Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 1998;97:1227-1230

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shibata, K.
Right arrow Articles by Tsujimoto, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shibata, K.
Right arrow Articles by Tsujimoto, G.

(Circulation. 1998;97:1227-1230.)
© 1998 American Heart Association, Inc.


Brief Rapid Communications

Effects of Quinidine and Verapamil on Human Cardiovascular {alpha}1-Adrenoceptors

Katsushi Shibata, MD; Akira Hirasawa, PhD; Rudolf Foglar, MD, PhD; Satoshi Ogawa, MD, PhD; ; Gozoh Tsujimoto, MD, PhD

From the Department of Molecular Cell Pharmacology, National Children's Medical Research Center (A.H., R.F., G.T.), and the Department of Internal Medicine, School of Medicine, Keio University (K.S., S.O.), Tokyo, Japan.

Correspondence to Gozoh Tsujimoto, MD, PhD, Department of Molecular Cell Pharmacology, National Children's Medical Research Center, 3–35-31 Taishido, Setagaya-ku, Tokyo, Japan 154. E-mail gtsujimoto{at}nch.go.jp


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background—The antiarrhythmic drugs quinidine and verapamil are known to block {alpha}1-adrenoceptors ({alpha}1ARs). {alpha}1ARs are a heterogeneous family of three subtypes ({alpha}1A, {alpha}1B, and {alpha}1D), and little is known about the effects of quinidine and verapamil on the different human {alpha}1AR subtypes.

Methods and Results—Reverse transcriptase–polymerase chain reaction showed that all {alpha}1AR subtypes are expressed in both human heart (atrium and ventricle) and the mesenteric artery. Pharmacological profiles of quinidine and verapamil actions on the {alpha}1AR subtypes were characterized with Chinese hamster ovary cells stably expressing cloned human {alpha}1AR subtypes. Radioligand binding studies showed that quinidine and verapamil had high affinities for all {alpha}1AR subtypes. Also, both drugs synergistically inhibited {alpha}1AR-mediated inositol 1,4,5-triphosphate production at the clinical effective concentration range (1 µmol/L quinidine and 0.1 µmol/L verapamil).

Conclusions—The results show that all {alpha}1AR subtypes are expressed in the human cardiovascular system and that quinidine and verapamil may have a potent, synergistic inhibitory effect on the {alpha}1ARs. Clinically observed hypotension after quinidine plus verapamil can be explained by their synergistic inhibitory effects on human {alpha}1ARs.


Key Words: receptors, adrenergic, alpha • blood pressure • catecholamines • signal transduction


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Quinidine is used for the treatment of ventricular arrhythmia and supraventricular tachycardia.1 Verapamil is a calcium channel blocker that has been used in the treatment of vasospasm and supraventricular arrhythmia, and its vasodilator effect makes it useful for the treatment of other disorders, such as angina pectoris and hypertension.2 Because quinidine and verapamil are widely used for the treatment of a variety of cardiovascular disorders, their interaction is of potential significance. Serious hypotension, which responds to epinephrine,3 has been reported after combined therapy with verapamil and quinidine, and radioligand binding studies using native tissues (rat heart and kidney for {alpha}1AR and human platelets for {alpha}2AR) have shown the interaction to be due to an additive blockade of {alpha}AR.4 5

{alpha}1ARs play an important role in human cardiovascular physiology.6 Recently, the heterogeneity of {alpha}1ARs has been recognized,7 8 and three distinct cDNAs encoding human {alpha}1AR subtypes ({alpha}1A, {alpha}1B, and {alpha}1D) have been cloned.9 10 11 Little is known, however, about the effects of quinidine and verapamil on each {alpha}1AR subtype. The present study was therefore designed to assess this effect on human {alpha}1AR subtypes by use of human cloned {alpha}1ARs.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Reverse Transcriptase–Polymerase Chain Reaction
Autopsy samples of myocardium and mesenteric artery were analyzed. Total RNA from each tissue was reverse transcribed, and first-strand cDNA was used as a template in PCR (94°C for 60 seconds, 55°C for 30 seconds, and 72°C for 60 seconds) as previously described.9 The primers CATCGTGGTCGGCTGCT TCGTCCTCTGCTG (sense) and TCCCACGGGGATGCGCAC CATGTCCTTGTG (antisense) were chosen for amplification of {alpha}1AAR, CCTGTGCGCCATCTCCATCGATCGCTAC (sense) and ATGAAGAAGGGTAGCCAGCACAAGATGAA (antisense) for {alpha}1BAR, CTCTGCACCATCTCCGTGGACCGGTAC (sense) and AAAGAAGAAAGGGAACCAGCAGAGCACGAA (antisense) for {alpha}1DAR, and ATGGGGGCAACCCGGGAAC (sense) and AGATCT GCGGAGTCCATGCC (antisense) for ß-actin.

Incorporation of [{alpha}-32P]dCTP during the PCR reaction showed that PCR products were exponentially generated from the 23rd to the 35th cycle for {alpha}1AAR, the 29th to the 35th cycle for {alpha}1BAR, and the 29th to the 35th cycle for {alpha}1DAR. Therefore, PCR experiments were performed within these ranges.

[125I]HEAT Binding
Radioligand binding studies with the transfected CHO cells were performed as described previously.12 Briefly, measurement of specific [125I]HEAT binding was performed by incubating 0.1 mL of membrane preparation ({approx}10 µg of protein) with [125I]HEAT (2200 Ci/mmol) in a final volume of 0.25 mL assay buffer for 60 minutes at 25°C in the presence or absence of competing drugs. The incubation was terminated by addition of ice-cold buffer and immediate filtration through glass-fiber filters. Each filter was collected, and the radioactivity was measured. The protein concentration was measured with the bicinchoninic acid protein assay kit (Pierce).

Measurement of Ins(1,4,5)P3
The cells at 50% confluence in 35-mm culture dishes treated with NE (1 µmol/L) for 10 seconds were immediately added by ice-cold 20% perchloric acid. After centrifugation, the supernatant was adjusted to pH 7.0 with HEPES-KOH solution, and the sediment was eliminated by centrifugation. Amounts of Ins(1,4,5)P3 in a sample were measured by a radioreceptor assay with a D-myo-inositol 1,4,5-triphosphate [3H] assay kit, TRK 1000 (Amersham).

Statistical Analysis
Analysis of saturation and competition binding data was performed with LIGAND,13 a nonlinear curve-fitting program. All results are shown as mean±SEM. All experiments were conducted at least three times.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
The results of RT-PCR are shown in Fig 1Down. All {alpha}1AR subtype mRNAs were detected in both human heart (atrium and left ventricle) and the mesenteric artery; the mRNA of all {alpha}1ARs was more abundant in mesenteric artery than in the atrium or ventricle.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 1. Expression of {alpha}1AR subtype mRNA in human cardiovascular tissues measured by RT-PCR. PCR products of predicted size ({alpha}1A, 316 bp; {alpha}1B, 531 bp; {alpha}1D, 540 bp; and ß-actin, 421 bp) were evident. Negative controls without template were routinely included in PCR amplifications with both primer sets. Amplified PCR products were confirmed to originate from cDNAs of {alpha}1A, {alpha}1B, and {alpha}1DAR, as determined by sequencing.

Membrane preparations from CHO cells stably expressing the cloned human {alpha}1ARs showed saturable binding of [125I]HEAT; Bmax values were 1.3±0.2, 5.5±0.1, and 1.1±0.1 pmol/mg protein, with Kd values of 110±21, 60±1, and 300±26 pmol/L, for the {alpha}1A-, {alpha}1B-, and {alpha}1DARs (n=3 each), respectively. Competition isotherms showed the expected pharmacology for each receptor subtype.12 The abilities of quinidine and verapamil to compete with specific [125I]HEAT binding at each {alpha}1AR subtype are shown in Table 1Down. Both quinidine and verapamil showed small differences in their binding potencies for the different {alpha}1AR subtypes (Fig 2Down). The Hill coefficient for quinidine obtained for each {alpha}1AR subtype was close to unity, indicating that quinidine displaces at one site. Conversely, the Hill coefficient for verapamil was 1.5 to 1.7 (significantly different from 1), suggesting a positive cooperativity. Verapamil could be an allosteric modifier that can displace [125I]HEAT binding.


View this table:
[in this window]
[in a new window]
 
Table 1. Affinity of Quinidine and Verapamil at Cloned Human {alpha}1-ARs



View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. Inhibition of specific [125I]HEAT binding by quinidine and verapamil in membrane preparations from CHO cells stably expressing each {alpha}1-AR subtype. Specific receptor binding was defined as binding displaced by 10 µmol/L phentolamine. Data are plotted as percentage of specific binding remaining in presence of indicated concentrations of antagonists. Each point represents mean from at least three experiments performed in duplicate.

We also examined the abilities of these drugs to inhibit [125I]HEAT binding to the three cloned human {alpha}1AR subtypes at their clinically effective concentration ranges (1 µmol/L quinidine and 0.1 µmol/L verapamil).4 14 As shown in Table 2ADown, quinidine (1 µmol/L) potently inhibited the binding at all {alpha}1AR subtypes, whereas verapamil (0.1 µmol/L) had little displacing effect. When the two drugs were combined, little additive effect on [125I]HEAT binding was observed.


View this table:
[in this window]
[in a new window]
 
Table 2. Inhibitory Effects of Quinidine and Verapamil on Specific [125I]HEAT Binding and NE-Promoted Ins(1,4,5)P3 Production

To determine whether quinidine and verapamil exert agonistic or antagonistic effects on {alpha}1ARs, we further examined their effects on {alpha}1AR-mediated Ins(1,4,5)P3 production. As shown in Table 2BUp, quinidine (1 µmol/L) inhibited NE-induced Ins(1,4,5)P3 production for each {alpha}1AR subtype. Interestingly, verapamil (0.1 µmol/L) had an inhibitory effect on NE-induced Ins(1,4,5)P3 production. Moreover, quinidine (1 µmol/L) plus verapamil (0.1 µmol/L) almost abolished NE-induced Ins(1,4,5)P3 production in all {alpha}1AR subtypes. In all cells examined, neither quinidine nor verapamil alone had a stimulatory effect (data not shown), and phentolamine (10 µmol/L) abolished NE-induced Ins(1,4,5)P3 production.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Our RT-PCR study showed that {alpha}1ARs are expressed in the human cardiovascular system, and binding and functional studies using cloned human {alpha}1ARs showed for the first time that quinidine and verapamil used together clinically may exert a potent, synergistic inhibitory effect on human {alpha}1ARs.

Our radioligand studies using cloned human {alpha}1ARs provide more direct evidence for an interaction of quinidine and verapamil with human {alpha}1ARs. Compared with the previous binding studies using nonhuman {alpha}1AR,4 15 our study showed the affinity for quinidine and verapamil to be generally comparable to that for the cloned human {alpha}1AR, although data obtained from the natively expressed {alpha}1AR cannot simply be compared with those obtained with the cloned {alpha}1AR, because mixed populations of {alpha}1AR subtypes are contained in native tissues. Our approach using cells engineered by molecular biology may provide a useful model for assessing the pharmacological properties of receptors naturally expressed in human tissue.

A comparison of binding and Ins(1,4,5)P3 studies revealed an interesting property of the quinidine and verapamil interaction on {alpha}1ARs. Quinidine had an {alpha}1AR-blocking effect, whereas verapamil had little effect on the {alpha}1AR site; however, verapamil showed an inhibitory effect on {alpha}1AR-mediated Ins(1,4,5)P3 production, suggesting that it inhibits {alpha}1AR signal transduction by a mechanism other than {alpha}1AR blockade.14 It is particularly noteworthy that the two drugs, when given together at their clinically effective concentrations, inhibited the {alpha}1AR-mediated response much more potently than would be expected from their additive effect. Hence, the results suggest that the synergistic inhibition of {alpha}1AR function via the quinidine and verapamil interaction may occur not only through antagonism at {alpha}1AR sites but also through a postreceptor mechanism.

In summary, our radioligand and functional approaches using cloned human {alpha}1ARs provide more direct evidence for an interaction between quinidine and verapamil on human {alpha}1ARs. Our results show that quinidine and verapamil may have a potent, synergistic inhibitory effect on {alpha}1ARs. Clinically observed hypotension after quinidine plus verapamil can be explained by their synergistic inhibitory effects on human {alpha}1ARs.


*    Selected Abbreviations and Acronyms
 
{alpha}1AR = {alpha}1-adrenoceptor
CHO = Chinese hamster ovary
[125I]HEAT = 2-[ß-(4-hydroxy-3-[125I]iodophenyl)ethylamino-methyl] tetralone
Ins(1,4,5)P3 = inositol 1,4,5-triphosphate
NE = norepinephrine
PCR = polymerase chain reaction
RT = reverse transcriptase


*    Acknowledgments
 
This work was supported in part by research grants from the Scientific Research Fund of the Ministry of Education, Science, and Culture of Japan; a grant-in-aid from the Japan Health Science Foundation; and a grant from the Ministry of Human Health and Welfare, Tokyo, Japan.

Received January 8, 1998; revision received February 12, 1998; accepted February 12, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Marcus FI, Opie LH. Antiarrhythmic agents. In: Opie LH, ed. Drugs for the Heart. Philadelphia, Pa: W.B. Saunders; 1995:207–246.

2. Opie LH, Fishman WH, Thadani U. Calcium channel antagonists (calcium entry blockers). In: Opie LH, ed. Drugs for the Heart. Philadelphia, Pa: W.B. Saunders; 1995:50–82.

3. Maisel AS, Motulsky HJ, Insel PA. Hypotension after quinidine plus verapamil: possible additive competition at {alpha}-adrenergic receptors. N Engl J Med. 1985;312:167–170.[Medline] [Order article via Infotrieve]

4. Motulsky HJ, Maisel AS, Snavely MD, Insel PA. Quinidine is a competitive antagonist at {alpha}1- and {alpha}2-adrenergic receptors. Circ Res. 1984;55:376–381.[Abstract/Free Full Text]

5. Muller A, Noack E. Additive competitive interaction of verapamil and quinidine at {alpha}-adrenergic receptors of isolated cardiac guinea pig myocytes and human platelets. Life Sci. 1988;42:667–677.[Medline] [Order article via Infotrieve]

6. Nichols JA, Ruffolo JRR. Functions mediated by {alpha}-adrenoceptors. In: Ruffolo JRR, ed. {alpha}-Adrenoceptors: Molecular Biology, Biochemistry, and Pharmacology. Basel, Switzerland: Karger; 1991:115–179.

7. Han C, Abel PW, Minneman KP. Heterogeneity of {alpha}1-adrenergic receptors revealed by chlorethylclonidine. Mol Pharmacol. 1987;32:505–510.[Abstract]

8. Tsujimoto G, Tsujimoto A, Suzuki E, Hashimoto K. Glycogen phosphorylase activation by two different {alpha}1-adrenergic receptor subtypes: methoxamine selectively stimulates a putative {alpha}1-adrenergic receptor subtype ({alpha}1a) that couples with Ca2+ influx. Mol Pharmacol. 1989;36:166–176.[Abstract]

9. Hirasawa A, Horie K, Tanaka T, Takagaki K, Murai M, Yano J, Tsujimoto G. Cloning, functional expression and tissue distribution of human cDNA for the {alpha}1C-adrenergic receptor. Biochem Biophys Res Commun. 1993;195:902–909.[Medline] [Order article via Infotrieve]

10. Weinberg DH, Trivedi P, Tan CP, Mitra S, Perkins-Barrow A, Borkowski D, Strader CD, Bayne M. Cloning, expression and characterization of human {alpha} adrenergic receptors {alpha}1A, {alpha}1B and {alpha}1C. Biochem Biophys Res Commun. 1994;201:1296–1304.[Medline] [Order article via Infotrieve]

11. Esbenshade TA, Hirasawa A, Tsujimoto G, Tanaka T, Yano J, Minneman KP, Murphy TJ. Cloning of the human {alpha}1A/D-adrenergic receptor and inducible expression of three human subtypes in SKNMC cells. Mol Pharmacol. 1995;47:977–985.[Abstract]

12. Shibata K, Foglar R, Horie K, Obika K, Sakamoto A, Ogawa S, Tsujimoto G. KMD-3213, a novel, potent, {alpha}1a-adrenoceptor-selective antagonist: characterization using recombinant human {alpha}1-adrenoceptors and native tissues. Mol Pharmacol. 1995;48:250–258.[Abstract]

13. Munson PJ, Rodbard D. LIGAND: a versatile computerized approach for characterization of ligand-binding systems. Anal Biochem. 1980;107:220–239.[Medline] [Order article via Infotrieve]

14. Nishimura J, Kanaide H, Nakamura M. Binding of [3H]prazosin to porcine aortic membranes: interaction of calcium antagonists with vascular alpha-1 adrenoceptors. J Pharmacol Exp Ther. 1985;236:789–793.[Abstract/Free Full Text]

15. Nayler WG, Thompson JE, Jarrott B. The interaction of calcium antagonists (slow channel blockers) with myocardial alpha adrenoceptors. J Mol Cell Cardiol. 1982;14:185–188.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
G. Asemu, N. S. Dhalla, and P. S. Tappia
Inhibition of PLC improves postischemic recovery in isolated rat heart
Am J Physiol Heart Circ Physiol, December 1, 2004; 287(6): H2598 - H2605.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
Y. P. R. Jarajapu, F. Johnston, C. Berry, A. Renwick, J. C. McGrath, A. MacDonald, and C. Hillier
Functional Characterization of alpha 1-Adrenoceptor Subtypes in Human Subcutaneous Resistance Arteries
J. Pharmacol. Exp. Ther., November 1, 2001; 299(2): 729 - 734.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
R. E. Shapiro, B. Winters, M. Hales, T. Barnett, D. A. Schwinn, N. Flavahan, and D. E. Berkowitz
Endogenous Circulating Sympatholytic Factor in Orthostatic Intolerance
Hypertension, October 1, 2000; 36(4): 553 - 560.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
X. L. Rudner, D. E. Berkowitz, J. V. Booth, B. L. Funk, K. L. Cozart, E. B. D’Amico, H. El-Moalem, S. O. Page, C. D. Richardson, B. Winters, et al.
Subtype Specific Regulation of Human Vascular {alpha}1-Adrenergic Receptors by Vessel Bed and Age
Circulation, December 7, 1999; 100(23): 2336 - 2343.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shibata, K.
Right arrow Articles by Tsujimoto, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shibata, K.
Right arrow Articles by Tsujimoto, G.