This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Li, H. Articles by Towbin, J. A. Search for Related Content PubMed PubMed Citation Articles by Li, H. Articles by Towbin, J. A.

(Circulation. 1998;97:1264-1269.)
© 1998 American Heart Association, Inc.

Clinical Investigation and Reports

New Mutations in the KVLQT1 Potassium Channel That Cause Long-QT Syndrome

Hua Li, PhD; Qiuyun Chen, PhD; Arthur J. Moss, MD; Jennifer Robinson, MS; Veronica Goytia, BS; James C. Perry, MD; G. Michael Vincent, MD; Silvia G. Priori, MD; Michael H. Lehmann, MD; Susan W. Denfield, MD; Desmond Duff, MD; Stephen Kaine, MD; Wataru Shimizu, MD; Peter J. Schwartz, MD; Qing Wang, PhD; ; Jeffrey A. Towbin, MD

From Lillie Frank Abercrombie Section of Cardiology, Department of Pediatrics (H.L, Q.C., V.G., S.W.D., Q.W., J.A.T.), and Department of Molecular and Human Genetics (J.A.T.), Baylor College of Medicine, Houston, Tex; Children's Hospital and Health Center, San Diego, Calif (J.C.P.); Department of Medicine, University of Rochester Medical Center, Rochester, NY (A.J.M., J.R.); Department of Medicine, LDS Hospital and University of Utah School of Medicine, Salt Lake City (G.M.V.); Department of Cardiology, University of Pavia and Policlinico S. Matteo, IFCCS, Pavia, Italy (S.G.P., P.J.S.); Arrhythmia Center, Sinai Hospital, Wayne State University School of Medicine, Detroit, Mich (M.H.L.); Pediatric Cardiology, Our Lady's Hospital for Sick Children, Dublin, Ireland (D.D.); Pediatric Cardiology, Children's Mercy Hospital, Kansas City, Mo (S.K.); and National Cardiovascular Center, Osaka, Japan (W.S.).

Correspondence to Jeffrey A. Towbin, MD, Pediatrics (Cardiology), Baylor College of Medicine, One Baylor Plaza, Room 333E, Houston, TX 77030. E-mail jtowbin{at}bcm.tmc.edu

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background—Long-QT syndrome (LQTS) is an inherited cardiac arrhythmia that causes sudden death in young, otherwise healthy people. Four genes for LQTS have been mapped to chromosome 11p15.5 (LQT1), 7q35–36 (LQT2), 3p21–24 (LQT3), and 4q25–27 (LQT4). Genes responsible for LQT1, LQT2, and LQT3 have been identified as cardiac potassium channel genes (KVLQT1, HERG) and the cardiac sodium channel gene (SCN5A).

Methods and Results—After studying 115 families with LQTS, we used single-strand conformation polymorphism (SSCP) and DNA sequence analysis to identify mutations in the cardiac potassium channel gene, KVLQT1. Affected members of seven LQTS families were found to have new, previously unidentified mutations, including two identical missense mutations, four identical splicing mutations, and one 3-bp deletion. An identical splicing mutation was identified in affected members of four unrelated families (one Italian, one Irish, and two American), leading to an alternatively spliced form of KVLQT1. The 3-bp deletion arose de novo and occurs at an exon-intron boundary. This results in a single base deletion in the KVLQT1 cDNA sequence and alters splicing, leading to the truncation of KVLQT1 protein.

Conclusions—We have identified LQTS-causing mutations of KVLQT1 in seven families. Five KVLQT1 mutations cause the truncation of KVLQT1 protein. These data further confirm that KVLQT1 mutations cause LQTS. The location and character of these mutations expand the types of mutation, confirm a mutational hot spot, and suggest that they act through a loss-of-function mechanism or a dominant-negative mechanism.

Key Words: arrhythmias • long-QT syndrome • potassium • death, sudden • KVLQT1

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Sudden death from cardiac arrhythmias is thought to account for 11% of all natural deaths.^{1 2} LQTS is an inherited cardiac disorder that causes syncope, seizures, and sudden death, usually in young and otherwise healthy individuals.^{3 4 5 6 7 8} In many cases, the first symptom is sudden death. Individuals with LQTS usually have prolongation of the QT interval on electrocardiograms, an indication of abnormal repolarization.^{5 9 10} The clinical features of LQTS result from episodic ventricular tachyarrhythmias, specifically torsade de pointes and ventricular fibrillation.^{9 10 11}

Inherited LQTS can result from at least five different genes. Four genes were mapped to chromosome 11p15.5 (LQT1),^{12 13} 7q35–36 (LQT2),¹⁴ 3p21–24 (LQT3),¹⁴ and 4q25–27 (LQT4).¹⁵ Several other families with autosomal dominant LQTS are not linked to any known LQTS loci (unpublished data), indicating that additional LQTS locus heterogeneity exists. Three LQTS genes (LQT1, LQT2, and LQT3) were identified either by the candidate gene approach or positional cloning. These include the cardiac potassium channel genes KVLQT1 (LQT1),¹⁶ HERG (LQT2),¹⁷ and the cardiac sodium channel gene SCN5A (LQT3).^{18 19} In addition, mutations in KVLQT1 were shown to result in both Romano-Ward syndrome (heterozygous mutations) and Jervell and Lange-Nielsen syndrome (homozygous mutations).^{16 20} Wang et al¹⁶ identified 11 different types of KVLQT1 mutations (one 3-bp deletion and 10 missense mutations) in 16 LQTS families with Romano-Ward syndrome and, more recently, Neyroud et al²⁰ identified a homozygous insertion-deletion mutation in Jervell and Lange-Nielsen syndrome.¹⁶ Here, we report identification of new KVLQT1 mutations in affected members of seven families with Romano-Ward syndrome. We identified two identical missense mutations (one in a white kindred and the other in a Japanese family), four identical splicing mutations, and a 3-bp deletion that truncates the KVLQT1 channel; the latter mutation arose de novo.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Identification of LQTS Patients
LQTS patients were identified throughout North America, Europe, and Asia, with the majority of patients being identified from the International LQTS Registry established by the National Institutes of Health at the University of Rochester, NY. Informed consent was obtained from participants in 115 families in accordance with standards established by local institutional review boards. For each individual, historical data (the presence of syncope, the number of syncopal episodes, the presence of seizures, the age of onset of symptoms, and the occurrence of sudden death) and the length of the QT_c²¹ were obtained. Phenotypic criteria used were as follows: (1) Individuals without any symptoms and with a QT_c of 0.41 second were classified as unaffected, (2) symptomatic individuals with a QT_c of 0.45 second and asymptomatic individuals with a QT_c of 0.47 seconds were considered affected, and (3) symptomatic individuals with a QT_c of 0.44 second and asymptomatic individuals with a QT_c between 0.41 and 0.47 second were classified as uncertain.^{12 14 16 18}

Genomic DNA Samples and Linkage Analysis
Genomic DNA was prepared from peripheral blood lymphocytes or cell lines derived from Epstein-Barr virus–transformed lymphocytes by standard procedures.²²

Genotypic analysis for paternity evaluation was performed with 15 short-tandem-repeat polymorphisms that were previously mapped to 15 different chromosomes (Genome Data Base). Amplification of each short tandem repeat was carried out as previously described.^{14 16}

SSCP Analysis
SSCP and DNA sequence analyses were used to screen for KVLQT1 mutations with DNA samples from 115 LQTS families. The partial genomic structure of KVLQT1 was previously determined.¹⁶ Primers (intronic sequences) that can PCR-amplify exons encoding transmembrane domains S2-S6 were defined previously from the partial genomic structure and used in this study for SSCP analysis.¹⁶ PCR was carried out in a 10-µL volume containing 50 ng genomic DNA, 0.52 µmol/L of each primer, 75 µmol/L of each dNTP, 1 µCi [-³²P]dCTP, 0.24 mmol/L spermidine, 1.5 mmol/L MgCl₂, 10 mmol/L Tris (pH 8.3), 50 mmol/L KCl, and 1 U Taq DNA polymerase (Promega and Gibco-BRL). PCR amplification was carried out in a Perkin-Elmer System 9600 thermocycler using the following profile: 1 cycle of denaturation at 94°C for 5 minutes; 5 cycles at 94°C for 20 seconds, 64°C for 20 seconds, 72°C for 30 seconds; and 25 cycles of 94°C for 20 seconds, 62°C for 20 seconds, 72°C for 30 seconds; followed by a 5-minute extension at 72°C.

Amplified samples were diluted fivefold with 50 µL of formamide buffer (95% formamide, 10 mmol/L EDTA, 0.1% bromphenol blue, 0.1% xylene cyanol) and 50 µL of 0.1% SDS/10 mmol/L EDTA. The mixture was denatured at 94°C for 5 minutes, then cooled rapidly on ice and held for 5 minutes. For each sample, 3 to 5 µL was loaded onto 10% nondenaturing polyacrylamide gels (acrylamide to bisacrylamide ratio=50:1) and run at 8 W overnight at room temperature. Gels were dried on Schleicher and Schuell filter paper and exposed to x-ray film.

DNA Sequencing
Both normal and aberrant SSCP bands were cut out of the gel and rehydrated in 100 µL water for 30 minutes at 65°C. Ten microliters of the eluted DNA was reamplified with the original PCR primers in a total volume of 100 µL. Amplified products were purified through 2% low-melting agarose. These products were sequenced directly with an ABI Sequencer or subcloned into PBluescript-SK⁽⁺⁾ (Stratagene) by use of the T-vector method as described,²³ and several colonies were sequenced by the dideoxy chain termination method with Sequenase Version 2.0 (United States Biochemicals, Inc).

	Results

Top Abstract Introduction Methods Results Discussion References

 
KVLQT1 Splicing Mutations Associated With LQTS in Four Families
Aberrant SSCP conformers were identified in affected members of four families (F1002, F1003, F1004, and F1005; Fig 1); these SSCP anomalies were not observed in DNA samples from unaffected members of these families (Fig 1) or from more than 150 control subjects (data not shown). The pattern of aberrant banding appeared to be similar in all four LQTS families (Fig 1). Sequence analysis of the aberrant bands revealed the presence of an identical splicing mutation, a G-to-A substitution, in all four families. This substitution occurs at the third position of codon A249 (SP/A249/g-a) and disrupts the splice-donor sequence within the S6 transmembrane domain. The fact that the same substitution cosegregated with the disease status in four unrelated LQTS families (one Italian, one Irish, and two American) strongly suggests this variant to be a mutation.

View larger version (30K): [in this window] [in a new window]   Figure 1. KVLQT1 splicing mutation cosegregating with LQT in families F1002, F1003, F1004, and F1005. Pedigree structures are shown. Individuals with characteristic features of LQT, including prolongation of QT interval on ECG and history of syncope or aborted sudden death are indicated by solid circles (females) or squares (males). Unaffected individuals are indicated by open symbols, and individuals with an equivocal phenotype by hatched symbols. Deceased individuals are indicated by a slash. Results of SSCP analyses are shown below each pedigree. Aberrant SSCP conformers are indicated by arrows. Sequence analyses of normal (left) and aberrant (right) conformers revealed that all four families had an identical change, a G to A substitution (SP/A249/g-a). This mutation occurs in splice-donor sequence of exon in S6 domain. PCR primers 9 and 10 in Wang et al16 were used: 9, CCCCAGGACCCCAGCTGTCCAA; and 10, AGGCTGACCACTGTCCCTCT.

KVLQT1 Missense Mutations Associated With LQTS in Two Families
SSCP analysis with a pair of primers in the S6 domain revealed aberrant bands in affected members of families F1006 and F1007 (Fig 2). These abnormal SSCP bands were not seen in DNA samples from unaffected members of these families (Fig 2) or from more than 150 control individuals (data not shown). DNA sequence analysis of the normal and aberrant conformers revealed that both F1006 and F1007 had an identical missense mutation, a single base substitution (C to T) (Fig 2). This mutation results in substitution of an alanine by a valine at position 246 (A246V) within transmembrane domain S6 (Fig 2C).

View larger version (20K): [in this window] [in a new window]   Figure 2. KVLQT1 missense mutation identified in F1006 and F1007. Results of SSCP analyses are shown below each pedigree, with aberrant SSCP conformer indicated by arrow. Sequence analyses of normal (left) and aberrant (right) conformers reveal a C to T substitution at codon 246. This mutation causes substitution of an alanine residue by a valine (A246V). F1006 is a Japanese family and F1007 a white family. Same mutation was previously reported in six other families.16 25 PCR primers 9 and 10 in Wang et al16 were used (see Fig 1).

De Novo Intragenic Deletion of KVLQT1 in a Sporadic Case of LQTS
SSCP analysis with a pair of primers within the pore region of KVLQT1 identified an aberrant conformer in an affected individual in F1008 (Fig 3). This SSCP anomaly was not observed in DNA samples from either parent, from the patient's unaffected brother (Fig 3), or from more than 150 control subjects (data not shown). Direct sequencing of the abnormal SSCP band identified a 3-bp deletion (SP/V212/GGT) spanning an exon-intron boundary in the pore region. This deletion results in a frame shift and alters splicing, leading to the truncation of the KVLQT1 protein. Genotypic analysis of this family using more than 15 polymorphic markers confirmed paternity.

View larger version (21K): [in this window] [in a new window]   Figure 3. De novo mutation of KVLQT1 identified in sporadic case of LQT. Pedigree structure of F1008 is shown. Results of SSCP analyses are shown below pedigree. Aberrant conformer is indicated by arrow. DNA sequence analysis identified a 3-bp deletion (SP/V212/ggt) spanning an exon-intron boundary in pore region. This mutation results in a frame shift in KVLQT1 cDNA sequence, leading to a nonfunctional protein. Genotypic analysis of this kindred using more than 15 polymorphic markers confirmed maternity and paternity. QTc intervals for proband, proband's father, and proband's mother are 0.50, 0.39, and 0.36 second, respectively. PCR primers 7 and 8 in Wang et al16 were used: 7, TCCTGGAGCCCGAACTGTGTGT; and 8, AGGCTGACCACTGTCCCTCT.

Phenotype-Genotype Correlation
Despite the genotypic differences found in these seven families, the phenotype was fairly similar in all affected individuals (Table 1). In six of seven families, the QT_c was >0.500 second; the seventh family had QT_c measured in the range of 0.490 to 0.493. In addition, six of seven families were symptomatic, with episodes of syncope. Only the family in which the QT_c was <0.500 second was without symptoms (Table 1). T-wave alternans, ventricular tachycardia, and torsade de pointes were uncommon; only one family had evidence of T-wave alternans, and two families were noted to have episodes of torsade de pointes (Table 1).

View this table: [in this window] [in a new window]   Table 1. Phenotype-Genotype Correlation

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The potassium channel gene KVLQT1 was initially identified by positional cloning,¹⁶ and 11 different types of missense mutations of KVLQT1 were identified in 16 LQTS families¹⁶ in the original report (Table 2). Later, Tanaka et al²⁴ reported four missense mutations, and Russell et al²⁵ reported two additional missense mutations in three LQTS families, including a previously reported mutation, A246V (previously named A212V) (Table 2). In this report, we found the same A246V mutation in affected members of two more LQTS families, including one Japanese family (Table 2 and Fig 4). To date, of 30 families with KVLQT1 mutations, alanine at position 246 was mutated 10 times (33%) (Table 2). The frequent occurrence of A246 mutations and its presence in both white and Japanese populations indicate that the alanine residue at position 246 is a mutational hot spot in KVLQT1.

View this table: [in this window] [in a new window]   Table 2. Summary of KVLQT1 Mutations

View larger version (26K): [in this window] [in a new window]   Figure 4. Model for KVLQT1 potassium channel and location of LQT mutations. Channel consists of six putative membrane-embedded homologous domains (S1 to S6).

An identical splicing mutation was identified in affected members of four unrelated families (one Italian, one Irish, and two American); no unaffected individuals from these families or from more than 150 normal control subjects demonstrate the splicing mutation. In addition, the mutation occurs in a highly conserved region of the gene. Together, these data strongly suggest that the splicing change we identified is the disease-causing mutation. We also identified a 3-bp deletion that arose de novo. The 3-bp deletion, spanning an exon-intron boundary in the pore region, not only alters splicing but also leads to a 1-bp deletion in the coding region, causing a frame shift and truncation of the KVLQT1 protein. These data strongly support the notion that mutations in KVLQT1 cause the chromosome 11–linked LQTS.

Since the original identification of genes for chromosome 3–linked LQTS (SCN5A) and chromosome 7–linked LQTS (HERG), electrophysiological studies have established that the molecular mechanism for chromosome 3–linked LQTS is the presence of a late phase of inactivation-resistant sodium current in the plateau phase of the action potential (a gain-of-function mechanism),^{26 27} whereas HERG mutations cause the loss of I_Kr potassium current^{28 29} through dominant-negative mechanisms or loss-of-function mechanisms.³⁰ Molecular mechanisms of KVLQT1 mutations are currently unknown. Analysis of the predicted amino acid sequence of KVLQT1 suggests that it encodes a potassium channel subunit.¹⁶ Recent electrophysiological characterization of the KVLQT1 protein in various heterologous systems has confirmed that KVLQT1 is a voltage-gated potassium channel protein.^{31 32} When coexpressed with minK, KVLQTI forms the slowly activating potassium current (I_Ks) in cardiac myocytes.^{31 32} A combination of normal and mutant KVLQT1 subunits could therefore form abnormal I_Ks channels. Thus, LQTS-associated mutations of KVLQT1 could act through a dominant-negative mechanism. The type and location of KVLQT1 mutations described here are consistent with this hypothesis. The missense mutation, A246V, was identified in two families and affects the S6 domain. Two mutations lead to premature termination and truncated proteins (one splicing mutation identified in four unrelated families and one 3-bp deletion that arose de novo). In the first case, the S6 domain and the carboxyl end of the protein are truncated, leaving intact the amino end of the protein and S1 domain to the pore. In the second case, a frame shift and altered splicing cause truncation of the protein in the pore. Alternatively, the latter two mutations could act through a loss-of-function mechanism. In general, these patients had moderate symptomatology, with relatively frequent episodes of syncope and long QT_c intervals (>0.500 second). It is unclear whether mutations in certain regions of the KVLQT1 gene will cause more malignant disease than mutations in other regions of the gene. Electrophysiological characterization of KVLQT1 mutations will shed light on the molecular mechanisms of these mutations and possibly allow for predictions of clinical outcome.

Neyroud et al²⁰ demonstrated a homozygous insertion-deletion mutation in the 3' end of KVLQT1 leading to Jervell and Lange-Nielsen syndrome, which includes LQT and deafness. They show that the hearing abnormality occurs in three individuals because of the loss of function of the channel, which is the result of mutation on both alleles (ie, homozygous mutation). When a heterozygous mutation occurs, no matter at which end of the gene, it appears that Romano-Ward syndrome (ie, no deafness) results. Despite the possibility that heterozygous mutations in KVLQT1 act in a dominant-negative mechanism, some functional KVLQT1 potassium channels exist in the stria vascularis of the inner ear. Therefore, deafness is averted.

Identification of SCN5A and HERG as LQTS genes has led to potential new rational gene-specific therapy to prevent life-threatening arrhythmias. Mexiletine, a sodium channel blocking agent, has been shown to markedly shorten the QT_c of chromosome 3–linked LQTS patients and to have only a modest effect on chromosomes 7–and 11–linked LQTS patients.³³ By contrast, raising the serum potassium concentration was shown to be effective in shortening the QT_c interval for patients with chromosome 7–linked LQTS; however, no corresponding data have yet been reported for chromosomes 3–and 11–linked patients.³⁴ No effective treatment for patients with chromosome 11–linked LQTS is currently known. Studies with various interventions, for example, potassium channel opening agents,³⁵ are needed to identify therapeutic strategies aimed at reducing the risk of life-threatening arrhythmias in patients with KVLQT1 mutations.

	Selected Abbreviations and Acronyms

 

LQTS = long-QT syndrome PCR = polymerase chain reaction QTc = QT interval on ECG corrected for heart rate SSCP = single-strand conformation polymorphism

	Acknowledgments

 
This work was supported by the Abercrombie Cardiology Fund, Texas Children's Hospital (Dr Wang), NIH grants R01-HL-33843 and R01-HL-51618 (Dr Moss), and The Texas Children's Hospital Foundation Endowed Chair in Pediatric Cardiac Research (Dr Towbin). Dr Wang is also a Visiting Professor of the China National Rice Research Institute.

	Footnotes

 
Guest editor for this article was D. Woodrow Benson, MD, Seidman Laboratory, Boston, Mass.

Received June 5, 1997; revision received December 4, 1997; accepted December 5, 1997.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Kannel WB, Cupples A, D'Agostino RB. Sudden death risk in overt coronary heart diseases: the Framingham study. Am Heart J. 1987;113:799–804.[Medline] [Order article via Infotrieve]

2. Willich SN, Levy D, Rocco MB, Tofler GH, Stone PH, Muller JOE. Circadian variation in the incidence of sudden cardiac death in the Framingham heart study population. Am J Cardiol. 1987;60:801–806.[Medline] [Order article via Infotrieve]

3. Ward OC. A new familial cardiac syndrome in children. J Ir Med Assoc. 1964;54:103–106.[Medline] [Order article via Infotrieve]

4. Romano C. Congenital cardiac arrhythmia. Lancet. 1965;1:658–659.[Medline] [Order article via Infotrieve]

5. Schwartz PJ, Periti M, Malliani A. The long QT syndrome. Am Heart J. 1975;109:378–390.

6. Moss AJ, McDonald J. Unilateral cervicothoracic sympathetic ganglionectomy for the treatment of long QT interval syndrome. N Engl J Med. 1970;285:903–904.

7. Schwartz PJ, Locati EN, Napolitano C, Priori SG. The long QT syndrome. In: Zipes DP, Jalife J, eds. Cardiac Electrophysiology: From Cell to Bedside. Philadelphia, Pa: WB Saunders Co; 1995:788–811.

8. Moss AJ, Schwartz PJ, Crampton KS, Tzlvoni D, Locati EH, MacCluer J, Hall WJ, Weitkamp I, Vincent GM, Garson A Jr, Robinson JL, Benhorin J, Choi S. The long QT syndrome: prospective longitudinal study of 328 families. Circulation. 1991;84:1136–1144.[Abstract/Free Full Text]

9. Roden DM, Lazzara R, Rosen M, Schwartz PJ, Towbin J, Vincent GM. Multiple mechanisms in the long-QT syndrome: current knowledge, gaps, and future directions. Circulation. 1996;94:1996–2012.[Abstract/Free Full Text]

10. Vincent GM, Timothy KW, Leppert MF, Keating MT. The spectrum of symptoms and QT intervals in carriers of the gene for the long QT syndrome. N Engl J Med. 1992;327:846–852.[Abstract]

11. Jervell A, Lange-Nielsen F. Congenital deaf mutism, functional heart disease with prolongation of the QT interval, and sudden death. Am Heart J. 1957;54:59–78.[Medline] [Order article via Infotrieve]

12. Keating MT, Atkinson D, Dunn C, Timothy K, Vincent GM, Leppert M. Linkage of a cardiac arrhythmia, the long QT syndrome, and the Harvey ras-1 gene. Science. 1991;252:704–706.[Abstract/Free Full Text]

13. Keating MT, Atkinson D, Dunn C, Timothy K, Vincent GM, Leppert M. Consistent linkage of the long QT syndrome to the Harvey ras-1 locus on chromosome 11. Am J Hum Genet. 1991;49:1335–1339.[Medline] [Order article via Infotrieve]

14. Jiang C, Atkinson D, Towbin JA, Splawski I, Lehmann MH, Li H, Timothy K, Taggart RT, Schwartz PJ, Vincent GM, Moss AJ, Keating MT. Two long QT syndrome loci map to chromosomes 3 and 7 with evidence for further heterogeneity. Nat Genet. 1994;8:141–147.[Medline] [Order article via Infotrieve]

15. Schott J, Charpentier F, Peltier S, Foley P, Drouin E, Bouhour J, Donnelly P, Vergnaud G, Bachner L, Moisan J, Marec HL, Pascal O. Mapping of a gene for long QT syndrome to chromosome 4q25–27. Am J Hum Genet. 1995;57:1114–1122.[Medline] [Order article via Infotrieve]

16. Wang Q, Curran ME, Splawski I, Connors TD, Burn TC, Millholland JM, VanRaay TJ, Shen J, de Jager T, Schwartz PJ, Towbin JA, Moss AJ, Atkinson DL, Timothy KW, Vincent GM, Landes GM, Connors TD, Keating MT. Positional cloning of a novel potassium channel gene: KVLQT1 mutations cause cardiac arrhythmias. Nat Genet. 1996;12:17–23.[Medline] [Order article via Infotrieve]

17. Curran ME, Splawski I, Timothy KW, Vincent GM, Geen ED, Keating MT. A molecular basis for cardiac arrhythmia: HERG mutations cause long QT syndrome. Cell. 1995;80:795–803.[Medline] [Order article via Infotrieve]

18. Wang Q, Shen J, Splawski I, Atkinson D, Li Z, Robinson JL, Moss AJ, Towbin JA, Keating MT. SCN5A mutations associated with an inherited cardiac arrhythmia, long QT syndrome. Cell. 1995;80:805–811.[Medline] [Order article via Infotrieve]

19. Wang Q, Shen J, Li Z, Timothy K, Vincent GM, Priori S, Schwartz PJ, Keating MT. Cardiac sodium channel mutations in patients with long QT syndrome, an inherited cardiac arrhythmia. Hum Mol Genet. 1995;4:1603–1607.[Abstract/Free Full Text]

20. Neyroud N, Tesson F, Denjoy I, Leibovici M, Donger C, Barhanin J, Faure S, Gary F, Coumel P, Petti C, Schwartz K, Guicheney P. A novel mutation on the potassium channel gene KVLQT1 causes the Jervell and Lange-Nielsen cardioauditory syndrome. Nat Genet. 1997;15:186–189.[Medline] [Order article via Infotrieve]

21. Bazett HC. An analysis of the time-relationship of electrocardiograms. Heart. 1920;7:353–370.

22. Anderson MA, Gusella JK. Use of cyclosporin A in establishing Epstein-Barr virus-transformed human lymphoblastoid cell lines. In Vitro. 1984;20:856–858.[Medline] [Order article via Infotrieve]

23. Marchuk D, Drumm M, Saulino A, Collins FS. Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res. 1990;19:1154.[Free Full Text]

24. Tanaka T, Nagai R, Tomoike H, Takata S, Yano K, Yabuta K, Haned N, Nakano O, Shibata A, Sawayama T, Kasai H, Yazaki Y, Nakamura Y. Four novel KVLQT1 and four novel HERG mutations in familial long-QT syndrome. Circulation. 1997;95:565–567.[Abstract/Free Full Text]

25. Russell MW, Dick M II, Collins FS, Brody LC. KVLQT1 mutations in three familial or sporadic long QT syndrome. Hum Mol Genet. 1996;9:1319–1324.

26. Dumaine R, Wang Q, Keating MT, Hartmann HA, Schwartz PJ, Brown AM, Kirsch GE. Multiple mechanisms of sodium channel-linked long QT syndrome. Circ Res. 1996;78:916–924.[Abstract/Free Full Text]

27. Bennett PB, Patton DE, Scheuer T, Wang Y, Goldin AL, Catterall WA. Molecular mechanism for an inherited cardiac arrhythmia. Nature. 1995;376:683–685.[Medline] [Order article via Infotrieve]

28. Sanguinetti MC, Jiang C, Curran ME, Keating MT. A mechanistic link between an inherited and an acquired cardiac arrhythmia: HERG encodes the I_Kr potassium channel. Cell. 1995;81:299–307.[Medline] [Order article via Infotrieve]

29. Trudeau MC, Warmke J, Ganetzky B, Robertson G. HERG, a human inward rectifier in the voltage-gated potassium channel family. Science. 1995;269:92–95.[Abstract/Free Full Text]

30. Sanguinetti MC, Curran ME, Spector PS, Keating MT. Spectrum of HERG K⁺-channel dysfunction in an inherited cardiac arrhythmia. Proc Natl Acad Sci U S A. 1996;93:2208–2212.[Abstract/Free Full Text]

31. Barhanin J, Lesage F, Guillemare E, Finc M, Lazdunski M, Romey G. KVLQT1 and IsK (minK) proteins associate to form the I_Ks cardiac potassium current. Nature. 1996;384:78–80.[Medline] [Order article via Infotrieve]

32. Sanguinetti MC, Curran ME, Zou A, Shen J, Spector PS, Atkinson DL, Keating MT. Coassembly of KVLQT1 and minK (IsK) proteins to form cardiac I_Ks potassium channel. Nature. 1996;384:80–83.[Medline] [Order article via Infotrieve]

33. Schwartz PJ, Priori SG, Locati E, Napolitano C, Cantu F, Towbin JA, Keating MT, Hammoude H, Brown AM, Chen L, Colatsky TJ. Long QT syndrome patients with mutations of the SCN5A and HERG genes have differential responses to Na⁺ channel blockade and to increases in heart rate: implications for gene-specific therapy. Circulation. 1995;92:3381–3386.[Abstract/Free Full Text]

34. Compton SJ, Lux RL, Ramsey MR, Strelich KR, Sanguinetti MC, Green LS, Keating MT, Mason JW. Genetically defined therapy of inherited long-QT syndrome. Circulation. 1996;94:1018–1022.[Abstract/Free Full Text]

35. Carlsson L, Abrahamsson C, Drews L, Ducker G. Antiarrhythmic effects of potassium channel openers in rhythm abnormalities related to delayed repolarization. Circulation. 1991;85:1491–1500.[Abstract/Free Full Text]

This article has been cited by other articles:

				D. M. Roden Long-QT Syndrome N. Engl. J. Med., January 10, 2008; 358(2): 169 - 176. [Full Text] [PDF]

				A. Anastasakis, C.-M. Kotta, S. Kyriakogonas, B. Wollnik, A. Theopistou, and C. Stefanadis Phenotype reveals genotype in a Greek long QT syndrome family. Europace, April 1, 2006; 8(4): 241 - 244. [Abstract] [Full Text] [PDF]

				W. Tian, Y. Fu, D. H. Wang, and D. M. Cohen Regulation of TRPV1 by a novel renally expressed rat TRPV1 splice variant Am J Physiol Renal Physiol, January 1, 2006; 290(1): F117 - F126. [Abstract] [Full Text] [PDF]

				K.-H. Park, J. Piron, S. Dahimene, J. Merot, I. Baro, D. Escande, and G. Loussouarn Impaired KCNQ1-KCNE1 and Phosphatidylinositol-4,5-Bisphosphate Interaction Underlies the Long QT Syndrome Circ. Res., April 15, 2005; 96(7): 730 - 739. [Abstract] [Full Text] [PDF]

				G. Seebohm, M. Pusch, J. Chen, and M. C. Sanguinetti Pharmacological Activation of Normal and Arrhythmia-Associated Mutant KCNQ1 Potassium Channels Circ. Res., November 14, 2003; 93(10): 941 - 947. [Abstract] [Full Text] [PDF]

				M. Vatta, R. Dumaine, G. Varghese, T. A. Richard, W. Shimizu, N. Aihara, K. Nademanee, R. Brugada, J. Brugada, G. Veerakul, et al. Genetic and biophysical basis of sudden unexplained nocturnal death syndrome (SUNDS), a disease allelic to Brugada syndrome Hum. Mol. Genet., February 1, 2002; 11(3): 337 - 345. [Abstract] [Full Text] [PDF]

				L. Huang, M. Bitner-Glindzicz, L. Tranebjaerg, and A. Tinker A spectrum of functional effects for disease causing mutations in the Jervell and Lange-Nielsen syndrome Cardiovasc Res, September 1, 2001; 51(4): 670 - 680. [Abstract] [Full Text] [PDF]

				J. A. Towbin, Z. Wang, and H. Li Genotype and Severity of Long QT Syndrome Drug Metab. Dispos., April 1, 2001; 29(4): 574 - 579. [Abstract] [Full Text]

				F. Ichida, S. Tsubata, K. R. Bowles, N. Haneda, K. Uese, T. Miyawaki, W. J. Dreyer, J. Messina, H. Li, N. E. Bowles, et al. Novel Gene Mutations in Patients With Left Ventricular Noncompaction or Barth Syndrome Circulation, March 6, 2001; 103(9): 1256 - 1263. [Abstract] [Full Text] [PDF]

				G. Lande, F. Kyndt, I. Baro, D. Chabannes, P. Boisseau, J.-C. Pony, D. Escande, and H. Le Marec Dynamic analysis of the QT interval in long QT1 syndrome patients with a normal phenotype Eur. Heart J., March 1, 2001; 22(5): 410 - 422. [Abstract] [PDF]

				C.-C. Shieh, M. Coghlan, J. P. Sullivan, and M. Gopalakrishnan Potassium Channels: Molecular Defects, Diseases, and Therapeutic Opportunities Pharmacol. Rev., December 1, 2000; 52(4): 557 - 594. [Abstract] [Full Text] [PDF]

				L. Bianchi, S. G. Priori, C. Napolitano, K. A. Surewicz, A. T. Dennis, M. Memmi, P. J. Schwartz, and A. M. Brown Mechanisms of IKs suppression in LQT1 mutants Am J Physiol Heart Circ Physiol, December 1, 2000; 279(6): H3003 - H3011. [Abstract] [Full Text] [PDF]

				I. Splawski, J. Shen, K. W. Timothy, M. H. Lehmann, S. Priori, J. L. Robinson, A. J. Moss, P. J. Schwartz, J. A. Towbin, G. M. Vincent, et al. Spectrum of Mutations in Long-QT Syndrome Genes : KVLQT1, HERG, SCN5A, KCNE1, and KCNE2 Circulation, September 5, 2000; 102(10): 1178 - 1185. [Abstract] [Full Text] [PDF]

				C.-E. Chiang and D. M. Roden The long QT syndromes: genetic basis and clinical implications J. Am. Coll. Cardiol., July 1, 2000; 36(1): 1 - 12. [Abstract] [Full Text] [PDF]

				F. Lehmann-Horn and K. Jurkat-Rott Voltage-Gated Ion Channels and Hereditary Disease Physiol Rev, October 1, 1999; 79(4): 1317 - 1372. [Abstract] [Full Text] [PDF]

				A. Murray, C. Donger, C. Fenske, I. Spillman, P. Richard, Y. B. Dong, N. Neyroud, P. Chevalier, I. Denjoy, N. Carter, et al. Splicing Mutations in KCNQ1 : A Mutation Hot Spot at Codon 344 That Produces In Frame Transcripts Circulation, September 7, 1999; 100(10): 1077 - 1084. [Abstract] [Full Text] [PDF]

				J. Tyson, S. Malcolm, and M. Bitner-Glindzicz Splice Mutations in KVLQT1? Circulation, May 11, 1999; 99 (18): 2476 - 2479. [Full Text] [PDF]

				D. M. Roden and S. Kupershmidt From genes to channels: normal mechanisms Cardiovasc Res, May 1, 1999; 42(2): 318 - 326. [Abstract] [Full Text] [PDF]

				M. Berthet, I. Denjoy, C. Donger, L. Demay, H. Hammoude, D. Klug, E. Schulze-Bahr, P. Richard, H. Funke, K. Schwartz, et al. C-terminal HERG Mutations : The Role of Hypokalemia and a KCNQ1-Associated Mutation in Cardiac Event Occurrence Circulation, March 23, 1999; 99(11): 1464 - 1470. [Abstract] [Full Text] [PDF]

				N. Neyroud, P. Richard, N. Vignier, C. Donger, I. Denjoy, L. Demay, M. Shkolnikova, R. Pesce, P. Chevalier, B. Hainque, et al. Genomic Organization of the KCNQ1 K+ Channel Gene and Identification of C-Terminal Mutations in the Long-QT Syndrome Circ. Res., February 19, 1999; 84(3): 290 - 297. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Li, H. Articles by Towbin, J. A. Search for Related Content PubMed PubMed Citation Articles by Li, H. Articles by Towbin, J. A.