This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Vincenti, V. Articles by Persico, M. G. Search for Related Content PubMed PubMed Citation Articles by Vincenti, V. Articles by Persico, M. G.

(Circulation. 1996;93:1493-1495.)
© 1996 American Heart Association, Inc.

Articles

Assignment of the Vascular Endothelial Growth Factor Gene to Human Chromosome 6p21.3

Valeria Vincenti, MS; Caterina Cassano, MS; Mariano Rocchi, PhD; M. Graziella Persico, PhD

From the International Institute of Genetics and Biophysics, CNR, Naples (V.V., M.G.P.), and the Istituto di Genetica, Bari (C.C., M.R.), Italy.

Correspondence to M. Graziella Persico, International Institute of Genetics and Biophysics, CNR, Via Guglielmo Marconi 12, 80125 Naples, Italy.

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background Vascular endothelial growth factor (VEGF) is an endothelial cell–specific growth factor and a regulator of physiological and pathological angiogenesis. Four different proteins are produced by alternative splicing of a unique transcript generated from a single-copy gene. Knowledge of the chromosomal location of the VEGF gene would help in determining a linkage to any known human congenital syndrome and/or to known chromosomal rearrangements in tumors.

Methods and Results A human chromosome mapping panel was used to assign the VEGF gene to human chromosomes by polymerase chain reaction using VEGF-specific oligonucleotide primers. Amplified DNA fragments were fractionated on a 1% agarose gel. A single band of the expected size was obtained only from the DNA of those hybrid cell lines that contained the human chromosome 6. Three YAC clones containing the VEGF gene were obtained by screening the ICI Diagnostics library. In situ hybridization was then used to locate the VEGF gene in the 6p21.3 region.

Conclusions The location of the VEGF gene in the 6p21.3 region is a potential starting point for a linkage study. In addition, the isolation of YAC clones containing the VEGF gene will contribute to the construction of the physical map of this chromosomal region.

Key Words: angiogenesis • growth substances • genes

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Vascular endothelial growth factor (VEGF) is a growth factor for endothelial cells in vitro; it elicited an angiogenic response in several in vivo assays.^{1 2} In addition, VEGF is able to increase the permeability of capillary vessels to different macromolecules. VEGF consists of a family of polypeptide isoforms, generated from a single-copy gene by alternative splicing of the primary transcript.³ VEGF is secreted by intact cells as a dimer of the four isoforms of 121, 165, 189, and 206 amino acids. All forms, except homodimeric VEGF₁₂₁, can bind heparin in vitro and bind heparan derivatives of the extracellular matrix in vivo. VEGF produced from several cell types binds to the two endothelial cell–specific receptors Flt-1 and Flk-1/KDR.^{4 5} VEGF mRNA is expressed in a variety of normal adult tissues and during embryonic development, as well as in many tumors. VEGF mRNA expression is upregulated by oxygen deprivation in vitro in several cell types as well as by ischemia in vivo.⁶ Intravenous administration of VEGF results in enhanced collateral vessel formation in the rabbit ischemic hind limb.^{7 8}

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Polymerase Chain Reaction Amplification Analysis and Chromosomal Mapping Panel
The hamsterxhuman hybrid cell lines were characterized for their human chromosome content.⁹ Oligonucleotide primers (sense, GTGGTGAAGTTCATGGATGTCTA; antisense, TTGGTGAGGTTTGATCCGCATAA) were chosen from the published VEGF genomic sequence to amplify a 1119-bp portion of the human VEGF gene.³ Three hundred nanograms of DNA from each cell line was amplified in 25 µL of 50 mmol/L KCl, 1.5 mmol/L MgCl₂, 10 mmol/L Tris-HCl (pH 8.5), 20 µg/mL gelatin, 0.2 mmol/L each dNTP, 0.2 µmol/L each oligonucleotide, and 0.5 units Ampli-Taq polymerase (Perkin-Elmer Cetus). Reactions were performed for 35 rounds of amplification as follows: 45 seconds at 94°C for denaturation, 40 seconds at 60°C for annealing, and 2 minutes at 72°C for extension. Amplified DNA fragments were fractionated on a 1% agarose gel in TBE (53 mmol/L Tris-base, 53 mmol/L boric acid, 1.2 mmol/L EDTA). DNA was then transferred onto nylon Hybond-N membranes (Amersham Inc) according to the manufacturer's instructions. Hybridization reactions were performed at 65°C as previously described.⁹ The VEGF probe corresponding to a 0.6-kb EcoRI-BamHI cDNA fragment spanning the entire human VEGF₁₂₁ isoform was provided by Dr H. Weich, Braunschweig, Germany.

YAC Isolation and Fluorescent In Situ Hybridization Analysis
A human YAC library was screened to isolate VEGF-specific clones. The ICI library¹⁰ was screened at the YAC screening center DIBIT-HSR, Milan, Italy, by polymerase chain reaction analysis using the primers described above. Human metaphase chromosome preparations, probe labeling, and in situ hybridization were performed as previously described.¹¹

	Results

Top Abstract Introduction Methods Results Discussion References

 
Chromosome Mapping With Somatic Cell Hybrid Panel
A human chromosome mapping panel was used to assign the VEGF gene to human chromosome 6. A human VEGF-specific fragment was amplified from 300 ng of cell hybrid DNA template. A single band of the expected size (1119 bp) was obtained only from the DNA of the hybrid cell lines containing chromosome 6 (Table). Southern blot hybridization of the polymerase chain reaction products with a VEGF-specific probe confirmed the identity of the reaction product (data not shown).

View this table: [in this window] [in a new window]   Table 1. Segregation of VEGF Sequence in HumanxHamster Hybrids

In situ hybridization was used to determine regional location of the VEGF gene. Three independent YAC clones (10CC7, 9DE2, and 28FD11) containing the VEGF gene were obtained by screening of the ICI library.¹⁰ Metaphase chromosome spreads were prepared from phytohemagglutinin-stimulated whole blood by standard techniques. Total DNA from YAC clones 10CC7 and 28FD11 was labeled with biotin-16-dUTP by nick translation. A probe concentration of 5 ng/mL was used, with 300 ng of human Cot-1 competitor DNA/µL. Hybridization to all four chromatids in the 6p21.3 region was observed in all 10 metaphase spreads that were analyzed for each YAC probe used.

The Figure shows a typical hybridization of the YAC clone 28FD11 to the 6p21.3 region of both chromatids of both chromosomes.

View larger version (48K): [in this window] [in a new window]   Figure 1. Fluorescent in situ hybridization of the YAC clone 28FD11 on metaphase chromosomes showing specific hybridization to chromosome 6p. Metaphase chromosome spreads were prepared from phytohemagglutinin-stimulated whole blood by standard techniques.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The VEGF primary protein sequence shares homology with another angiogenic factor, placenta growth factor (PlGF).^{9 12} Both VEGF and PlGF contain the eight-cysteine-residue motif characteristic of platelet-derived growth factor. These factors are active as homodimers PlGF/PlGF and VEGF/VEGF and heterodimers PlGF/VEGF. The VEGF homodimer binds to both Flt-1 and KDR/Flk-1 receptors.^{4 5} The PlGF homodimer binds only to the Flt-1 receptor.⁵ It has been hypothesized that the two receptors also could form heterodimers and homodimers.¹² Presumably, the three protein forms could bind with different affinity to the three endothelium-specific receptor isoforms, thereby eliciting specific signal transduction cascades. Mutations in the polypeptide chain could impair either dimer formation or binding to the receptor.

Flt-1 and Flk-1/KDR deficiencies cause in utero death of mouse embryos between 8.5 and 9.5 days postcoitum.^{13 14} The analysis of homozygous Flk-1/KDR null mutant embryos reveals a defect in the development of hemopoietic and endothelial cells.¹³ Organized blood vessels are not observed either in the embryo or in the yolk sac, and hemopoietic progenitors are severely reduced. These results suggest that Flk-1/KDR is essential for yolk sac blood-island formation and vasculogenesis in the mouse embryo.¹³ Mouse embryos homozygous for a targeted mutation in the Flt-1 locus produced endothelial cells in both extraembryonic regions but assembled these cells into abnormal vascular channels; such embryos died in utero at midsomite stages.¹⁴ These data suggest that the Flt-1 signaling pathway may regulate normal endothelial cell-cell or cell-matrix interaction during vascular development.¹⁴

The human VEGF gene was mapped to determine whether associated mutations could possibly correspond to any known human congenital syndrome and/or to known chromosomal rearrangements in tumors.

Several diseases whose genetic defect is unknown have been mapped to the human 6p21.3 band.¹⁵ Among these, we draw attention to the atrial septal defect secundum type and hemocromatosis. Both Flt-1 and KDR/Flk-1 receptor genes have recently been mapped on chromosomes 4 and 13, respectively.^{16 17} We have mapped the mouse Plgf gene to chromosome 12, one cM from D12Mit5, and the human PlGF gene to 14q24 using both FISH and genetic crosses. The comparative analysis of the phenotypes of transgenic mice and mapping of human disease genes could help in understanding the role of these growth factors and their receptors in normal and pathological angiogenesis.

	Acknowledgments

 
This work was supported by grants from the Associazione Italiana Ricerca sul Cancro (AIRC), Progetto Finalizzato "Applicazioni Cliniche della Ricerca Oncologica"; the CNR; and the Ministero della Sanità, Istituto Superiore di Sanità "Progetto A.I.D.S. 1994-Roma-Italia" to Dr Persico and in part by grants from the AIRC and Telethon Program to Dr Rocchi.

Received January 9, 1996; revision received January 31, 1996; accepted February 1, 1996.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Keck PJ, Hauser SD, Krivi G, Sanzo K, Warren T, Feder J, Connolly DT. Vascular permeability factor, an endothelial cell mitogen related to PDGF. Science. 1989;246:1309-1312. [Abstract/Free Full Text]

2. Leung DW, Cachianes G, Kuang W, Goeddel DV, Ferrara N. Vascular endothelial growth factor is a secreted angiogenic mitogen. Science. 1989;246:1306-1309. [Abstract/Free Full Text]

3. Tischer E, Mitchell R, Hartman T, Silva M, Gospodarowicz D, Fiddes JC, Abraham JA. The human gene for vascular endothelial growth factor. J Biol Chem. 1991;266:11947-11954. [Abstract/Free Full Text]

4. De Vries C, Escobedo JA, Ueno H, Houck K, Ferrara N, Williams LT. The fms-like tyrosine kinase, a receptor for vascular endothelial growth factor. Science. 1992;255:989-991. [Abstract/Free Full Text]

5. Terman BI, Khandke L, Dougher-Vermazan M, Maglione D, Lassam NJ, Gospodarowicz D, Persico MG, Böhlen P, Eisinger MG. VEGF receptor subtypes KDR and FLT1 show different sensitivities to heparin and placenta growth factor. Growth Factors. 1994;11:187-195. [Medline] [Order article via Infotrieve]

6. Hashimoto E, Ogita T, Nakaoka T, Matsuoka R, Takao A, Kira Y. Rapid induction of vascular endothelial growth factor expression by transient ischemia in rat heart. Am J Physiol. 1994;267:1948-1954.

7. Takeshita S, Zheng LP, Brogi E, Kearney M, Pu L-Q, Bunting S, Ferrara N, Symes JF, Isner JM. Therapeutic angiogenesis: a single intraarterial bolus of vascular endothelial growth factor augments revascularization in a rabbit ischemic hind limb model. J Clin Invest. 1994;93:662-670.

8. Callow AD, Choi ET, Trachtenberg JD, Stevens SL, Connolly DT, Rodi C, Ryan U. Vascular permeability factor accelerates endothelial regrowth following balloon angioplasty. Growth Factors. 1994;10:223-228. [Medline] [Order article via Infotrieve]

9. Maglione D, Guerriero V, Viglietto G, Ferraro MG, Aprelikova O, Alitalo K, Del Vecchio S, Lei K-J, Chou JY, Persico MG. Two alternative mRNAs coding for the angiogenic factor, placenta growth factor (PlGF), are transcribed from a single gene of chromosome 14. Oncogene. 1993;8:925-931. [Medline] [Order article via Infotrieve]

10. Anand R, Villasante A, Tyler-Smith C. Construction of yeast artificial libraries with large inserts using fractionation by pulsed-field gel electrophoresis. Nucleic Acids Res. 1989;17:3425-3433. [Abstract/Free Full Text]

11. DiPalma T, Tucci M, Russo G, Maglione D, Lago CT, Romano A, Saccone S, DellaValle G, De Gregorio L, Dragani TA, Viglietto G, Persico MG. The placenta growth factor gene of the mouse. Mamm Genome. In press.

12. Maglione D, Guerriero V, Viglietto G, Delli-Bovi P, Persico MG. Isolation of human placenta cDNA coding for a protein related to the vascular permeability factor. Proc Natl Acad Sci U S A. 1991;88:9267-9271. [Abstract/Free Full Text]

13. Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu X-F, Breltman ML, Schuh AC. Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature. 1995;376:62-66. [Medline] [Order article via Infotrieve]

14. Fong G-H, Rossant J, Gertsenstein M, Breltman ML. Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature. 1995;376:66-70. [Medline] [Order article via Infotrieve]

15. Volz A, Boyle JM, Cann HM, Cottingham RW, Orr HT, Ziegler A. Report of the Second International Workshop on Human Chromosome 6. Genomics. 1994;21:464-472.[Medline] [Order article via Infotrieve]

16. Spritz RA, Strunk KM, Lee ST, Lu-Kuo JM, Ward DC, Le Paslier D, Altherr MR, Dorman TE, Moir DT. A YAC contig spanning a cluster of human type III receptor protein tyrosine kinase genes (PDGFRA-KIT-KDR) in chromosome segment 4q12. Genomics. 1994;22:431-436. [Medline] [Order article via Infotrieve]

17. Rosnet O, Stephenson D, Mattei M-G, Marchetto S, Shibuya M, Chapman VM, Binbaum D. Close physical linkage of the FLT1 and FLT3 genes on chromosome 13 in man and chromosome 5 in mouse. Oncogene. 1993;8:173-179.[Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				D. H. Kim, W. Xu, S. Kamel-Reid, X. Liu, C. W. Jung, S. Kim, and J. H. Lipton Clinical relevance of vascular endothelial growth factor (VEGFA) and VEGF receptor (VEGFR2) gene polymorphism on the treatment outcome following imatinib therapy Ann. Onc., October 29, 2009; (2009) mdp452v1. [Abstract] [Full Text] [PDF]

				J. Dai and A.B.M. Rabie VEGF: an Essential Mediator of Both Angiogenesis and Endochondral Ossification Journal of Dental Research, October 1, 2007; 86(10): 937 - 950. [Abstract] [Full Text] [PDF]

				M. Buraczynska, P. Ksiazek, I. Baranowicz-Gaszczyk, and L. Jozwiak Association of the VEGF gene polymorphism with diabetic retinopathy in type 2 diabetes patients Nephrol. Dial. Transplant., November 22, 2006; (2006) gfl641v1. [Abstract] [Full Text] [PDF]

				A Eroglu, S Gulec, C Kurtman, R Cam, and N Akar Vascular endothelial growth factor 936 C/T polymorphism in cancer patients Ann. Onc., September 1, 2006; 17(9): 1467 - 1468. [Full Text] [PDF]

				A R L Medford and A B Millar Vascular endothelial growth factor (VEGF) in acute lung injury (ALI) and acute respiratory distress syndrome (ARDS): paradox or paradigm? Thorax, July 1, 2006; 61(7): 621 - 626. [Abstract] [Full Text] [PDF]

				N. Kataoka, Q. Cai, W. Wen, X.-O. Shu, F. Jin, Y.-T. Gao, and W. Zheng Population-Based Case-Control Study of VEGF Gene Polymorphisms and Breast Cancer Risk among Chinese Women. Cancer Epidemiol. Biomarkers Prev., June 1, 2006; 15(6): 1148 - 1152. [Abstract] [Full Text] [PDF]

				D. S. Faffe, L. Flynt, K. Bourgeois, R. A. Panettieri Jr., and S. A. Shore Interleukin-13 and Interleukin-4 Induce Vascular Endothelial Growth Factor Release from Airway Smooth Muscle Cells: Role of Vascular Endothelial Growth Factor Genotype Am. J. Respir. Cell Mol. Biol., February 1, 2006; 34(2): 213 - 218. [Abstract] [Full Text] [PDF]

				E. Zygalaki, A. Stathopoulou, C. Kroupis, L. Kaklamanis, Z. Kyriakides, D. Kremastinos, and E. S. Lianidou Real-Time Reverse Transcription-PCR Quantification of Vascular Endothelial Growth Factor Splice Variants Clin. Chem., August 1, 2005; 51(8): 1518 - 1520. [Full Text] [PDF]

				M. Bhanoori, K. Arvind Babu, N.G. Pavankumar Reddy, K. Lakshmi Rao, K. Zondervan, M. Deenadayal, S. Kennedy, and S. Shivaji The vascular endothelial growth factor (VEGF) +405G>C 5'-untranslated region polymorphism and increased risk of endometriosis in South Indian women: a case control study Hum. Reprod., July 1, 2005; 20(7): 1844 - 1849. [Abstract] [Full Text] [PDF]

				S. Lee, S. M. Jilani, G. V. Nikolova, D. Carpizo, and M. L. Iruela-Arispe Processing of VEGF-A by matrix metalloproteinases regulates bioavailability and vascular patterning in tumors J. Cell Biol., May 23, 2005; 169(4): 681 - 691. [Abstract] [Full Text] [PDF]

				S. J. Lee, S. Y. Lee, H.-S. Jeon, S. H. Park, J. S. Jang, G. Y. Lee, J. W. Son, C. H. Kim, W. K. Lee, S. Kam, et al. Vascular Endothelial Growth Factor Gene Polymorphisms and Risk of Primary Lung Cancer Cancer Epidemiol. Biomarkers Prev., March 1, 2005; 14(3): 571 - 575. [Abstract] [Full Text] [PDF]

				G. Pages and J. Pouyssegur Transcriptional regulation of the Vascular Endothelial Growth Factor gene-a concert of activating factors Cardiovasc Res, February 15, 2005; 65(3): 564 - 573. [Abstract] [Full Text] [PDF]

				N. Ferrara Vascular Endothelial Growth Factor: Basic Science and Clinical Progress Endocr. Rev., August 1, 2004; 25(4): 581 - 611. [Abstract] [Full Text] [PDF]

				L. Jensen, H. Pilegaard, P. D. Neufer, and Y. Hellsten Effect of acute exercise and exercise training on VEGF splice variants in human skeletal muscle Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2004; 287(2): R397 - R402. [Abstract] [Full Text] [PDF]

				D. Papazoglou, G. Galazios, M. I. Koukourakis, I. Panagopoulos, E. N. Kontomanolis, K. Papatheodorou, and E. Maltezos Vascular endothelial growth factor gene polymorphisms and pre-eclampsia Mol. Hum. Reprod., May 1, 2004; 10(5): 321 - 324. [Abstract] [Full Text] [PDF]

				D.C Felmeden, A.D Blann, and G.Y.H Lip Angiogenesis: basic pathophysiology and implications for disease Eur. Heart J., April 1, 2003; 24(7): 586 - 603. [Full Text] [PDF]

				A. Stevens, J. Soden, P. E. Brenchley, S. Ralph, and D. W. Ray Haplotype Analysis of the Polymorphic Human Vascular Endothelial Growth Factor Gene Promoter Cancer Res., February 15, 2003; 63(4): 812 - 816. [Abstract] [Full Text] [PDF]

				E S Bamberger and C W Perrett Angiogenesis in epithelian ovarian cancer Mol. Pathol., December 1, 2002; 55(6): 348 - 359. [Abstract] [Full Text] [PDF]

				M. Shahbazi, A. A. Fryer, V. Pravica, I. J. Brogan, H. M. Ramsay, I. V. Hutchinson, and P. N. Harden Vascular Endothelial Growth Factor Gene Polymorphisms Are Associated with Acute Renal Allograft Rejection J. Am. Soc. Nephrol., January 1, 2002; 13(1): 260 - 264. [Abstract] [Full Text] [PDF]

				K. R. S. Brown, K. M. England, K. L. Goss, J. M. Snyder, and M. J. Acarregui VEGF induces airway epithelial cell proliferation in human fetal lung in vitro Am J Physiol Lung Cell Mol Physiol, October 1, 2001; 281(4): L1001 - L1010. [Abstract] [Full Text] [PDF]

				F. J. Giles The Vascular Endothelial Growth Factor (VEGF) Signaling Pathway: A Therapeutic Target in Patients with Hematologic Malignancies Oncologist, October 1, 2001; 6(2008): 32 - 39. [Abstract] [Full Text] [PDF]

				C. Robinson and S. Stringer The splice variants of vascular endothelial growth factor (VEGF) and their receptors J. Cell Sci., January 3, 2001; 114(5): 853 - 865. [Abstract] [PDF]

				M. D. Mueller, J.-L. Vigne, A. Minchenko, D. I. Lebovic, D. C. Leitman, and R. N. Taylor Regulation of vascular endothelial growth factor (VEGF) gene transcription by estrogen receptors alpha and beta PNAS, September 19, 2000; (2000) 200377097. [Abstract] [Full Text]

				J. Gogusev, J.B. de Joliniere, L. Telvi, M. Doussau, S. du Manoir, A. Stojkoski, and M. Levardon Genetic abnormalities detected by comparative genomic hybridization in a human endometriosis-derived cell line Mol. Hum. Reprod., September 1, 2000; 6(9): 821 - 827. [Abstract] [Full Text] [PDF]

				A. Aguayo, S. O'Brien, M. Keating, T. Manshouri, C. Gidel, B. Barlogie, M. Beran, C. Koller, H. Kantarjian, and M. Albitar Clinical relevance of intracellular vascular endothelial growth factor levels in B-cell chronic lymphocytic leukemia Blood, July 15, 2000; 96(2): 768 - 770. [Abstract] [Full Text] [PDF]

				K. Tae, A. K. El-Naggar, E. Yoo, L. Feng, J. J. Lee, W. K. Hong, W. N. Hittelman, and D. M. Shin Expression of Vascular Endothelial Growth Factor and Microvessel Density in Head and Neck Tumorigenesis Clin. Cancer Res., July 1, 2000; 6(7): 2821 - 2828. [Abstract] [Full Text]

				A. Aguayo, E. Estey, H. Kantarjian, T. Mansouri, C. Gidel, M. Keating, F. Giles, Z. Estrov, B. Barlogie, and M. Albitar Cellular Vascular Endothelial Growth Factor Is a Predictor of Outcome in Patients With Acute Myeloid Leukemia Blood, December 1, 1999; 94(11): 3717 - 3721. [Abstract] [Full Text] [PDF]

				N. Ferrara and T. Davis-Smyth The Biology of Vascular Endothelial Growth Factor Endocr. Rev., February 1, 1997; 18(1): 4 - 25. [Abstract] [Full Text]

				M. D. Mueller, J.-L. Vigne, A. Minchenko, D. I. Lebovic, D. C. Leitman, and R. N. Taylor Regulation of vascular endothelial growth factor (VEGF) gene transcription by estrogen receptors alpha and beta PNAS, September 26, 2000; 97(20): 10972 - 10977. [Abstract] [Full Text] [PDF]

This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Vincenti, V. Articles by Persico, M. G. Search for Related Content PubMed PubMed Citation Articles by Vincenti, V. Articles by Persico, M. G.