From the Department of Molecular Cell Pharmacology, National
Children's Medical Research Center (A.H., R.F., G.T.), and the
Department of Internal Medicine, School of Medicine, Keio University (K.S.,
S.O.), Tokyo, Japan.
Correspondence to Gozoh Tsujimoto, MD, PhD, Department of Molecular Cell Pharmacology, National Children's Medical Research Center, 3–35-31 Taishido, Setagaya-ku, Tokyo, Japan 154. E-mail gtsujimoto{at}nch.go.jp
Methods and Results—Reverse transcriptase–polymerase chain
reaction showed that all
Conclusions—The results show that all
Incorporation of [
[125I]HEAT Binding
Measurement of Ins(1,4,5)P3
Statistical Analysis
Membrane preparations from CHO cells stably expressing the cloned human
We also examined the abilities of these drugs to inhibit
[125I]HEAT binding to the three cloned human
To determine whether quinidine and verapamil exert
agonistic or antagonistic effects on
Our radioligand studies using cloned human
A comparison of binding and Ins(1,4,5)P3 studies
revealed an interesting property of the quinidine and
verapamil interaction on
In summary, our radioligand and functional approaches using
cloned human
Received January 8, 1998;
revision received February 12, 1998;
accepted February 12, 1998.
2.
Opie LH, Fishman WH, Thadani U. Calcium channel
antagonists (calcium entry blockers). In: Opie LH, ed.
Drugs for the Heart. Philadelphia, Pa: W.B. Saunders;
1995:50–82.
3.
Maisel AS, Motulsky HJ, Insel PA. Hypotension after
quinidine plus verapamil: possible additive competition at
4.
Motulsky HJ, Maisel AS, Snavely MD, Insel PA.
Quinidine is a competitive antagonist at
5.
Muller A, Noack E. Additive competitive interaction of
verapamil and quinidine at
6.
Nichols JA, Ruffolo JRR. Functions mediated by
7.
Han C, Abel PW, Minneman KP.
Heterogeneity of
8.
Tsujimoto G, Tsujimoto A, Suzuki E, Hashimoto K.
Glycogen phosphorylase activation by two different
9.
Hirasawa A, Horie K, Tanaka T, Takagaki K, Murai M,
Yano J, Tsujimoto G. Cloning, functional expression and tissue
distribution of human cDNA for the
10.
Weinberg DH, Trivedi P, Tan CP, Mitra S, Perkins-Barrow
A, Borkowski D, Strader CD, Bayne M. Cloning, expression and
characterization of human
11.
Esbenshade TA, Hirasawa A, Tsujimoto G, Tanaka T, Yano
J, Minneman KP, Murphy TJ. Cloning of the human
12.
Shibata K, Foglar R, Horie K, Obika K, Sakamoto A,
Ogawa S, Tsujimoto G. KMD-3213, a novel, potent,
13.
Munson PJ, Rodbard D. LIGAND: a versatile computerized
approach for characterization of ligand-binding systems. Anal
Biochem. 1980;107:220–239.[Medline]
[Order article via Infotrieve]
14.
Nishimura J, Kanaide H, Nakamura M. Binding of
[3H]prazosin to porcine aortic membranes:
interaction of calcium antagonists with vascular alpha-1 adrenoceptors.
J Pharmacol Exp Ther. 1985;236:789–793.
15.
Nayler WG, Thompson JE, Jarrott B. The interaction of
calcium antagonists (slow channel blockers) with myocardial
alpha adrenoceptors. J Mol Cell Cardiol. 1982;14:185–188.[Medline]
[Order article via Infotrieve]
© 1998 American Heart Association, Inc.
Brief Rapid Communications
Effects of Quinidine and Verapamil on Human Cardiovascular
1-Adrenoceptors
Abstract
Top
Abstract
Introduction
Methods
Results
Discussion
References
Background—The antiarrhythmic drugs
quinidine and verapamil are known to block
1-adrenoceptors (1ARs).
1ARs are a heterogeneous family of three
subtypes (1A, 1B, and 1D),
and little is known about the effects of quinidine and
verapamil on the different human 1AR
subtypes. 1AR subtypes are expressed in
both human heart (atrium and ventricle) and the mesenteric artery.
Pharmacological profiles of quinidine and verapamil actions
on the 1AR subtypes were characterized with Chinese
hamster ovary cells stably expressing cloned human 1AR
subtypes. Radioligand binding studies showed that quinidine
and verapamil had high affinities for all
1AR subtypes. Also, both drugs synergistically inhibited
1AR-mediated inositol 1,4,5-triphosphate
production at the clinical effective concentration range
(1 µmol/L quinidine and 0.1 µmol/L
verapamil). 1AR
subtypes are expressed in the human cardiovascular
system and that quinidine and verapamil may have a potent,
synergistic inhibitory effect on the 1ARs.
Clinically observed hypotension after quinidine plus
verapamil can be explained by their synergistic
inhibitory effects on human 1ARs.
Key Words: receptors, adrenergic, alpha • blood pressure • catecholamines • signal transduction
Introduction
Top
Abstract
Introduction
Methods
Results
Discussion
References
Quinidine is
used for the treatment of ventricular arrhythmia
and supraventricular
tachycardia.1 Verapamil
is a calcium channel blocker that has been used in the treatment of
vasospasm and supraventricular arrhythmia, and its
vasodilator effect makes it useful for the treatment of other
disorders, such as angina pectoris and
hypertension.2 Because quinidine and
verapamil are widely used for the treatment of a variety of
cardiovascular disorders, their interaction is of
potential significance. Serious hypotension, which responds to
epinephrine,3 has been reported after
combined therapy with verapamil and quinidine, and
radioligand binding studies using native tissues (rat heart
and kidney for 1AR and human platelets for
2AR) have shown the interaction to be due to
an additive blockade of AR.4 5 1ARs play an important role in human
cardiovascular physiology.6
Recently, the heterogeneity of
1ARs has been
recognized,7 8 and three distinct cDNAs encoding
human 1AR subtypes
(1A, 1B, and
1D) have been
cloned.9 10 11 Little is known, however, about the
effects of quinidine and verapamil on each
1AR subtype. The present study was
therefore designed to assess this effect on human
1AR subtypes by use of human cloned
1ARs.
Methods
Top
Abstract
Introduction
Methods
Results
Discussion
References
Reverse Transcriptase–Polymerase Chain Reaction
Autopsy samples of myocardium and mesenteric artery
were analyzed. Total RNA from each tissue was reverse
transcribed, and first-strand cDNA was used as a template in PCR
(94°C for 60 seconds, 55°C for 30 seconds, and 72°C for 60
seconds) as previously described.9 The primers
CATCGTGGTCGGCTGCT TCGTCCTCTGCTG (sense) and
TCCCACGGGGATGCGCAC CATGTCCTTGTG (antisense) were chosen for
amplification of 1AAR,
CCTGTGCGCCATCTCCATCGATCGCTAC (sense) and ATGAAGAAGGGTAGCCAGCACAAGATGAA
(antisense) for 1BAR,
CTCTGCACCATCTCCGTGGACCGGTAC (sense) and AAAGAAGAAAGGGAACCAGCAGAGCACGAA
(antisense) for 1DAR, and ATGGGGGCAACCCGGGAAC
(sense) and AGATCT GCGGAGTCCATGCC (antisense) for ß-actin. -32P]dCTP during the PCR
reaction showed that PCR products were exponentially generated from
the 23rd to the 35th cycle for 1AAR, the 29th
to the 35th cycle for 1BAR, and the 29th to
the 35th cycle for 1DAR. Therefore, PCR
experiments were performed within these ranges.
Radioligand binding studies with the transfected CHO
cells were performed as described previously.12
Briefly, measurement of specific [125I]HEAT
binding was performed by incubating 0.1 mL of membrane preparation
(
10 µg of protein) with [125I]HEAT (2200
Ci/mmol) in a final volume of 0.25 mL assay buffer for 60 minutes at
25°C in the presence or absence of competing drugs. The incubation
was terminated by addition of ice-cold buffer and immediate filtration
through glass-fiber filters. Each filter was collected, and the
radioactivity was measured. The protein concentration was measured with
the bicinchoninic acid protein assay kit (Pierce).
The cells at 50% confluence in 35-mm culture dishes treated
with NE (1 µmol/L) for 10 seconds were immediately added by
ice-cold 20% perchloric acid. After centrifugation,
the supernatant was adjusted to pH 7.0 with HEPES-KOH solution, and the
sediment was eliminated by centrifugation. Amounts of
Ins(1,4,5)P3 in a sample were measured by a
radioreceptor assay with a D-myo-inositol
1,4,5-triphosphate [3H] assay kit, TRK
1000 (Amersham).
Analysis of saturation and competition binding data was
performed with LIGAND,13 a nonlinear
curve-fitting program. All results are shown as mean±SEM. All
experiments were conducted at least three times.
Results
Top
Abstract
Introduction
Methods
Results
Discussion
References
The results of RT-PCR are shown in Fig 1
. All 1AR
subtype mRNAs were detected in both human heart (atrium and left
ventricle) and the mesenteric artery; the mRNA of all
1ARs was more abundant in mesenteric artery
than in the atrium or ventricle.
View larger version (45K):
[in a new window]
Figure 1. Expression of 1AR subtype mRNA in
human cardiovascular tissues measured by RT-PCR. PCR
products of predicted size (1A, 316 bp;
1B, 531 bp; 1D, 540 bp; and ß-actin,
421 bp) were evident. Negative controls without template were routinely
included in PCR amplifications with both primer sets. Amplified PCR
products were confirmed to originate from cDNAs of
1A, 1B, and 1DAR, as
determined by sequencing.1ARs showed saturable binding of
[125I]HEAT; Bmax values
were 1.3±0.2, 5.5±0.1, and 1.1±0.1 pmol/mg protein, with
Kd values of 110±21, 60±1, and 300±26
pmol/L, for the 1A-,
1B-, and 1DARs (n=3
each), respectively. Competition isotherms showed the expected
pharmacology for each receptor subtype.12 The
abilities of quinidine and verapamil to compete with
specific [125I]HEAT binding at each
1AR subtype are shown in Table 1. Both quinidine and
verapamil showed small differences in their binding
potencies for the different 1AR subtypes (Fig 2). The Hill coefficient for quinidine
obtained for each 1AR subtype was close to
unity, indicating that quinidine displaces at one site. Conversely, the
Hill coefficient for verapamil was 1.5 to 1.7
(significantly different from 1), suggesting a positive cooperativity.
Verapamil could be an allosteric modifier that can displace
[125I]HEAT binding.
View this table:
[in a new window]
Table 1. Affinity of Quinidine and Verapamil at
Cloned Human 1-ARs
View larger version (24K):
[in a new window]
Figure 2. Inhibition of specific [125I]HEAT
binding by quinidine and verapamil in membrane preparations
from CHO cells stably expressing each 1-AR
subtype. Specific receptor binding was defined as binding
displaced by 10 µmol/L phentolamine. Data are plotted as
percentage of specific binding remaining in presence of indicated
concentrations of antagonists. Each point
represents mean from at least three experiments performed in
duplicate.1AR subtypes at their clinically effective
concentration ranges (1 µmol/L quinidine and 0.1 µmol/L
verapamil).4 14 As shown in Table 2A, quinidine (1 µmol/L) potently
inhibited the binding at all 1AR subtypes,
whereas verapamil (0.1 µmol/L) had little displacing
effect. When the two drugs were combined, little additive effect on
[125I]HEAT binding was observed.
View this table:
[in a new window]
Table 2. Inhibitory Effects of Quinidine and
Verapamil on Specific [125I]HEAT Binding
and NE-Promoted Ins(1,4,5)P3 Production 1ARs, we further examined their effects on
1AR-mediated
Ins(1,4,5)P3 production. As shown in
Table 2B
, quinidine (1 µmol/L) inhibited NE-induced
Ins(1,4,5)P3 production for each
1AR subtype. Interestingly,
verapamil (0.1 µmol/L) had an inhibitory
effect on NE-induced Ins(1,4,5)P3
production. Moreover, quinidine (1 µmol/L) plus
verapamil (0.1 µmol/L) almost abolished NE-induced
Ins(1,4,5)P3 production in all
1AR subtypes. In all cells examined, neither
quinidine nor verapamil alone had a stimulatory effect
(data not shown), and phentolamine (10 µmol/L) abolished
NE-induced Ins(1,4,5)P3 production.
Discussion
Top
Abstract
Introduction
Methods
Results
Discussion
References
Our RT-PCR study showed that 1ARs are
expressed in the human cardiovascular system, and
binding and functional studies using cloned human
1ARs showed for the first time that quinidine
and verapamil used together clinically may exert a potent,
synergistic inhibitory effect on human
1ARs. 1ARs provide more direct evidence for an
interaction of quinidine and verapamil with human
1ARs. Compared with the previous binding
studies using nonhuman
1AR,4 15 our study
showed the affinity for quinidine and verapamil to be
generally comparable to that for the cloned human
1AR, although data obtained from the natively
expressed 1AR cannot simply be compared with
those obtained with the cloned 1AR, because
mixed populations of 1AR subtypes are
contained in native tissues. Our approach using cells engineered by
molecular biology may provide a useful model for assessing the
pharmacological properties of receptors naturally expressed in human
tissue. 1ARs.
Quinidine had an 1AR-blocking effect, whereas
verapamil had little effect on the
1AR site; however, verapamil
showed an inhibitory effect on
1AR-mediated
Ins(1,4,5)P3 production, suggesting that
it inhibits 1AR signal transduction by a
mechanism other than 1AR
blockade.14 It is particularly noteworthy that
the two drugs, when given together at their clinically effective
concentrations, inhibited the 1AR-mediated
response much more potently than would be expected from their additive
effect. Hence, the results suggest that the synergistic inhibition of
1AR function via the quinidine and
verapamil interaction may occur not only through antagonism
at 1AR sites but also through a postreceptor
mechanism. 1ARs provide more direct evidence
for an interaction between quinidine and verapamil on human
1ARs. Our results show that quinidine and
verapamil may have a potent, synergistic
inhibitory effect on 1ARs.
Clinically observed hypotension after quinidine plus
verapamil can be explained by their synergistic
inhibitory effects on human
1ARs.
Selected Abbreviations and Acronyms
1AR=
1-adrenoceptor
CHO
=
Chinese hamster ovary
[125I]HEAT
=
2-[ß-(4-hydroxy-3-[125I]iodophenyl)ethylamino-methyl]
tetralone
Ins(1,4,5)P3
=
inositol 1,4,5-triphosphate
NE
=
norepinephrine
PCR
=
polymerase chain reaction
RT
=
reverse transcriptase
Acknowledgments
This work was supported in part by research grants from the
Scientific Research Fund of the Ministry of Education, Science, and
Culture of Japan; a grant-in-aid from the Japan Health Science
Foundation; and a grant from the Ministry of Human Health and Welfare,
Tokyo, Japan.
References
Top
Abstract
Introduction
Methods
Results
Discussion
References
1.
Marcus FI, Opie LH. Antiarrhythmic agents. In:
Opie LH, ed. Drugs for the Heart. Philadelphia, Pa: W.B.
Saunders; 1995:207–246.-adrenergic receptors. N Engl J Med. 1985;312:167–170.[Medline]
[Order article via Infotrieve]1- and 2-adrenergic
receptors. Circ Res. 1984;55:376–381.-adrenergic receptors of
isolated cardiac guinea pig myocytes and human platelets.
Life Sci. 1988;42:667–677.[Medline]
[Order article via Infotrieve]-adrenoceptors. In: Ruffolo JRR, ed. -Adrenoceptors:
Molecular Biology, Biochemistry, and Pharmacology. Basel,
Switzerland: Karger; 1991:115–179.1-adrenergic
receptors revealed by chlorethylclonidine. Mol Pharmacol. 1987;32:505–510.[Abstract]1-adrenergic receptor subtypes:
methoxamine selectively stimulates a putative
1-adrenergic receptor subtype
(1a) that couples with
Ca2+ influx. Mol Pharmacol. 1989;36:166–176.[Abstract]1C-adrenergic receptor. Biochem Biophys
Res Commun. 1993;195:902–909.[Medline]
[Order article via Infotrieve] adrenergic receptors
1A, 1B and
1C. Biochem Biophys Res Commun. 1994;201:1296–1304.[Medline]
[Order article via Infotrieve]1A/D-adrenergic receptor and inducible
expression of three human subtypes in SKNMC cells. Mol
Pharmacol. 1995;47:977–985.[Abstract]1a-adrenoceptor-selective
antagonist: characterization using recombinant human
1-adrenoceptors and native tissues. Mol
Pharmacol. 1995;48:250–258.[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  G. Asemu, N. S. Dhalla, and P. S. Tappia Inhibition of PLC improves postischemic recovery in isolated rat heart Am J Physiol Heart Circ Physiol, December 1, 2004; 287(6): H2598 - H2605. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. P. R. Jarajapu, F. Johnston, C. Berry, A. Renwick, J. C. McGrath, A. MacDonald, and C. Hillier Functional Characterization of alpha 1-Adrenoceptor Subtypes in Human Subcutaneous Resistance Arteries J. Pharmacol. Exp. Ther., November 1, 2001; 299(2): 729 - 734. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. E. Shapiro, B. Winters, M. Hales, T. Barnett, D. A. Schwinn, N. Flavahan, and D. E. Berkowitz Endogenous Circulating Sympatholytic Factor in Orthostatic Intolerance Hypertension, October 1, 2000; 36(4): 553 - 560. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. L. Rudner, D. E. Berkowitz, J. V. Booth, B. L. Funk, K. L. Cozart, E. B. D’Amico, H. El-Moalem, S. O. Page, C. D. Richardson, B. Winters, et al. Subtype Specific Regulation of Human Vascular {alpha}1-Adrenergic Receptors by Vessel Bed and Age Circulation, December 7, 1999; 100(23): 2336 - 2343. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||