septum, and atrial chambers. In all terminally ill animals, there was significant biventricular fibrosis and atrial thrombosis.

Conclusions—This is the first report detailing the effects of tissue-specific production of TNF-{alpha} by cardiac myocytes in vivo. These findings indicate that production of TNF-{alpha} by cardiac myocytes is sufficient to cause severe cardiac disease and support a causal role for this cytokine in the pathogenesis of human cardiac disease.


Key Words: apoptosis • magnetic resonance imaging • heart failure • cardiomyopathy • myocarditis


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Tumor necrosis factor-{alpha} is a multifunctional cytokine that mediates diverse pathological processes, such as cachexia during cancer, shock during infection, and inflammation during autoimmunity.1 2 3 4 5 6 7 8 Recently, TNF has been detected in human cardiac-related illnesses, including congestive heart failure, myocarditis, ischemic heart disease, dilated cardiomyopathy, and septic cardiomyopathy.9 10 11 12 13 In these conditions, several lines of evidence indicate that the origin of TNF is, at least in part, the heart itself.14 15 16 17 18 Using a reporter transgene that accounted for both TNF transcriptional and translational regulation, we initially demonstrated TNF reporter gene expression in the hearts of transgenic mice after endotoxin administration.15 After this observation, TNF production by cardiac myocytes was detected after stimulation of murine cardiac myocytes with endotoxin in vitro and by cardiac myocytes after thermal injury of guinea pigs in vivo.15 16 Production of TNF mRNA and protein by cardiac myocytes has also been demonstrated in vitro and in vivo in feline hearts stimulated with endotoxin14 or exposed to brief hemodynamic pressure overload.19 Recently, TNF mRNA and protein were detected in explanted hearts from humans with dilated cardiomyopathy and ischemic heart disease, but TNF was not detected in nonfailing hearts.18 Because cardiac myocytes also express functional TNF receptors,17 18 these data suggest that biosynthesis, secretion, and activity of TNF may be compartmentalized within the myocardium and exert pathogenic effects even if TNF is not produced by other tissues.

Several investigators have begun to elucidate the effects of TNF on cardiac function. Systemic administration of recombinant TNF has consistently resulted in myocardial depression20 21 22 23 and has been associated with the development of cardiomyopathy.24 In contrast, exposure of cardiac myocytes to TNF in vitro has led to disparate effects, including enhancement of myocyte contractility, depression of myocyte contractility, myocyte apoptosis, or myocyte hypertrophy.25 26 27 28 29 30 Thus far, no model has been able to determine the cardiac effects of TNF production by cardiac myocytes in vivo. Such a model of compartmentalized TNF production may be important, because it may simulate the TNF production that is thought to occur in human cardiac-related illnesses. Furthermore, an in vivo model would allow for the induction and subsequent characterization of secondary humoral and cellular effectors that might ultimately mediate TNF effects.

To determine the effects of TNF production by cardiac myocytes in vivo, we developed transgenic mice in which TNF is constitutively expressed only by cardiac myocytes. In these animals, expression of the cytokine is directed by the {alpha}-MHC promoter. This promoter was previously shown to drive selective expression of reporter sequences only in the hearts of transgenic mice31 and was upregulated shortly after birth.32 Our data indicate that production of TNF by cardiac myocytes in vivo is sufficient to cause severe cardiac disease and support a causal role for this cytokine in the pathogenesis of cardiac disease.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
All animals were used in accordance with the guidelines of the University of Texas Southwestern Medical Center Animal Care and Research Advisory Committee and in compliance with the rules governing animal use, as published by the National Institutes of Health.

Transgene Design and Expression
The transgene vector consisted of a murine TNF-{alpha} coding sequence flanked by the full-length murine {alpha}-MHC promoter and an SV40 3'-polyadenylation sequence (Fig 1ADown). The {alpha}-MHC promoter was obtained in plasmid pBluescript II (pBS-MHC) (gift of Jeffrey Robbins, Cincinnati, Ohio) as previously described.31 The 5.5-kb promoter sequence was excised by use of BamHI and SalI. The TNF coding sequence was obtained by reverse transcriptase–PCR amplification of total RNA obtained from LPS-stimulated mouse macrophages (RAW 264.7). PCR product consisted of TNF-{alpha} nucleotides 1 to 871, with 5' KpnI and 3' HindIII restriction sites added. The SV40 PA sequence was excised from pcDNA1 (Invitrogen) and cloned into pBluescript, PstI to BamHI (pBS-SV40 PA). The TNF coding sequence was inserted into pBS-SV40 PA, KpnI to HindIII. Then TNF-SV40 PA was amplified from this vector by use of oligonucleotides containing SalI 5' and KpnI 3' restriction sites. The amplified product was then inserted into pBS-MHC, SalI to KpnI. A purified transgene vector was obtained by excision of the sequence from BamHI to KpnI, which removed the irrelevant pBluescript vector sequences. The transgene sequence was microinjected into fertilized oocytes by the NICHD Transgenic Mouse Development Facility at the University of Alabama at Birmingham according to standard protocols. Founder animals were mated with B6xSJL mice (Jackson Laboratories, Bar Harbor, Me). Transgenic offspring were identified by PCR amplification of unique transgene sequences from tail DNA by use of oligonucleotide primers (TNF, 5'-CCCGTC GACCTCAGATCATCTTCTCAAAAT; SV40, 3'-CCCGGTAC CTTAAGACATGATAAGATACAT).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 1. Structure and expression of {alpha}-MHC/TNF-{alpha} transgene. A, Murine {alpha}-MHC promoter, murine TNF-{alpha} coding sequence without 5'UTR and 3'UTR, and SV40 polyadenylation sequences (PA) were cloned as indicated to construct transgene vector. B, Northern blot containing poly(A)–enriched RNA obtained from a heterozygous transgenic mouse and nontransgenic littermate control (wild type). Hybridization was performed with a probe consisting of either SV40 PA sequence or a murine TNF-{alpha} coding sequence. Expression of transgene mRNA is exclusively limited to heart and is not found in other organs.

Northern Blots
RNA was purified from organs and enriched for poly(A) RNA with MicroPoly(A)Pure (Ambion); probes were labeled and blots performed by standard methods as previously described.33 Probes consisted of either the SV40 poly(A) sequence or the murine TNF coding sequence originally used to construct the transgene vector.

Endotoxin Challenge
Nontransgenic littermates were injected with 100 µg IP of Escherichia coli O111:B4 LPS (Sigma Chemical Co). After 1.5 hours, mice were anesthetized with methoxyflurane, cervically dislocated, and exsanguinated, and hearts were removed.

TNF Assays
Cardiac TNF production was determined by the method of Benigni and coworkers.34 Hearts were excised, rinsed in normal saline, frozen in liquid nitrogen, and stored at -70°C until assay. Hearts were thawed, rinsed in ice-cold normal saline, then homogenized in 4x wt/vol ice-cold normal saline. The homogenate was centrifuged at 13 800g in a microfuge for 10 minutes at 4°C. The concentration of TNF was measured in the supernatant or in serum by the Quantikine M ELISA (R&D Systems) according to the manufacturer's instructions.

Magnetic Resonance Imaging
Each mouse was anesthetized with intraperitoneal injections of Avertin and positioned supine, head up, with ECG leads attached, and MRI was performed with a 1.5-T Philips Gyroscan NT whole-body imaging system (Philips Medical Systems) with a 4x8-cm surface coil. Multiframe, short-axis, gated gradient-echo sequences were used to measure left ventricular volumes and ejection fraction. Typically, hearts rates were 350 to 550 bpm. The slice thickness was 1.5 mm with a 0.2-mm gap between slices, matrix of 256x256, and a field of view of 45 to 50 mm (yielding voxel sizes of 0.18 to 0.19x0.18 to 0.19x1.5 mm). Volumes were calculated by summation (Simpson's rule) after the endocardial border for each slice was traced. Left ventricular (LV) ejection fraction was calculated as (LV end-diastolic volume-LV end-systolic volume)/LF end-diastolic volume.

Histopathology
Moribund animals were euthanized with intraperitoneal injection of barbiturate and examined. Heart, lung, and liver were removed, fixed in 10% buffered formalin, embedded in paraffin, and sectioned at 4 µm. The sections were stained with hematoxylin and eosin or with Masson's trichrome for collagen.

Statistics
TNF levels are expressed as mean±SEM. Comparison between groups was done by the Wilcoxon rank sum test. Differences were considered statistically significant at a value of P<.05.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Six transgenic founder mice were produced, of which four developed a similar abnormal phenotype and two remained normal. Of the four symptomatic founders, two died before successful mating, and two founders were able to transmit their transgene in a Mendelian fashion despite their developing phenotype. Both transgenic lineages resulting from these two founders demonstrated selective transgene expression in the heart and no transgene expression in other organs, including lung, kidney, liver, brain, and skeletal muscle (Fig 1BUp). Production of immunoreactive TNF protein was documented in the hearts of both lineages but was never detectable in the serum of either lineage (TableDown). Cardiac TNF levels in lineage 1 were significantly greater than the cardiac TNF levels in lineage 2 (TableDown), but TNF levels in both transgenic lineages were substantially lower than cardiac TNF levels after LPS challenge of nontransgenic littermates. The higher levels of cardiac TNF in lineage 1 compared with lineage 2 is consistent with a transgene copy number in lineage 1 of {approx}20 copies per genome, compared with the transgene copy number of lineage 2 of {approx}5 copies per genome (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 1. Serum and Cardiac TNF Levels

Transgenic animals were phenotypically normal at birth and remained so until the onset of a characteristic illness. All founders and heterozygous offspring developed a clinical syndrome consisting of decreased activity, tachypnea, hunched posture, and poor grooming, which led to premature death within days of illness onset. Half of the heterozygous transgenics in lineage 1 died by 70 days of age (Fig 2Down). Heterozygotes in transgenic lineage 2 also died prematurely compared with nontransgenic littermate controls but survived longer than lineage 1.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 2. Survival of heterozygous transgenic mice of lineage 1 (n=20, solid line), heterozygous transgenic mice of lineage 2 (n=10, broken line), and nontransgenic littermate controls (n=20, dotted line).

In vivo, ECG-gated MRI of three sick transgenic mice (n=6 MRI scans) documented a severe impairment of cardiac function, indicated by marked ventricular dilatation and significantly depressed ejection fractions (the fractional change in ventricular volume between end diastole and end systole) (Fig 3Down). Animals were euthanized when their activity dramatically decreased, tachypnea worsened, and/or >10% weight loss occurred, consistent with institutional animal care guidelines. Postmortem examination of heterozygous transgenic animals revealed the presence of bilateral pleural effusions and striking cardiac abnormalities. Euthanized animals of both lineages (n=20) had grossly enlarged, globular hearts with biatrial and biventricular dilatation (Fig 4aDown and 4bDown). There were no congenital cardiac developmental defects or valvular abnormalities. Histological examination (n=8 transgenic mice) of the ventricles revealed marked dilatation and transmural myocarditis in both the right and left free walls, septum, and atrium as well (Fig 4cDown). The inflammatory infiltrate, consisting primarily of macrophages and small numbers of lymphocytes, was evident between the cardiac myocytes. Numerous cardiac myocytes contained large hyperplastic, vesiculated nuclei. In all terminally ill animals, there was significant biventricular fibrosis. Lesions in the atria paralleled those in the ventricles but were more dramatic (Fig 4dDown and 4eDown). Lymphocytes formed distinct multifocal aggregates, and numerous neutrophils often were seen within the atrial myocardium. Associated with the acute inflammation in moribund animals was massive atrial thrombosis that obliterated the atrial chamber. Where the thrombus attached to the atrial wall, fibroplasia and neovascularization were prominent. In regions of mature fibrosis, cartilagenous metaplasia was present.



View larger version (125K):
[in this window]
[in a new window]
 
Figure 3. Cardiac function in heterozygous transgenic and wild-type controls, as determined by in vivo, ECG-gated MRI. A, End-diastolic and B, end-systolic MRI images in a wild-type mouse (short-axis view). Ejection fraction was determined to be 71% (normal, >=50%). RV indicates right ventricle; LV, left ventricle. C, End-diastolic and D, end-systolic MRI images in a heterozygous transgenic mouse with symptomatic heart failure (short-axis view). Ejection fraction was determined to be 26%.



View larger version (122K):
[in this window]
[in a new window]
 
Figure 4. Abnormal anatomy and histology of TNF transgenic animals. a and b, Gross morphology of hearts from wild-type (WT) and transgenic (TNF-TG) mice; c through f, histological sections of heart (c through e) and lung (f) stained with hematoxylin-eosin. c, Ventricle with myocarditis and fibrosis; d, atrium with marked myocarditis and atrial thrombosis; e, higher magnification of inset in d showing intense lymphocytic infiltrate; and f, lung with vascular congestion (arrow) and "heart-failure" cells (arrowheads) in alveoli. f indicates fibrosis; m, myocardium; and t, thrombus. Scale bars: a and b, 2 mm; c through f, 40 µm.

The lungs were edematous and congested, and alveoli contained numerous intra-alveolar macrophages containing red blood cells (Fig 4fUp). These "heart-failure cells" are characteristic of left-sided heart failure, which leads to increased diapedesis of red blood cells into the alveoli. However, with the exception of mild centrolobular vacuolization of the liver, which occurred rarely, the remaining livers were histologically normal.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Current data indicate that cardiac myocytes are a primary source of TNF secretion during sepsis, thermal injury, and end-stage congestive heart failure. The primary conclusion of this study is that production of TNF by cardiac myocytes is sufficient to cause myocarditis, myocardial dysfunction, cardiac failure, and premature death and therefore supports a causal role for TNF in the pathogenesis of diverse cardiac diseases.

The notion that TNF may be involved in cardiac disease evolved from observations concerning the pathogenesis of cardiac dysfunction during septic shock. Parillo et al35 and Reilly et al36 first identified myocardial depressant substances in the serum of patients with septic shock. Cardiac dysfunction has since been documented in human volunteers given small doses of bacterial endotoxin37 and in a variety of animal models, including administration of endotoxin to numerous species38 39 40 41 42 43 44 45 46 ; intravenous administration of TNF to guinea pigs and dogs20 21 22 23 ; and implantation of intraperitoneal fibrin clots impregnated with Gram-positive or Gram-negative bacteria, endotoxin, or TNF in dogs.47 48 49 Blockade of TNF activity prevents cardiac dysfunction after LPS challenge or cutaneous thermal injury,16 50 51 and inhibition of TNF ameliorated cardiac dysfunction in humans with septic shock.52 53 Taken together, these observations strongly suggest that TNF mediates cardiac dysfunction, at least in part, during septic shock and after thermal burns.

Investigators have also proposed a role for TNF in cardiac illnesses unrelated to sepsis.10 TNF is present in the plasma of humans with severe congestive heart failure,9 54 55 56 in patients with myocardial infarction,57 58 59 60 myocarditis,12 cardiomyopathy,13 cardiac transplant rejection,61 and in patients after cardiopulmonary bypass.62 63 64 Recently, TNF mRNA and protein were detected in explanted hearts of patients with end-stage dilated cardiomyopathy and ischemic heart disease but not in nonfailing hearts.17 18 These observations suggested that TNF may contribute to myocardial dysfunction and/or injury in these conditions. This possibility is fueled by recent observations that TNF causes apoptosis in cardiac myocytes in vitro26 and therefore could be associated with myocyte apoptosis, which occurs in patients with congestive heart failure who require transplantation.65

The hypothesis that myocyte production of TNF is deleterious in vivo has remained untested. It is possible that cardiac TNF production occurs but is unrelated to dysfunction or that myocardial TNF production might serve to enhance contractility, mediate compensatory myocyte hypertrophy, or be involved in myocardial adaptation to stress.25 28 The transgenic model reported here is the first to investigate the effects of isolated, tissue-specific production of TNF by cardiac myocytes in vivo, in the absence of confounding influences. All clinical, radiological, and pathological findings indicate that these animals experienced severe myocarditis that led to myocardial fibrosis, heart failure, and premature mortality. Abnormalities were uniformly present in heterozygous transgenic mice but were never present in nontransgenic littermate controls. Similar findings have also been reported in abstract form.66

Our results clearly indicate that myocyte production of TNF is sufficient to cause severe cardiac disease; however, the present experiments do not distinguish whether damage is caused by TNF directly, by inflammatory cells that have been recruited by TNF, by the expression of other cytokines, or by the induction of nitric oxide synthases and the generation of free radicals such as peroxynitrite.67 Atrial thrombosis was present in all moribund animals that were examined pathologically. Thrombosis may be a consequence of severely reduced cardiac output and stasis but could also be the result of enhanced thrombogenic potential of the endothelium as a direct result of local expression of cytokines and upregulation of molecules such as tissue factor.68 69

In addition to elucidating the effects of TNF on the heart, these transgenic animals may serve as a unique and reproducible model of progressive heart failure in which diverse processes such as myocyte apoptosis and cardiac compensation can be investigated. However, the present model has limitations. Despite having two lineages with different levels of transgene expression, the dosage of cardiac TNF is largely uncontrolled. It remains possible that lower or higher tissue levels of TNF may yield different results. In addition, TNF secretion in this model begins perinatally, and it is possible that different effects would be observed if secretion of TNF began only after the animals were mature or occurred only during a finite time interval. These limitations can be overcome in future transgenic models using currently available technology.


*    Selected Abbreviations and Acronyms
 
LPS = lipopolysaccharide
{alpha}-MHC = {alpha}-myosin heavy chain
PCR = polymerase chain reaction
SV40 = simian virus 40
TNF = tumor necrosis factor-{alpha}


*    Acknowledgments
 
This work was funded in part by the National Institute of General Medical Sciences and in part by the American Heart Association Texas Affiliate. We thank the NICHD Transgenic Mouse Development Facility (contract NO1-HD-5–3229) at the University of Alabama at Birmingham for microinjection of the transgene construct and production of founders; Beth Bauer, DVM, for expert veterinary consultation; Jennifer Lavender for her technical expertise; Ed Fernandez for helpful discussion; and Robert Webb for histological preparation.

Received September 12, 1997; revision received November 4, 1997; accepted November 7, 1997.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Pennica D, Nedwin GE, Hayflick JS, Seeburg PH, Derynck R, Palladino MA, Kohr WJ, Aggarwal BB, Goeddel DV. Human tumor necrosis factor: precursor structure, expression and homology to lymphotoxin. Nature. 1984;312:724–729.[Medline] [Order article via Infotrieve]

2. Tracey KJ, Beutler B, Lowry SF. Shock and tissue injury induced by recombinant human cachectin. Science. 1986;234:470–474.[Abstract/Free Full Text]

3. Beutler B, Krochin N, Milsark IW, Luedke C, Cerami A. Control of cachectin (tumor necrosis factor) synthesis: mechanisms of endotoxin resistance. Science. 1986;232:977–980.[Abstract/Free Full Text]

4. Oliff A, Defoe-Jones D, Boyer M, Martinez D, Kiefer D, Vuocolo G, Wolfe A, Socher SH. Tumors secreting human TNF/cachectin induce cachexia in mice. Cell. 1987;50:555–563.[Medline] [Order article via Infotrieve]

5. Tracey KJ, Cerami A. Tumor necrosis factor: a pleiotropic cytokine and therapeutic target. Annu Rev Med. 1994;45:491–503.[Medline] [Order article via Infotrieve]

6. Feldmann M, Brennan FM, Maini RN. Role of cytokines in rheumatoid arthritis. Annu Rev Immunol. 1996;14:397–440.[Medline] [Order article via Infotrieve]

7. Probert L, Akassoglou K, Pasparakis M, Kontogergos G, Kollias G. Spontaneous inflammatory demyelinating disease in transgenic mice showing central nervous system-specific expression of tumor necrosis factor-alpha. Proc Natl Acad Sci U S A. 1995;92:11294–11298.[Abstract/Free Full Text]

8. Michie HR, Manogue KR, Spriggs DR. Detection of circulating tumor necrosis factor after endotoxin administration. N Engl J Med. 1988;318:1481–1486.[Abstract]

9. Levine B, Kalman J, Mayer L, Fillit HM, Packer M. Elevated circulating levels of tumor necrosis factor in severe chronic heart failure. N Engl J Med. 1990;323:236–241.[Abstract]

10. Mann DL, Young JB. Basic mechanisms in congestive heart failure: recognizing the role of proinflammatory cytokines. Chest. 1994;105:897–904.[Free Full Text]

11. McMurray J, Abdullah I, Dargie HJ, Shapiro D. Increased concentrations of tumour necrosis factor in `cachectic' patients with severe chronic heart failure. Br Heart J. 1991;66:356–358.[Abstract/Free Full Text]

12. Matsumori A, Yamada T, Suzuki H, Matoba Y, Sasayama S. Increased circulating cytokines in patients with myocarditis and cardiomyopathy. Br Heart J. 1994;72:561–566.[Abstract/Free Full Text]

13. Habib FM, Springall DR, Davies GJ, Oakley CM, Yacoub MH, Polak JM. Tumour necrosis factor and inducible nitric oxide synthase in dilated cardiomyopathy. Lancet. 1996;347:1151–1155.[Medline] [Order article via Infotrieve]

14. Kapadia S, Lee J, Torre-Amione G, Birdsall HH, Ma TS, Mann DL. Tumor necrosis factor-alpha gene and protein expression in adult feline myocardium after endotoxin administration. J Clin Invest. 1995;96:1042–1052.

15. Giroir BP, Johnson JH, Brown T, Allen GA, Beutler B. The tissue distribution of tumor necrosis factor biosynthesis during endotoxemia. J Clin Invest. 1992;90:693–698.

16. Giroir BP, Horton JW, White DJ, McIntyre KL, Lin CQ. Inhibition of tumor necrosis factor (TNF) prevents myocardial dysfunction during burn shock. Am J Physiol. 1994;267:H118–H124.[Abstract/Free Full Text]

17. Torre-Amione G, Kapadia S, Lee J, Bies RD, Lebovitz R, Mann DL. Expression and functional significance of tumor necrosis factor receptors in human myocardium. Circulation. 1995;92:1487–1493.[Abstract/Free Full Text]

18. Torre-Amione G, Kapadia S, Lee J, Durand J-B, Bies RD, Young JB, Mann DL. Tumor necrosis factor-alpha and tumor necrosis factor receptors in the failing human heart. Circulation. 1996;93:704–711.[Abstract/Free Full Text]

19. Kapadia SR, Oral H, Lee J, Nakano M, Taffet GE, Mann DL. Hemodynamic regulation of tumor necrosis factor-{alpha} and protein expression in adult feline myocardium. Circ Res. 1997;81:187–195.[Abstract/Free Full Text]

20. Heard SO, Perkins MW, Fink MP. Tumor necrosis factor-alpha causes myocardial depression in guinea pigs. Crit Care Med. 1992;20:523–527.[Medline] [Order article via Infotrieve]

21. Pagani FD, Baker LS, Hsi C, Knox M, Fink MP, Visner MS. Left ventricular systolic and diastolic dysfunction after infusion of tumor necrosis factor-alpha in conscious dogs. J Clin Invest. 1992;90:389–398.

22. Eichenholz PW, Eichacker PQ, Hoffman WD, Banks SM, Parrillo JE, Danner RL, Natanson C. Tumor necrosis factor challenges in canines: patterns of cardiovascular dysfunction. Am J Physiol. 1992;263:H668–H675.[Abstract/Free Full Text]

23. Eichacker PQ, Hoffman WD, Farese A, Banks SM, Kuo GC, MacVittie TJ, Natanson C. TNF but not IL-1 in dogs causes lethal lung injury and multiple organ dysfunction similar to human sepsis. J Appl Physiol. 1991;71:1979–1989.[Abstract/Free Full Text]

24. Hegewisch S, Weh HJ, Hossfeld DK. TNF-induced cardiomyopathy. Lancet. 1990;2:294–295.

25. Yokoyama T, Nakano M, Bednarczyk JL, McIntyre BW, Entman M, Mann DL. Tumor necrosis factor-alpha provokes a hypertrophic growth response in adult cardiac myocytes. Circulation. 1997;95:1247–1252.[Abstract/Free Full Text]

26. Krown KA, Page MT, Nguyen C, Zechner D, Gutierrez V, Comstock KL, Glembotski CC, Quintana PJE, Sabbadini RA. Tumor necrosis factor alpha-induced apoptosis in cardiac myocytes: involvement of the sphingolipid signaling cascade in cardiac cell death. J Clin Invest. 1996;98:2854–2865.[Medline] [Order article via Infotrieve]

27. Kumar A, Thota V, Dee L, Olson J, Uretz E, Parrillo JE. Tumor necrosis factor {alpha} and interleukin 1ß are responsible for in vitro myocardial cell depression induced by human septic shock serum. J Exp Med. 1996;183:949–958.[Abstract/Free Full Text]

28. Murray DR, Freeman GL. Tumor necrosis factor-{alpha} induces a biphasic effect on myocardial contractility in conscious dogs. Circ Res. 1996;78:154–160.[Abstract/Free Full Text]

29. DeMeules JE, Pigula FA, Mueller M, Raymond SJ, Gamelli RL. Tumor necrosis factor and cardiac function. J Trauma. 1992;32:686–692.[Medline] [Order article via Infotrieve]

30. Muller-Werdan U, Reithman C, Werdan K. Cytokines and the Heart: Molecular Mechanisms of Septic Cardiomyopathy. Austin, Tex: R.G. Landes; 1996.

31. Gulick J, Subramaniam A, Neumann J, Robbins J. Isolation and characterization of the mouse cardiac myosin heavy chain genes. J Biol Chem. 1991;266:9180–9185.[Abstract/Free Full Text]

32. Robbins J, Gulick J, Sanchez A, Howles P, Doetschman T. Mouse embryonic stem cells express the cardiac myosin heavy chain genes during development in vitro. J Biol Chem. 1990;265:11905–11909.[Abstract/Free Full Text]

33. Williams G, Becker L, Bryant D, Willis S, Giroir BP. Effects of transforming growth factor on nitric oxide synthesis by C2C12 skeletal myocytes. Am J Physiol. 1996;270(1 Pt 2):R145–R152.

34. Benigni F, Sacco S, Pennica D, Ghezzi P. Cardiotrophin-1 inhibits tumor necrosis factor production in the heart and serum of lipopolysaccharide-treated mice and in vitro in mouse blood cells. Am J Pathol. 1996;149:1847–1850.[Abstract]

35. Parrillo JE, Shelhamer JH, Parker MM, Natanson C, Schuette W. A circulating myocardial depressant substance in humans with septic shock: septic shock patients with a reduced ejection fraction have a circulating factor that depresses in vitro myocardial cell performance. J Clin Invest. 1985;76:1539–1553.

36. Reilly JM, Cunnion RE, Burch-Whitman C, Parker MM, Shelhamer JH, Parrillo JE. A circulating myocardial depressant substance is associated with cardiac dysfunction and peripheral hypoperfusion (lactic acidemia) in patients with septic shock. Chest. 1989;95:1072–1080.[Abstract/Free Full Text]

37. Suffredini AF, Frinnm RE, Parker MM, Brenner M, Kovacs JA, Wesley RA, Parrillo JE. The cardiovascular response of normal humans to the administration of endotoxin. N Engl J Med. 1989;321:280–287.[Abstract]

38. Natanson C, Eichenholz PW, Danner RL, Eichacker PQ, Hoffman WD, Kuo GC, Banks SM, MacVittie TJ, Parrillo JE. Endotoxin and tumor necrosis factor challenges in dogs simulate the cardiovascular profile of human septic shock. J Exp Med. 1989;169:823–832.[Abstract/Free Full Text]

39. Solis RT, Downing SE. Effects of E. coli endotoxemia on ventricular performance. Am J Physiol. 1966;211:307–313.

40. Adams HR, Baxter CR, Parker JL, Watts NB. Contractile function and rhythmicity of cardiac preparation from Escherichia coli endotoxin-shocked guinea pigs. Circ Shock. 1984;13:241–253.[Medline] [Order article via Infotrieve]

41. Parker JL, Adams HR. Contractile dysfunction of atrial myocardium from endotoxin-shocked guinea pigs. Am J Physiol. 1981;240:H954–H962.

42. Adams HR, Baxter CR, Parker JL. Reduction of intrinsic contractile reserves of the left ventricle by Escherichia coli endotoxin shock in guinea-pigs. J Mol Cell Cardiol. 1985;17:575–585.[Medline] [Order article via Infotrieve]

43. Rubin LJ, Keller RS, Parker JL, Adams HR. Contractile dysfunction of ventricular myocytes isolated from endotoxemic guinea pigs. Shock. 1994;2:113–120.[Medline] [Order article via Infotrieve]

44. Noshima S, Noda H, Herndon DN, Traber LD, Traber DL. Left ventricular performance during continuous endotoxin-induced hyperdynamic endotoxemia in sheep. J Appl Physiol. 1993;74:1528–1533.[Abstract/Free Full Text]

45. Hung J, Lew WYW. Cellular mechanisms of endotoxin-induced myocardial depression in rabbits. Circ Res. 1993;73:125–134.[Abstract]

46. Decking UKM, Flesche CW, Godecke A, Schrader J. Endotoxin-induced contractile dysfunction in guinea pig hearts is not mediated by nitric oxide. Am J Physiol. 1995;268:H2460–H2465.[Abstract/Free Full Text]

47. Natanson C, Danner RL, Elin RJ, Hosseini JM, Peart KW, Banks SM, MacVittie TJ, Walker RI, Parrillo JE. Role of endotoxemia in cardiovascular dysfunction and mortality: Escherichia coli and Staphylococcus aureus challenges in a canine model of human septic shock. J Clin Invest. 1989;83:243–251.

48. Natanson C, Danner RL, Fink MP, MacVittie TJ, Walker RI, Conklin JJ, Parrillo JE. Cardiovascular performance with E. coli challenges in a canine model of human sepsis. Am J Physiol. 1988;254:H558–H569.[Abstract/Free Full Text]

49. Natanson C, Fink MP, Ballantyne HK, MacVittie TJ, Conklin JJ, Parrillo JE. Gram-negative bacteremia produces both severe systolic and diastolic cardiac dysfunction in a canine model that simulates human septic shock. J Clin Invest. 1986;78:259–270.

50. Arteaga G, White J, Horton J, Giroir B. Prevention of endotoxin-induced myocardial dysfunction with TNF blockade or IL-1 blockade. Crit Care Med. 1996;24:A144. Abstract.

51. Herbertson MJ, Werner HA, Goddard CM, Russell JA, Wheeler A, Coxon R, Walley KR. Anti-tumor necrosis factor-alpha prevents decreased ventricular contractility in endotoxemic pigs. Am J Respir Crit Care Med. 1995;152:480–488.[Abstract]

52. Lanore JJ, Dhainaut JF, Fisher CJ, Opal SM, Zimmerman J, Nightingale P, Stephens S, Schein RL, Panacek EA, Vincent JL, Foulke GE, Warren EL, Garrard C, Park G, Bodmer MW, Cohen J, van der Linden G, Sadoff JC, Pochard F, CB0006 Study Group. Effects of an anti-TNF IgG monoclonal antibody on left ventricular performance in septic patients. Intens Care Med. 1992;18:S49. Abstract.

53. Boekstegers P, Weidenhofer S, Zell R, Pilz G, Holler E, Ertel W, Kapsner T, Redl H, Schlag G, Kaul M, Kempeni J, Stenzel R, Werdan K. Repeated administration of a F(ab')2 fragment of an anti-tumor necrosis factor alpha-monoclonal antibody in patients with severe sepsis: effects on the cardiovascular system and cytokine levels. Shock. 1994;1:237–245.[Medline] [Order article via Infotrieve]

54. Katz SD, Rao R, Berman JW, Schwarz M, Demopoulos L, Bijou R, LeJemtel TH. Pathophysiological correlates of increased serum tumor necrosis factor in patients with congestive heart failure. Circulation. 1994;90:12–16.[Abstract/Free Full Text]

55. Torre-Amione G, Kapadia S, Benedict C, Oral H, Young JB, Mann DL. Proinflammatory cytokine levels in patients with depressed left ventricular ejection fraction: a report from the Studies of Left Ventricular Dysfunction (SOLVD). J Am Coll Cardiol. 1996;27:1201–1206.[Abstract]

56. Ferrari R, Bachetti T, Confortini R, Opasich C, Febo O, Corti A, Cassani G, Visioli O. Tumor necrosis factor soluble receptors in patients with various degrees of congestive heart failure. Circulation. 1995;92:1479–1486.[Abstract/Free Full Text]

57. Vaddi K, Nicolini FA, Mehta P, Mehta JL. Increased secretion of tumor necrosis factor-alpha and interferon-gamma by mononuclear leukocytes in patients with ischemic heart disease. Circulation. 1994;90:694–699.[Abstract/Free Full Text]

58. Maury CPJ, Teppo AM. Circulating tumour necrosis factor-alpha (cachectin) in myocardial infarction. J Intern Med. 1989;225:333–336.[Medline] [Order article via Infotrieve]

59. Latini R, Bianchi M, Correale E, Dinarello CA, Fantuzzi G, Fresco C, Maggioni AP, Mengozzi M, Romano S, Shapiro L, Sironi M, Tognoni G, Turato R, Ghezzi P. Cytokines in acute myocardial infarction: selective increase in circulating tumor necrosis factor, its soluble receptor, and interleukin-1 receptor antagonist. J Cardiovasc Pharmacol. 1994;23:1–6.[Medline] [Order article via Infotrieve]

60. Herskowitz A, Choi S, Ansari AA, Wesselingh S. Cytokines mRNA expression in postischemic/reperfused myocardium. Am J Pathol. 1995;146:419–428.[Abstract]

61. Chollet-Martin S, Depoix JP, Hvass U, Pansard Y, Vissuzaine C, Gougerot-Pocidalo MA. Raised plasma levels of tumor necrosis factor in heart allograft rejection. Transplant Proc. 1990;22:283–286.[Medline] [Order article via Infotrieve]

62. Casey WF, Hauser GJ, Hannallah RS, Midgley FM, Kahn WN. Circulating endotoxin and tumor necrosis factor during pediatric cardiac surgery. Crit Care Med. 1992;20:1090–1096.[Medline] [Order article via Infotrieve]

63. Hennein HA, Ebba H, Rodriguez JL, Merrick SH, Keith FM, Bronstein MH, Leung JM, Mangano DT, Greenfield LJ, Rankin JS. Relationship of the proinflammatory cytokines to myocardial ischemia and dysfunction after uncomplicated coronary revascularization. J Thorac Cardiovasc Surg. 1994;108:626–635.[Abstract/Free Full Text]

64. Hattler BG, Zeevl A, Oddis CV, Finkel MS. Cytokine induction during cardiac surgery: analysis of TNF-alpha expression pre- and postcardiopulmonary bypass. J Card Surg. 1995;10:418–422.[Medline] [Order article via Infotrieve]

65. Olivetti G, Abbi R, Quaini F, Kajstura J, Cheng W, Nitahara JA, Quaini E, DiLoreto C, Beltrami CA, Krajewski S, Reed JC, Anversa P. Apoptosis in the failing human heart. N Engl J Med. 1997;336:1131–1141.[Abstract/Free Full Text]

66. Kubota T, McTierman CF, Frye CS, Demetris AJ, Feldman AM. Cardiac-specific overexpression of tumor necrosis factor-alpha causes lethal myocarditis in transgenic mice. J Am Coll Cardiol. 1997;22(suppl A):346A. Abstract.

67. Geller DA, Lowenstein CJ, Shapiro RA, Nussler AK, Di Silvio M, Wang SC, Nakayama DK, Simmons RL, Snyder SH, Billiar TR. Molecular cloning and expression of inducible nitric oxide synthase from human hepatocytes. Proc Natl Acad Sci U S A. 1993;90:3491–3495.[Abstract/Free Full Text]

68. Schmid EF, Binder K, Grell M, Scheurich P, Pfizenmaier K. Both tumor necrosis factor receptors, TNFR60 and TNFR80, are involved in signaling endothelial tissue factor expression by juxtacrine tumor necrosis factor alpha. Blood. 1995;86:1836–1841.[Abstract/Free Full Text]

69. Bierhaus A, Zhang Y, Deng Y, Mackman N, Quehenberger P, Haase M, Luther T, Muller M, Bohrer H, Greten J. Mechanism of tumor necrosis factor alpha-mediated induction of endothelial tissue factor. J Biol Chem. 1995;270:26419–26432.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
L. J. Jobe, G. C. Melendez, S. P. Levick, Y. Du, G. L. Brower, and J. S. Janicki
TNF-{alpha} inhibition attenuates adverse myocardial remodeling in a rat model of volume overload
Am J Physiol Heart Circ Physiol, October 1, 2009; 297(4): H1462 - H1468.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
W. Peng, Y. Zhang, W. Zhu, C.-M. Cao, and R.-P. Xiao
AMPK and TNF-{alpha} at the crossroad of cell survival and death in ischaemic heart
Cardiovasc Res, October 1, 2009; 84(1): 1 - 3.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Frantz, J. Bauersachs, and G. Ertl
Post-infarct remodelling: contribution of wound healing and inflammation
Cardiovasc Res, February 15, 2009; 81(3): 474 - 481.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
F. Cambronero, F. Marin, V. Roldan, D. Hernandez-Romero, M. Valdes, and G. Y.H. Lip
Biomarkers of pathophysiology in hypertrophic cardiomyopathy: implications for clinical management and prognosis
Eur. Heart J., January 9, 2009; (2009) ehn538v1.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F. Bogazzi, D. Russo, F. Raggi, F. Ultimieri, C. Urbani, M. Gasperi, L. Bartalena, and E. Martino
Transgenic Mice Overexpressing Growth Hormone (GH) Have Reduced or Increased Cardiac Apoptosis through Activation of Multiple GH-Dependent or -Independent Cell Death Pathways
Endocrinology, November 1, 2008; 149(11): 5758 - 5769.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. M. Dunlay, S. A. Weston, M. M. Redfield, J. M. Killian, and V. L. Roger
Tumor Necrosis Factor-{alpha} and Mortality in Heart Failure: A Community Study
Circulation, August 5, 2008; 118(6): 625 - 631.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
C. Leipner, K. Grun, A. Muller, E. Buchdunger, L. Borsi, H. Kosmehl, A. Berndt, T. Janik, A. Uecker, M. Kiehntopf, et al.
Imatinib mesylate attenuates fibrosis in coxsackievirus b3-induced chronic myocarditis
Cardiovasc Res, July 1, 2008; 79(1): 118 - 126.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
N. A. Turner, R. S. Mughal, P. Warburton, D. J. O'Regan, S. G. Ball, and K. E. Porter
Mechanism of TNF{alpha}-induced IL-1{alpha}, IL-1{beta} and IL-6 expression in human cardiac fibroblasts: Effects of statins and thiazolidinediones
Cardiovasc Res, October 1, 2007; 76(1): 81 - 90.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. Reifenberg, H.-A. Lehr, M. Torzewski, G. Steige, E. Wiese, I. Kupper, C. Becker, S. Ott, P. Nusser, K.-I. Yamamura, et al.
Interferon-{gamma} Induces Chronic Active Myocarditis and Cardiomyopathy in Transgenic Mice
Am. J. Pathol., August 1, 2007; 171(2): 463 - 472.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
D. L. Carlson, D. L. Maass, J. White, P. Sikes, and J. W. Horton
Caspase inhibition reduces cardiac myocyte dyshomeostasis and improves cardiac contractile function after major burn injury
J Appl Physiol, July 1, 2007; 103(1): 323 - 330.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Fernandez-Velasco, G. Ruiz-Hurtado, O. Hurtado, M. A. Moro, and C. Delgado
TNF-{alpha} downregulates transient outward potassium current in rat ventricular myocytes through iNOS overexpression and oxidant species generation
Am J Physiol Heart Circ Physiol, July 1, 2007; 293(1): H238 - H245.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. L. Spector, Y. Yarden, B. Smith, L. Lyass, P. Trusk, K. Pry, J. E. Hill, W. Xia, R. Seger, and S. S. Bacus
Activation of AMP-activated protein kinase by human EGF receptor 2/EGF receptor tyrosine kinase inhibitor protects cardiac cells
PNAS, June 19, 2007; 104(25): 10607 - 10612.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
O. Zimmermann, M. Kochs, T. P. Zwaka, M. Bienek-Ziolkowski, M. Hoher, V. Hombach, and J. Torzewski
Prognostic role of myocardial tumor necrosis factor-alpha and terminal complement complex expression in patients with dilated cardiomyopathy
Eur J Heart Fail, January 1, 2007; 9(1): 51 - 54.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
M. Satoh, Y. Shimoda, T. Akatsu, Y. Ishikawa, Y. Minami, and M. Nakamura
Elevated circulating levels of heat shock protein 70 are related to systemic inflammatory reaction through monocyte Toll signal in patients with heart failure after acute myocardial infarction
Eur J Heart Fail, December 1, 2006; 8(8): 810 - 815.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. N. Mazzadi, X. Andre-Fouet, N. Costes, P. Croisille, D. Revel, and M. F. Janier
Mechanisms leading to reversible mechanical dysfunction in severe CAD: alternatives to myocardial stunning
Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2570 - H2582.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
G. S. Hoare, E. J. Birks, C. Bowles, N. Marczin, and M. H. Yacoub
In vitro endothelial cell activation and inflammatory responses in end-stage heart failure
J Appl Physiol, November 1, 2006; 101(5): 1466 - 1473.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
X.-S. Zhao, W. Pan, R. Bekeredjian, and R. V. Shohet
Endogenous Endothelin-1 Is Required for Cardiomyocyte Survival In Vivo
Circulation, August 22, 2006; 114(8): 830 - 837.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. L. Hayward, N. Bautista-Lopez, K. Suzuki, A. Atrazhev, P. Dickie, and J. F. Elliott
CD4 T Cells Play Major Effector Role and CD8 T Cells Initiating Role in Spontaneous Autoimmune Myocarditis of HLA-DQ8 Transgenic IAb Knockout Nonobese Diabetic Mice.
J. Immunol., June 15, 2006; 176(12): 7715 - 7725.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. S. Petkova-Kirova, E. Gursoy, H. Mehdi, C. F. McTiernan, B. London, and G. Salama
Electrical remodeling of cardiac myocytes from mice with heart failure due to the overexpression of tumor necrosis factor-{alpha}
Am J Physiol Heart Circ Physiol, May 1, 2006; 290(5): H2098 - H2107.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
L. Li, G. Takemura, Y. Li, S. Miyata, M. Esaki, H. Okada, H. Kanamori, N. C. Khai, R. Maruyama, A. Ogino, et al.
Preventive Effect of Erythropoietin on Cardiac Dysfunction in Doxorubicin-Induced Cardiomyopathy
Circulation, January 31, 2006; 113(4): 535 - 543.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
G. Hall, I. S. Singh, L. Hester, J. D. Hasday, and T. B. Rogers
Inhibitor-{kappa}B kinase-{beta} regulates LPS-induced TNF-{alpha} production in cardiac myocytes through modulation of NF-{kappa}B p65 subunit phosphorylation
Am J Physiol Heart Circ Physiol, November 1, 2005; 289(5): H2103 - H2111.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. Grundmann, I. Hoefer, S. Ulusans, N. van Royen, S. H. Schirmer, C. K. Ozaki, C. Bode, J. J. Piek, and I. Buschmann
Anti-tumor necrosis factor-{alpha} therapies attenuate adaptive arteriogenesis in the rabbit
Am J Physiol Heart Circ Physiol, October 1, 2005; 289(4): H1497 - H1505.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
Z Yuan, Y Liu, Y Liu, J Zhang, C Kishimoto, Y Wang, A Ma, and Z Liu
Cardioprotective effects of peroxisome proliferator activated receptor {gamma} activators on acute myocarditis: anti-inflammatory actions associated with nuclear factor {kappa}B blockade
Heart, September 1, 2005; 91(9): 1203 - 1208.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
K. Yoshizawa, G. E. Kissling, J. A. Johnson, N. P. Clayton, N. D. Flagler, and A. Nyska
Chemical-Induced Atrial Thrombosis in NTP Rodent Studies
Toxicol Pathol, August 1, 2005; 33(5): 517 - 532.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
M. Satoh, M. Nakamura, T. Akatsu, Y. Shimoda, I. Segawa, and K. Hiramori
Myocardial osteopontin expression is associated with collagen fibrillogenesis in human dilated cardiomyopathy
Eur J Heart Fail, August 1, 2005; 7(5): 755 - 762.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
M Vanderheyden, W J Paulus, M Voss, P Knuefermann, N Sivasubramanian, D Mann, and G Baumgarten
Myocardial cytokine gene expression is higher in aortic stenosis than in idiopathic dilated cardiomyopathy
Heart, July 1, 2005; 91(7): 926 - 931.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Brown, M. McGuinness, T. Wright, X. Ren, Y. Wang, G. P. Boivin, H. Hahn, A. M. Feldman, and W. K. Jones
Cardiac-specific blockade of NF-{kappa}B in cardiac pathophysiology: differences between acute and chronic stimuli in vivo
Am J Physiol Heart Circ Physiol, July 1, 2005; 289(1): H466 - H476.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
N. Kawamura, T. Kubota, S. Kawano, Y. Monden, A. M. Feldman, H. Tsutsui, A. Takeshita, and K. Sunagawa
Blockade of NF-{kappa}B improves cardiac function and survival without affecting inflammation in TNF-{alpha}-induced cardiomyopathy
Cardiovasc Res, June 1, 2005; 66(3): 520 - 529.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. Li, D. Georgakopoulos, G. Lu, L. Hester, D. A. Kass, J. Hasday, and Y. Wang
p38 MAP Kinase Mediates Inflammatory Cytokine Induction in Cardiomyocytes and Extracellular Matrix Remodeling in Heart
Circulation, May 17, 2005; 111(19): 2494 - 2502.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
K. Grun, B. Markova, F.-D. Bohmer, A. Berndt, H. Kosmehl, and C. Leipner
Elevated expression of PDGF-C in coxsackievirus B3-induced chronic myocarditis
Eur. Heart J., April 1, 2005; 26(7): 728 - 739.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
X. Meng, L. Ao, Y. Song, C. D. Raeburn, D. A. Fullerton, and A. H. Harken
Signaling for myocardial depression in hemorrhagic shock: roles of Toll-like receptor 4 and p55 TNF-{alpha} receptor
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2005; 288(3): R600 - R606.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
K. E. Porter, N. A. Turner, D. J. O'Regan, and S. G. Ball
Tumor necrosis factor {alpha} induces human atrial myofibroblast proliferation, invasion and MMP-9 secretion: inhibition by simvastatin
Cardiovasc Res, December 1, 2004; 64(3): 507 - 515.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. Hikoso, O. Yamaguchi, Y. Higuchi, S. Hirotani, T. Takeda, K. Kashiwase, T. Watanabe, M. Taniike, I. Tsujimoto, M. Asahi, et al.
Pressure Overload Induces Cardiac Dysfunction and Dilation in Signal Transducer and Activator of Transcription 6-Deficient Mice
Circulation, October 26, 2004; 110(17): 2631 - 2637.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. Bourraindeloup, C. Adamy, G. Candiani, M. Cailleret, M.-C. Bourin, T. Badoual, J. B. Su, S. Adubeiro, F. Roudot-Thoraval, J.-L. Dubois-Rande, et al.
N-Acetylcysteine Treatment Normalizes Serum Tumor Necrosis Factor-{alpha} Level and Hinders the Progression of Cardiac Injury in Hypertensive Rats
Circulation, October 5, 2004; 110(14): 2003 - 2009.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. Engel, R. Peshock, R. C. Armstong, N. Sivasubramanian, and D. L. Mann
Cardiac myocyte apoptosis provokes adverse cardiac remodeling in transgenic mice with targeted TNF overexpression
Am J Physiol Heart Circ Physiol, September 1, 2004; 287(3): H1303 - H1311.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
K. Sekiguchi, X. Li, M. Coker, M. Flesch, P. M Barger, N. Sivasubramanian, and D. L Mann
Cross-regulation between the renin-angiotensin system and inflammatory mediators in cardiac hypertrophy and failure
Cardiovasc Res, August 15, 2004; 63(3): 433 - 442.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
J. M. Edelberg, A. Wong, J. M. Holm, M. Xaymardan, I. Duignan, A. Chin, J. R. Kizer, and D. Cai
Phage display identification of age-associated TNF{alpha}-mediated cardiac oxidative induction
Physiol Genomics, August 11, 2004; 18(3): 255 - 260.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. Berthonneche, T. Sulpice, F. Boucher, L. Gouraud, J. de Leiris, S. E. O'Connor, J.-M. Herbert, and P. Janiak
New insights into the pathological role of TNF-{alpha} in early cardiac dysfunction and subsequent heart failure after infarction in rats
Am J Physiol Heart Circ Physiol, July 1, 2004; 287(1): H340 - H350.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Nian, P. Lee, N. Khaper, and P. Liu
Inflammatory Cytokines and Postmyocardial Infarction Remodeling
Circ. Res., June 25, 2004; 94(12): 1543 - 1553.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
O. Appoloni, E. Dupont, M. Vandercruys, M. Andrien, J. Duchateau, and J.-L. Vincent
Association Between the TNF-2 Allele and a Better Survival in Cardiogenic Shock
Chest, June 1, 2004; 125(6): 2232 - 2237.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
P. O. Scumpia, P. J. Sarcia, K. M. Kelly, V. G. DeMarco, and J. W. Skimming
Hypothermia Induces Anti-Inflammatory Cytokines and Inhibits Nitric Oxide and Myeloperoxidase-Mediated Damage in the Hearts of Endotoxemic Rats
Chest, April 1, 2004; 125(4): 1483 - 1491.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
T. Tsutamoto, A. Wada, M. Ohnishi, T. Tsutsui, C. Ishii, K. Ohno, M. Fujii, T. Matsumoto, T. Yamamoto, T. Takayama, et al.
Transcardiac increase in tumor necrosis factor-{alpha} and left ventricular end-diastolic volume in patients with dilated cardiomyopathy
Eur J Heart Fail, March 1, 2004; 6(2): 173 - 180.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
L. L. Yang, R. Gros, M. G. Kabir, A. Sadi, A. I. Gotlieb, M. Husain, and D. J. Stewart
Conditional Cardiac Overexpression of Endothelin-1 Induces Inflammation and Dilated Cardiomyopathy in Mice
Circulation, January 20, 2004; 109(2): 255 - 261.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
L. B. Garner, M. S. Willis, D. L. Carlson, J. M. DiMaio, M. D. White, D. J. White, G. A. Adams IV, J. W. Horton, and B. P. Giroir
Macrophage migration inhibitory factor is a cardiac-derived myocardial depressant factor
Am J Physiol Heart Circ Physiol, December 1, 2003; 285(6): H2500 - H2509.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. F. Elliott, J. Liu, Z.-N. Yuan, N. Bautista-Lopez, S. L. Wallbank, K. Suzuki, D. Rayner, P. Nation, M. A. Robertson, G. Liu, et al.
Autoimmune cardiomyopathy and heart block develop spontaneously in HLA-DQ8 transgenic IA{beta} knockout NOD mice
PNAS, November 11, 2003; 100(23): 13447 - 13452.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Z. I. Dibbs, A. Diwan, S. Nemoto, G. DeFreitas, M. Abdellatif, B. A. Carabello, F. G. Spinale, G. Feuerstein, N. Sivasubramanian, and D. L. Mann
Targeted Overexpression of Transmembrane Tumor Necrosis Factor Provokes a Concentric Cardiac Hypertrophic Phenotype
Circulation, August 26, 2003; 108(8): 1002 - 1008.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. Flesch, A. Hoper, L. Dell'Italia, K. Evans, R. Bond, R. Peshock, A. Diwan, T. A. Brinsa, C.-C. Wei, N. Sivasubramanian, et al.
Activation and Functional Significance of the Renin-Angiotensin System in Mice With Cardiac Restricted Overexpression of Tumor Necrosis Factor
Circulation, August 5, 2003; 108(5): 598 - 604.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. Aker, S. Belosjorow, I. Konietzka, A. Duschin, C. Martin, G. Heusch, and R. Schulz
Serum but not myocardial TNF-{alpha} concentration is increased in pacing-induced heart failure in rabbits
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2003; 285(2): R463 - R469.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. A. Thomas, S. B. Haudek, T. Koroglu, M. F. Tsen, D. D. Bryant, D. J. White, D. F. Kusewitt, J. W. Horton, and B. P. Giroir
IRAK1 deletion disrupts cardiac Toll/IL-1 signaling and protects against contractile dysfunction
Am J Physiol Heart Circ Physiol, August 1, 2003; 285(2): H597 - H606.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. Cai, M. Xaymardan, J. M. Holm, J. Zheng, J. R. Kizer, and J. M. Edelberg
Age-associated impairment in TNF-{alpha} cardioprotection from myocardial infarction
Am J Physiol Heart Circ Physiol, July 11, 2003; 285(2): H463 - H469.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
K. J. Kelly
Distant Effects of Experimental Renal Ischemia/Reperfusion Injury
J. Am. Soc. Nephrol., June 1, 2003; 14(6): 1549 - 1558.
[Abstract] [Full Text] [PDF]


Home page
ANN INTERN MEDHome page
H. J. Kwon, T. R. Cote, M. S. Cuffe, J. M. Kramer, and M M. Braun
Case Reports of Heart Failure after Therapy with a Tumor Necrosis Factor Antagonist
Ann Intern Med, May 20, 2003; 138(10): 807 - 811.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. A. Fortuno, A. Gonzalez, S. Ravassa, B. Lopez, and J. Diez
Clinical implications of apoptosis in hypertensive heart disease
Am J Physiol Heart Circ Physiol, May 1, 2003; 284(5): H1495 - H1506.
[Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. Klingel, J.-J. Schnorr, M. Sauter, G. Szalay, and R. Kandolf
{beta}2-Microglobulin-Associated Regulation of Interferon-{gamma} and Virus-Specific Immunoglobulin G Confer Resistance Against the Development of Chronic Coxsackievirus Myocarditis
Am. J. Pathol., May 1, 2003; 162(5): 1709 - 1720.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. S. Vasan, L. M. Sullivan, R. Roubenoff, C. A. Dinarello, T. Harris, E. J. Benjamin, D. B. Sawyer, D. Levy, P. W.F. Wilson, and R. B. D'Agostino
Inflammatory Markers and Risk of Heart Failure in Elderly Subjects Without Prior Myocardial Infarction: The Framingham Heart Study
Circulation, March 25, 2003; 107(11): 1486 - 1491.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
C.-H. Wang, R. D. Weisel, P. P. Liu, P. W.M. Fedak, and S. Verma
Glitazones and Heart Failure: Critical Appraisal for the Clinician
Circulation, March 18, 2003; 107(10): 1350 - 1354.
[Full Text] [PDF]


Home page
CirculationHome page
H. Oral, N. Sivasubramanian, D. B. Dyke, R. H. Mehta, P. M. Grossman, K. Briesmiester, W. P. Fay, F. D. Pagani, S. F. Bolling, D. L. Mann, et al.
Myocardial Proinflammatory Cytokine Expression and Left Ventricular Remodeling in Patients With Chronic Mitral Regurgitation
Circulation, February 18, 2003; 107(6): 831 - 837.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Y. Machida, T. Kubota, N. Kawamura, H. Funakoshi, T. Ide, H. Utsumi, Y. Y. Li, A. M. Feldman, H. Tsutsui, H. Shimokawa, et al.
Overexpression of tumor necrosis factor-alpha increases production of hydroxyl radical in murine myocardium
Am J Physiol Heart Circ Physiol, February 1, 2003; 284(2): H449 - H455.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
P A Henriksen and D E Newby
Therapeutic inhibition of tumour necrosis factor {alpha} in patients with heart failure: cooling an inflamed heart
Heart, January 1, 2003; 89(1): 14 - 18.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
P. J. Pugh, R. D. Jones, T.H. Jones, and K. S. Channer
Heart failure as an inflammatory condition: potential role for androgens as immune modulators
Eur J Heart Fail, December 1, 2002; 4(6): 673 - 680.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart J SupplHome page
M. Afanasyeva and N.R. Rose
Immune mediators in inflammatory heart disease: insights from a mouse model
Eur. Heart J. Suppl., December 1, 2002; 4(suppl_I): I31 - I36.
[Abstract] [PDF]


Home page
Circ. Res.Home page
D. L. Mann
Inflammatory Mediators and the Failing Heart: Past, Present, and the Foreseeable Future
Circ. Res., November 29, 2002; 91(11): 988 - 998.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. R. R. Heyen, E. R. Blasi, K. Nikula, R. Rocha, H. A. Daust, G. Frierdich, J. F. Van Vleet, P. De Ciechi, E. G. McMahon, and A. E. Rudolph
Structural, functional, and molecular characterization of the SHHF model of heart failure
Am J Physiol Heart Circ Physiol, November 1, 2002; 283(5): H1775 - H1784.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. D. Raeburn, C. A. Dinarello, M. A. Zimmerman, C. M. Calkins, B. J. Pomerantz, R. C. McIntyre Jr., A. H. Harken, and X. Meng
Neutralization of IL-18 attenuates lipopolysaccharide-induced myocardial dysfunction
Am J Physiol Heart Circ Physiol, August 1, 2002; 283(2): H650 - H657.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Afanasyeva and N. R. Rose
Cardiomyopathy Is Linked to Complement Activation
Am. J. Pathol., August 1, 2002; 161(2): 351 - 357.
[Full Text] [PDF]


Home page
FASEB J.Home page
R. MORI, T. KONDO, T. OHSHIMA, Y. ISHIDA, and N. MUKAIDA
Accelerated wound healing in tumor necrosis factor receptor p55-deficient mice with reduced leukocyte infiltration
FASEB J, July 1, 2002; 16(9): 963 - 974.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
H. Funakoshi, T. Kubota, N. Kawamura, Y. Machida, A. M. Feldman, H. Tsutsui, H. Shimokawa, and A. Takeshita
Disruption of Inducible Nitric Oxide Synthase Improves {beta}-Adrenergic Inotropic Responsiveness but Not the Survival of Mice With Cytokine-Induced Cardiomyopathy
Circ. Res., May 17, 2002; 90(9): 959 - 965.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Stypmann, K. Glaser, W. Roth, D. J. Tobin, I. Petermann, R. Matthias, G. Monnig, W. Haverkamp, G. Breithardt, W. Schmahl, et al.
Dilated cardiomyopathy in mice deficient for the lysosomal cysteine peptidase cathepsin L
PNAS, April 18, 2002; (2002) 92637699.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
D. B. Sawyer and J. Loscalzo
Myocardial Hibernation: Restorative or Preterminal Sleep?
Circulation, April 2, 2002; 105(13): 1517 - 1519.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Yndestad, J. Kristian Damas, H. Geir Eiken, T. Holm, T. Haug, S. Simonsen, S. S. Froland, L. Gullestad, and P. Aukrust
Increased gene expression of tumor necrosis factor superfamily ligands in peripheral blood mononuclear cells during chronic heart failure
Cardiovasc Res, April 1, 2002; 54(1): 175 - 182.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
G. Wright, I. S. Singh, J. D. Hasday, I. K. Farrance, G. Hall, A. S. Cross, and T. B. Rogers
Endotoxin stress-response in cardiomyocytes: NF-kappa B activation and tumor necrosis factor-alpha expression
Am J Physiol Heart Circ Physiol, March 1, 2002; 282(3): H872 - H879.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
W. S. Bradham, B. Bozkurt, H. Gunasinghe, D. Mann, and F. G. Spinale
Tumor necrosis factor-alpha and myocardial remodeling in progression of heart failure: a current perspective
Cardiovasc Res, March 1, 2002; 53(4): 822 - 830.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
C G Densem, I V Hutchinson, N Yonan, and N H Brooks
Tumour necrosis factor {alpha} gene polymorphism: a predisposing factor to non-ischaemic myocardial dysfunction?
Heart, February 1, 2002; 87(2): 153 - 155.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
D. Hilfiker-Kleiner, A. Hilfiker, B. Schieffer, D. Engel, D. L Mann, K. C Wollert, and H. Drexler
TNF{alpha} decreases {alpha}MHC expression by a NO mediated pathway: role of E-box transcription factors for cardiomyocyte specific gene regulation
Cardiovasc Res, February 1, 2002; 53(2): 460 - 469.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
A.L. Clark, M. Loebe, E.V. Potapov, K. Egerer, C. Knosalla, R. Hetzer, and S.D. Anker
Ventricular assist device in severe heart failure. Effects on cytokines, complement and body weight
Eur. Heart J., December 2, 2001; 22(24): 2275 - 2283.
[Abstract] [PDF]


Home page
HypertensionHome page
A. L. Farre and S. Casado
Heart Failure, Redox Alterations, and Endothelial Dysfunction
Hypertension, December 1, 2001; 38(6): 1400 - 1405.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
C. Stamm, I. Friehs, D. B. Cowan, A. M. Moran, H. Cao-Danh, L. F. Duebener, P. J. del Nido, and F. X. McGowan Jr
Inhibition of Tumor Necrosis Factor-{alpha} Improves Postischemic Recovery of Hypertrophied Hearts
Circulation, September 18, 2001; 104 (2009): I-350 - I-355.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
N. Sivasubramanian, M. L. Coker, K. M. Kurrelmeyer, W. R. MacLellan, F. J. DeMayo, F. G. Spinale, and D. L. Mann
Left Ventricular Remodeling in Transgenic Mice With Cardiac Restricted Overexpression of Tumor Necrosis Factor
Circulation, August 14, 2001; 104(7): 826 - 831.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. J. Stetson, A. Perez-Verdia, W. Mazur, J. A. Farmer, M. M. Koerner, D. G. Weilbaecher, M. L. Entman, M. A. Quinones, G. P. Noon, and G. Torre-Amione
Cardiac Hypertrophy After Transplantation Is Associated With Persistent Expression of Tumor Necrosis Factor-{alpha}
Circulation, August 7, 2001; 104(6): 676 - 681.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
T. Tsutamoto, A. Wada, T. Matsumoto, K. Maeda, N. Mabuchi, M. Hayashi, T. Tsutsui, M. Ohnishi, M. Sawaki, M. Fujii, et al.
Relationship between tumor necrosis factor-alpha production and oxidative stress in the failing hearts of patients with dilated cardiomyopathy
J. Am. Coll. Cardiol., June 15, 2001; 37(8): 2086 - 2092.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
E. Braunwald
Congestive heart failure: a half century perspective
Eur. Heart J., May 2, 2001; 22(10): 825 - 836.
[PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. Ballard-Croft, D. J. White, D. L. Maass, D. P. Hybki, and J. W. Horton
Role of p38 mitogen-activated protein kinase in cardiac myocyte secretion of the inflammatory cytokine TNF-{alpha}
Am J Physiol Heart Circ Physiol, May 1, 2001; 280(5): H1970 - H1981.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. J. Giordano, H.-P. Gerber, S.-P. Williams, N. VanBruggen, S. Bunting, P. Ruiz-Lozano, Y. Gu, A. K. Nath, Y. Huang, R. Hickey, et al.
A cardiac myocyte vascular endothelial growth factor paracrine pathway is required to maintain cardiac function
PNAS, April 25, 2001; (2001) 91415198.
[Abstract] [Full Text]


Home page
CirculationHome page
S. F. Nagueh, S. J. Stetson, N. M. Lakkis, D. Killip, A. Perez-Verdia, M. L. Entman, W. H. Spencer III, and G. Torre-Amione
Decreased Expression of Tumor Necrosis Factor-{{alpha}} and Regression of Hypertrophy After Nonsurgical Septal Reduction Therapy for Patients With Hypertrophic Obstructive Cardiomyopathy
Circulation, April 10, 2001; 103(14): 1844 - 1850.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. L. Graciano, D. D. Bryant, D. J. White, J. Horton, N. E. Bowles, and B. P. Giroir
Targeted disruption of ICAM-1, P-selectin genes improves cardiac function and survival in TNF-{alpha} transgenic mice
Am J Physiol Heart Circ Physiol, April 1, 2001; 280(4): H1464 - H1471.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. G. Weiss
Imaging the Murine Cardiovascular System With Magnetic Resonance
Circ. Res., March 30, 2001; 88(6): 550 - 551.
[Full Text] [PDF]


Home page
Circ. Res.Home page
F. Wiesmann, J. Ruff, S. Engelhardt, L. Hein, C. Dienesch, A. Leupold, R. Illinger, A. Frydrychowicz, K.-H. Hiller, E. Rommel, et al.
Dobutamine-Stress Magnetic Resonance Microimaging in Mice : Acute Changes of Cardiac Geometry and Function in Normal and Failing Murine Hearts
Circ. Res., March 30, 2001; 88(6): 563 - 569.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
W. W. Parmley
How Many Medicines Do Patients With Heart Failure Need?
Circulation, March 27, 2001; 103(12): 1611 - 1612.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. B. Haudek, E. Spencer, D. D. Bryant, D. J. White, D. Maass, J. W. Horton, Z. J. Chen, and B. P. Giroir
Overexpression of cardiac I-{kappa}B{alpha} prevents endotoxin-induced myocardial dysfunction
Am J Physiol Heart Circ Physiol, March 1, 2001; 280(3): H962 - H968.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. Li, R. L. Kao, T. Ha, J. Kelley, I. W. Browder, and D. L. Williams
Early activation of IKK{beta} during in vivo myocardial ischemia
Am J Physiol Heart Circ Physiol, March 1, 2001; 280(3): H1264 - H1271.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
D. L. Mann
Tumor Necrosis Factor and Viral Myocarditis: The Fine Line Between Innate and Inappropriate Immune Responses in the Heart
Circulation, February 6, 2001; 103(5): 626 - 629.
[Full Text] [PDF]


Home page
CirculationHome page
H. Wada, K. Saito, T. Kanda, I. Kobayashi, H. Fujii, S. Fujigaki, N. Maekawa, H. Takatsu, H. Fujiwara, K. Sekikawa, et al.
Tumor Necrosis Factor-{{alpha}} (TNF-{{alpha}}) Plays a Protective Role in Acute Viral Myocarditis in Mice : A Study Using Mice Lacking TNF-{{alpha}}
Circulation, February 6, 2001; 103(5): 743 - 749.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
T. Ohtsuka, M. Hamada, G. Hiasa, O. Sasaki, M. Suzuki, Y. Hara, Y. Shigematsu, and K. Hiwada
Effect of beta-blockers on circulating levels of inflammatory and anti-inflammatory cytokines in patients with dilated cardiomyopathy
J. Am. Coll. Cardiol., February 1, 2001; 37(2): 412 - 417.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
X. Li, M. R. Moody, D. Engel, S. Walker, F. J. Clubb Jr, N. Sivasubramanian, D. L. Mann, and M. B. Reid
Cardiac-Specific Overexpression of Tumor Necrosis Factor-{alpha} Causes Oxidative Stress and Contractile Dysfunction in Mouse Diaphragm
Circulation, October 3, 2000; 102(14): 1690 - 1696.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
M. Satoh, M. Nakamura, H. Satoh, H. Saitoh, I. Segawa, and K. Hiramori
Expression of tumor necrosis factor-alpha-converting enzyme and tumor necrosis factor-alpha in human myocarditis
J. Am. Coll. Cardiol., October 1, 2000; 36(4): 1288 - 1294.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bryant, D.
Right arrow Articles by Giroir, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bryant, D.
Right arrow Articles by Giroir, B.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Cardiomyopathy
*Heart Failure