(Circulation. 1997;95:2552.)
© 1997 American Heart Association, Inc.
Articles |
the Department of Cardiovascular Medicine, Graduate School of Medicine, Kyoto University, Japan.
Correspondence to Akira Matsumori, MD, PhD, Department of Cardiovascular Medicine, Graduate School of Medicine, Kyoto University, 54 Kawaracho Shogoin, Sakyo-ku, Kyoto 606, Japan.
Abstract
Background Hepatocyte growth factor (HGF) is a multifunctional factor implicated in tissue regeneration, wound healing, and angiogenesis. Circulating HGF is reportedly elevated during the early stage of myocardial infarction. However, its precise effect on the heart is unknown. To evaluate the regulation of HGF in ischemically damaged myocardium, the production of HGF and its high-affinity receptor, c-Met, was studied in a rat model of myocardial ischemia and reperfusion.
Methods and Results The plasma concentration of HGF began to increase within 1 hour of reperfusion after 1 hour of ischemia. The peak level was reached at 3 hours after reperfusion. Northern blotting revealed that HGF mRNA expression in the heart was augmented threefold at 24 and 48 hours and remained elevated by twofold at 120 hours after the myocardium was reperfused. The signal for c-met , high-affinity HGF receptor mRNA, was also upregulated parallel to upregulation for HGF. In the kidney, liver, lung, and spleen, HGF mRNA was also maximally increased at 12 hours after reperfusion. However, c-met was not upregulated in these organs. Immunohistochemical studies disclosed that capillary endothelial and interstitial cells, including infiltrating macrophages, were intensely stained for HGF, whereas capillary endothelial cells in the reperfused myocardium were positive for c-Met.
Conclusions This study is the first to show that myocardial ischemia and reperfusion induced HGF expression in various organs in vivo. These results indicate that HGF/c-Met plays a role in capillary endothelial cell regeneration in the ischemically injured heart.
Key Words: hepatocyte growth factor myocardial infarction immunohistochemistry collateral circulation reperfusion
Hepatocyte growth factor, which has mitogenic actions on cultured hepatocytes,1 was originally isolated from the sera of rats after partial hepatectomy. Human HGF and rat HGF have since been cloned and sequenced.2 3 Rat HGF consists of two subunits,
and ß, containing 440 and 233 amino acids, respectively, and it has significant sequence and domain homology to plasminogen.3 In the rat, HGF mRNA is expressed in the liver and in a number of other organs, including the kidney, lung, and spleen.4 HGF is indistinguishable from scatter factor, a fibroblast-secreted protein that promotes the motility and matrix invasion of epithelial cells.5 This cytokine is also synthesized and secreted by vascular smooth muscle cells and acts on endothelial cells, stimulating migration, protease production, invasion, proliferation, and differentiation into capillary-like tubes in vitro.6 7
The HGF receptor is the c-met protooncogene product (the c-Met receptor).8 It is a heterodimeric protein consisting of
- and ß-subunits, which are derived from a single-chain precursor by proteolytic processing.9 10 The c-Met receptor has features characteristic of the tyrosine kinase family of growth factor receptors.11
As with most growth factors, the precise effects of HGF in vivo are unknown. HGF expression is increased in the regenerating rat liver after partial hepatectomy and after toxic liver injury induced by CCl4.12 13 A similarly increased expression of HGF has also been demonstrated in regenerating and developing skeletal muscle.14 The circulating HGF concentration is elevated in the early stage of acute myocardial infarction.15 It therefore appears that HGF has some function in patients with myocardial infarction. Physiological quantities of purified HGF induce angiogenesis in vivo.16 In view of the involvement of HGF in tissue regeneration and angiogenesis, we considered it of interest to study the role of HGF in ischemically damaged myocardium. In the present study, we evaluated HGF/c-Met production at the peptide and mRNA levels using an experimental rat model of MI/R.
Methods
Experimental Animal Preparation
Male Wistar rats (weight, 250 to 300 g; Shizuoka Agricultural Cooperation Association, Shizuoka, Japan) were anesthetized with sodium pentobarbital (50 mg/kg IP), and positive-pressure respiration was applied through an endotracheal tube. The thorax was opened at the fourth left intercostal space, and a silk ligature was looped under the left anterior descending coronary artery
2 mm from its origin. The ligature was pulled, occluding the artery, for 1 hour and then released. The thorax was closed, and the rats were returned to their cages. Sham-operated rats underwent the same surgical procedures except that the suture that passed under the left anterior descending coronary artery was not tied. Rats had free access to standard laboratory food and tap water. At all stages of the experiments, the rats were treated in accordance with local institutional guidelines. At each specified time after surgery, the rats were killed by excision of the heart under anesthesia.
Plasma Sampling and HGF Assay
The abdomen was opened under pentobarbital anesthesia. Blood (4 mL) was rapidly obtained by puncturing the abdominal aorta. The blood was transferred to chilled tubes containing aprotinin (1000 kallidinogenase inactivator units per milliliter) and Na2 EDTA (1 mg/mL) and immediately centrifuged at 4°C. Plasma samples were stored at -80°C until HGF assay. The plasma concentration of HGF in 50 µL of rat plasma was measured by use of specific ELISA kits (Institute of Immunology) with a sensitivity of 0.2 ng/mL.
Gene Expression in Hearts
The left ventricles of four rats in each group were dissected to obtain nonischemic and ischemic reperfused myocardium, which was immediately frozen. Nonischemic myocardial samples contained only the interventricular septum because it is never ischemic in this model. The borderline between the nonischemic and ischemic reperfused areas was included in the ischemic reperfused area. The entire experiment was repeated three times.
Whole-Organ Gene Expression
The whole liver, kidney, lung, and spleen of three rats in each group were obtained and immediately frozen. Three separate sets of experiments were performed.
DNA Probes
The following cDNA clones were used to prepare DNA probes: HGF, a 1.4-kb EcoRI fragment of rat HGF cDNA,3 and GAPDH, a 1.2-kb PstI fragment of human GAPDH cDNA.17 Sense primer and antisense primers were synthesized with the use of the published rat c-met cDNA sequences. The actual sequences of the oligonucleotides were as follows: sense, 5'GAGCACTGTTTCAATAGGACCCTGCTG3'; antisense, 5'TGGAGACACAGGATAGGAATCCAGGAG3'. The polymerase chain reaction product of rat c-met was cloned into the EcoRV site of pBluescript (Stratagene Inc). The DNA sequence was confirmed by dideoxy-chain termination and used to prepare the probes.
RNA Preparation and Northern Blotting
Total RNA was isolated by use of guanidine thiocyanate/phenol/chloroform/isoamyl alcohol.18 Up to 500 µg of total RNA was then poly(A)+ selected on oligo(dT) columns (oligotex-dT30, Roche).19 Poly(A)+ RNA (8 µg) was resolved by electrophoresis on a 1.2% agarose-formaldehyde gel, transferred to a nylon membrane (GeneScreen, NEN Research Products), and successively hybridized with the cDNA probes for HGF, c-met, and GAPDH.
Quantification of the RNA Message
The RNA message was quantified with the use of a Fujix BAS 2000 image analyzer (Fujix, Japan) with normalization to the GAPDH message levels.20 The results of three independent experiments were analyzed.
Statistical Analysis
Values are expressed as the mean±SE, and significance was established by one-way ANOVA with multiple comparisons with Fisher's protected least significant difference test. In all analyses, the level of statistical significance used was the 95% confidence level.
Immunohistochemistry
A cross section of the left ventricle was made perpendicular to the long axis of the heart in the sham-operated rats and rats with MI/R. These tissues were embedded in OCT compound (Tissue Tek, Miles Inc), quickly frozen in dry ice/acetone, and stored at -80°C. Cryostat sections were cut at a thickness of 6 µm and fixed in acetone at 4°C for 10 minutes. The primary antibodies were rabbit polyclonal anti-human a-chain of HGF (Immunobiological Laboratories) at a concentration of 10 µg/mL, rabbit polyclonal anti-human met gene product (Santa Cruz Biochemistry, Inc) at a concentration of 1.0 µg/mL, and mouse monoclonal anti-rat macrophage (clone Ki-M2R, BMA) diluted 1:50. The sections were incubated with the primary antibody at 4°C overnight. Biotinylated goat anti-rabbit IgG (Dako) and biotinylated goat anti-mouse IgG (Dako) diluted 1:300 were used as the secondary antibodies in incubations at room temperature for 30 minutes. After incubation with the avidin-biotinhorseradish peroxidase complex (Vector Laboratories), peroxidase was visualized by DAB followed by incubation with DAB-enhancing solution (Vector Labs). The sections were counterstained with methyl green. The primary antibodies were omitted in the control sections. The specificity of the staining for HGF and c-Met was demonstrated by incubating 10 µg of anti-HGF polyclonal antibody with 100 µg of recombinant rat HGF (kindly donated by Otsuka Pharmaceutical Co, Tokushima, Japan) and 10 µg of polyclonal anti-human met gene product with 100 µg of control peptide provided by Santa Cruz (Calif) Biotechnology, Inc for 2 hours at 37°C, which blocked the staining in representative sections of the myocardium.
Histopathology
Triplicate 2-µm sections from the ring in the middle of the infarct zone were stained with hematoxylin and eosin, Masson's trichrome, or Toluidine blue stain, as described elsewhere.21 22 23 24 Features of necrosis and healing were graded on a four-point scale (0, absent; 1, mild; 2, moderate; and 3, severe).
Results
Plasma Level of HGF in Rats With MI/R
Blood was obtained from rats with MI/R, and the plasma concentration of HGF was measured by use of specific ELISA kits. Fig 1
shows the change in the plasma HGF concentration in rats with MI/R. The plasma HGF concentration in the sham-operated rats was below the detection limit (0.2 ng/mL) at 0, 12, and 24 hours after reperfusion, but it was slightly increased compared with before the operation at 3 and 6 hours after reperfusion. In the rats with MI/R, the plasma HGF concentration was increased to 3.4±0.4 ng/mL at 3 hours after reperfusion, and it was still elevated at 24 hours after reperfusion.
|
HGF and c-Met Expression in the Heart
To determine whether or not the upregulation of HGF and c-met is selective for the ischemic reperfused region, we examined its expression in the nonischemic, ischemic reperfused, and sham-operated myocardium. The left ventricles of four rats in each group were dissected to obtain the nonischemic and ischemic reperfused myocardium. The level of HGF mRNA was significantly increased in the ischemic reperfused myocardium at 12, 24, 48, and 120 hours after reperfusion (178±28%, 320±48%, 316±42%, and 168±25%, respectively; P<.05 versus sham-operated myocardium). The c-met mRNA expression was also increased at 24, 48, and 120 hours after reperfusion (302±42%, 319±51%, and 172±28%, respectively; P<.05 versus sham-operated myocardium). However, there were no significant increases in the nonischemic or sham-operated myocardium (Figs 2
and 3
).
|
|
HGF and c-Met Expression in Other Organs
The HGF mRNA level tended to increase in all rats subjected to surgical stress, including the sham-operated rats. The increase was most pronounced in rats with MI/R at 12 hours after reperfusion, and the increase was 322±39% in the kidney, 588±88% in the liver, 523±42% in the lung, and 652±47% in the spleen, respectively. However, no significant changes in the c-met mRNA levels in these organs were evident (Figs 4
and 5
).
|
|
Immunohistochemistry
No immunostaining was evident in the control hearts. In contrast, the cytoplasm of endothelial and interstitial cells was intensely stained for HGF in sections of the ischemic reperfused hearts obtained at 24 and 48 hours after reperfusion. Cardiac muscle fibers were negative for HGF (Fig 6
). An examination of serial sections of heart tissue revealed that most of these interstitial cells were macrophages (Fig 7
A and B). These HGF-positive cells were localized at the border zone (Fig 8
). The capillary endothelial cells in the border zone were positive for high-affinity HGF receptor (c-Met) immunoreactivity, and the staining was intense 24 and 48 hours after reperfusion (Fig 9
). Immunostaining for HGF and c-Met was negative in the staining with the antibodies preabsorbed with each antigen, recombinant rat HGF, and control peptide for polyclonal anti-human met gene product (Fig 10
A and B).
|
|
|
|
|
Histopathological Parameters of Healing in Reperfused Hearts
The histological changes are summarized in the Table
. Compared with the rat myocardial infarction model,24 infiltration of polymorphonuclear leukocytes and vascular proliferation occurred earlier in this MI/R model.
|
Discussion
In this study, the plasma HGF concentration peaked at 3 hours and remained elevated at 24 hours after reperfusion after 1 hour of myocardial ischemia in rats. The HGF and c-met mRNA levels reached a maximum at 24 hours in the reperfused myocardium. HGF mRNA was also upregulated in the kidney, liver, lung, and spleen. However, c-met was not upregulated in these organs. Our results are the first to show HGF production in vivo in an experimental animal model of MI/R and the first to indicate that HGF/c-met plays a role in myocardial infarction.
The first increase in HGF activity in the plasma was noted 1 hour after reperfusion, and the activity reached a peak 3 hours after reperfusion, which was much earlier than the peak HGF mRNA level in the heart and other organs. Kinoshita et al25 reported that the plasma HGF of hepatectomized rats increased 3 hours after liver resection, although the HGF mRNA level in the remnant liver reached a maximum at 24 hours. These results suggest that posttranscriptional regulation may be important for the initial increase in plasma HGF.
HGF is supplied by autocrine, paracrine, and endocrine mechanisms.26 A putative signal molecule, "injurin," is thought to be released from the damaged or remnant liver after partial hepatectomy.27 "Injurin" is a heat- and acid-stable protein with a molecular weight of 10 to 20 kD that appears to be distinct from other known cytokines. This factor is thought to be released into the circulation and to act in turn on the spleen or lung, inducing HGF expression. Whether or not this "injurin" is produced from the ischemically injured myocardium has not yet been clarified, and further study is needed.
HGF is secreted as a single-chain precursor from producing cells. In response to tissue injury, the single-chain precursor is converted into a biologically active heterodimer by a serine protease, the activity of which is initiated in the injured tissue.28 29 The serum serine protease that activates the single-chain HGF has been identified as HGF activator, and its sequence is homologous to that of blood coagulation factor XIIa,30 which activates single-chain HGF. Because factor XIIa is activated during the initiation of contact activation induced by tissue injury, it may also function as an HGF-converting enzyme in MI/R.
In our study, HGF expression in the heart was upregulated only in the ischemic reperfused region, indicating that the effect of HGF would be enhanced in this region. Two sequence elements, an IL-6 response element and a potential binding site for nuclear factorIL-6, are located near the transcription initiation site of the human HGF gene, and they might be involved in the regulation of HGF gene expression.31 IL-1
, IL-1ß, TNF-
, and interferon-
stimulate HGF production.32 In the rat model of MI/R, cardiac TNF-
and IL-1ß mRNA levels are increased, and immunostaining revealed TNF-
and IL-1ß proteins only in the ischemic reperfused myocardium.33 These results provide evidence for the upregulation of HGF gene expression in the ischemic reperfused myocardium by those inflammatory cytokines.
In general, the regulation of c-met expression follows a different pattern than that of HGF.34 The HGF message is induced at sites distant from the damaging stimulus, whereas the target for HGF, c-met, is selectively upregulated in the reperfused myocardium in this model. In the kidney, liver, lung, or spleen, c-met expression did not increase. These findings were consistent with the absence of injury to these organs, indicating a local response to injury. In human carcinoma cell lines, inflammatory cytokines such as IL-1
, IL-6, and TNF-
, as well as transforming growth factor-ß1, epidermal growth factor, and the steroidal hormones, markedly influence the steady-state level of c-met mRNA.35 This suggests that c-met may be upregulated locally by inflammatory cytokines in the reperfused heart.
The polyclonal anti-HGF antibody used in the present study recognizes the
-chain of HGF. Therefore, we cannot distinguish the active form from the inactive single chain. However, we found immunoreactivity for HGF in capillary endothelial and interstitial cells, including infiltrating macrophages. The high-affinity HGF receptor was located in the capillary endothelial cells. HGF stimulates vascular endothelial cell migration, proliferation, and organization into capillary-like tubes in vitro.6 Thus, the HGF secreted from these cells may have mitogenic or trophic effects on capillary endothelial cells.
Healing after myocardial infarction is a dynamic process involving edema, hemorrhage, leukocyte infiltration, and vascular proliferation. During healing in this model, vascular proliferation occurs from 1 day until 1 week after reperfusion. Demonstration that either preventing the increase or blocking the effect of HGF/c-Met activity changed the biological response would provide further information about the pathophysiological implications in this setting. Nevertheless, the expression of HGF and c-met mRNA in the heart was enhanced almost in parallel with this vascular proliferation. The c-met mRNA upregulation was also localized in the reperfused myocardium, and c-Met immunostaining was positive in the capillary endothelium. Therefore, HGF/c-Met may be implicated in capillary endothelial cell proliferation and regeneration during the healing process in this model.
Purified native mouse scatter factor and recombinant human HGF induce angiogenesis in vivo.16 Our results revealed that HGF mRNA was induced in the ischemic reperfused heart and suggest that HGF plays some role in coronary collateral formation in the ischemic heart. Whereas heparin may be an angiogenic inducer in the ischemic heart in humans and other animals,36 37 HGF, as a heparin-potentiated angiogenesis factor38 39 40 secreted from the heart and other organs in vivo, may participate in that environment.
Further clarification of the biological and physiological significance of HGF in ischemic hearts will likely have important clinical implications.
Selected Abbreviations and Acronyms
|
Acknowledgments
We thank Tomoyoshi Nishino for providing HGF cDNA clone and Eiji Nonomura for providing recombinant rat HGF.
Received October 23, 1996; revision received December 9, 1996; accepted January 1, 1997.
References
This article has been cited by other articles:
![]() |
N. A. Gude, G. Emmanuel, W. Wu, C. T. Cottage, K. Fischer, P. Quijada, J. A. Muraski, R. Alvarez, M. Rubio, E. Schaefer, et al. Activation of Notch-Mediated Protective Signaling in the Myocardium Circ. Res., May 9, 2008; 102(9): 1025 - 1035. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-W. Lin, W. H.-H. Sheu, W.-J. Lee, Y.-T. Chen, T.-J. Liu, C.-T. Ting, and W.-L. Lee Circulating Hepatocyte Growth Factor Level but Not Basic Fibroblast Growth Factor Level Is Elevated in Angiography-Proven Symptomatic Peripheral Artery Disease Angiology, September 1, 2007; 58(4): 420 - 428. [Abstract] [PDF] |
||||
![]() |
T. Ohnishi, K. Kakimoto, K. Bandow, C. J. Lowenstein, Y. Daikuhara, and T. Matsuguchi Mature Hepatocyte Growth Factor/Scatter Factor on the Surface of Human Granulocytes Is Released by a Mechanism Involving Activated Factor Xa. J. Immunol., June 1, 2006; 176(11): 6945 - 6953. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-R. Son, L. A. Marquez-Curtis, M. Kucia, M. Wysoczynski, A. R. Turner, J. Ratajczak, M. Z. Ratajczak, and A. Janowska-Wieczorek Migration of Bone Marrow and Cord Blood Mesenchymal Stem Cells In Vitro Is Regulated by Stromal-Derived Factor-1-CXCR4 and Hepatocyte Growth Factor-c-met Axes and Involves Matrix Metalloproteinases Stem Cells, May 1, 2006; 24(5): 1254 - 1264. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shirakawa, Y. Sawa, Y. Takewa, E. Tatsumi, Y. Kaneda, Y. Taenaka, and H. Matsuda Gene transfection with human hepatocyte growth factor complementary DNA plasmids attenuates cardiac remodeling after acute myocardial infarction in goat hearts implanted with ventricular assist devices J. Thorac. Cardiovasc. Surg., September 1, 2005; 130(3): 624 - 632. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Gerritsen HGF and VEGF: A Dynamic Duo Circ. Res., February 18, 2005; 96(3): 272 - 273. [Full Text] [PDF] |
||||
![]() |
J.-K. Min, Y.-M. Lee, J. H. Kim, Y.-M. Kim, S. W. Kim, S.-Y. Lee, Y. S. Gho, G. T. Oh, and Y.-G. Kwon Hepatocyte Growth Factor Suppresses Vascular Endothelial Growth Factor-Induced Expression of Endothelial ICAM-1 and VCAM-1 by Inhibiting the Nuclear Factor-{kappa}B Pathway Circ. Res., February 18, 2005; 96(3): 300 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Cao, A. Hong, H. Schulten, and M. J. Post Update on therapeutic neovascularization Cardiovasc Res, February 15, 2005; 65(3): 639 - 648. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wojakowski, M. Tendera, A. Michalowska, M. Majka, M. Kucia, K. Maslankiewicz, R. Wyderka, A. Ochala, and M. Z. Ratajczak Mobilization of CD34/CXCR4+, CD34/CD117+, c-met+ Stem Cells, and Mononuclear Cells Expressing Early Cardiac, Muscle, and Endothelial Markers Into Peripheral Blood in Patients With Acute Myocardial Infarction Circulation, November 16, 2004; 110(20): 3213 - 3220. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lei, R. Zhou, W. Zheng, L. P. Christensen, R. M. Weiss, and R. J. Tomanek Bradycardia Induces Angiogenesis, Increases Coronary Reserve, and Preserves Function of the Postinfarcted Heart Circulation, August 17, 2004; 110(7): 796 - 802. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pikkarainen, H. Tokola, R. Kerkela, and H. Ruskoaho GATA transcription factors in the developing and adult heart Cardiovasc Res, August 1, 2004; 63(2): 196 - 207. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Day, G. Thiel, J. Lum, R. D. Chevere, Y. Yang, J. Stevens, L. Sibert, and B. L. Fanburg Hepatocyte Growth Factor Regulates Angiotensin Converting Enzyme Expression J. Biol. Chem., March 5, 2004; 279(10): 8792 - 8801. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Jayasankar, Y. J. Woo, L. T. Bish, T. J. Pirolli, S. Chatterjee, M. F. Berry, J. Burdick, T. J. Gardner, and H. L. Sweeney Gene Transfer of Hepatocyte Growth Factor Attenuates Postinfarction Heart Failure Circulation, September 9, 2003; 108(90101): II-230 - 236. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ding, T. Merkulova-Rainon, Z. C. Han, and G. Tobelem HGF receptor up-regulation contributes to the angiogenic phenotype of human endothelial cells and promotes angiogenesis in vitro Blood, June 15, 2003; 101(12): 4816 - 4822. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, G. Takemura, K.-i. Kosai, K. Yuge, S. Nagano, M. Esaki, K. Goto, T. Takahashi, K. Hayakawa, M. Koda, et al. Postinfarction Treatment With an Adenoviral Vector Expressing Hepatocyte Growth Factor Relieves Chronic Left Ventricular Remodeling and Dysfunction in Mice Circulation, May 20, 2003; 107(19): 2499 - 2506. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Lenihan, A. Osman, V. Sriram, J. Aitsebaomo, and C. Patterson Evidence for association of coronary sinus levels of hepatocyte growth factor and collateralization in human coronary disease Am J Physiol Heart Circ Physiol, May 1, 2003; 284(5): H1507 - H1512. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ahmet, Y. Sawa, T. Yamaguchi, and H. Matsuda Gene transfer of hepatocyte growth factor improves angiogenesis and function of chronic ischemic myocardium in canine heart Ann. Thorac. Surg., April 1, 2003; 75(4): 1283 - 1287. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Tomita, R. Morishita, Y. Taniyama, H. Koike, M. Aoki, H. Shimizu, K. Matsumoto, T. Nakamura, Y. Kaneda, and T. Ogihara Angiogenic Property of Hepatocyte Growth Factor Is Dependent on Upregulation of Essential Transcription Factor for Angiogenesis, ets-1 Circulation, March 18, 2003; 107(10): 1411 - 1417. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kitta, R. M. Day, Y. Kim, I. Torregroza, T. Evans, and Y. J. Suzuki Hepatocyte Growth Factor Induces GATA-4 Phosphorylation and Cell Survival in Cardiac Muscle Cells J. Biol. Chem., February 7, 2003; 278(7): 4705 - 4712. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Heeschen, S. Dimmeler, C. W. Hamm, E. Boersma, A. M. Zeiher, M. L. Simoons, and on Behalf of the CAPTURE (c7E3 Anti-Platelet Thera Prognostic Significance of Angiogenic Growth Factor Serum Levels in Patients With Acute Coronary Syndromes Circulation, February 4, 2003; 107(4): 524 - 530. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Jin, R. Yang, W. Li, A. K. Ogasawara, R. Schwall, D. A. Eberhard, Z. Zheng, D. Kahn, and N. F. Paoni Early Treatment with Hepatocyte Growth Factor Improves Cardiac Function in Experimental Heart Failure Induced by Myocardial Infarction J. Pharmacol. Exp. Ther., February 1, 2003; 304(2): 654 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kinoshita, T. Miyamoto, N. Ohashi, S. Sasayama, and A. Matsumori Thrombosis Increases Circulatory Hepatocyte Growth Factor by Degranulation of Mast Cells Circulation, December 10, 2002; 106(24): 3133 - 3138. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Funatsu, Y. Sawa, S. Ohtake, T. Takahashi, G. Matsumiya, N. Matsuura, T. Nakamura, and H. Matsuda Therapeutic angiogenesis in the ischemic canine heart induced by myocardial injection of naked complementary DNA plasmid encoding hepatocyte growth factor J. Thorac. Cardiovasc. Surg., December 1, 2002; 124(6): 1099 - 1105. [Abstract] [Full Text] |
||||
![]() |
I. M.C. Dixon Help from within: cardioprotective properties of hepatocyte growth factor Cardiovasc Res, July 1, 2001; 51(1): 4 - 6. [Full Text] [PDF] |
||||
![]() |
H. Ueda, T. Nakamura, K. Matsumoto, Y. Sawa, H. Matsuda, and T. Nakamura A potential cardioprotective role of hepatocyte growth factor in myocardial infarction in rats |