This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Benson, D. W. Articles by Satler, C. A. Search for Related Content PubMed PubMed Citation Articles by Benson, D. W. Articles by Satler, C. A.

(Circulation. 1996;93:1791-1795.)
© 1996 American Heart Association, Inc.

Articles

Missense Mutation in the Pore Region of HERG Causes Familial Long QT Syndrome

D. Woodrow Benson, MD, PhD; Calum A. MacRae, MD; Mark R. Vesely, BS; Edward P. Walsh, MD; J.G. Seidman, PhD; Christine E. Seidman, MD; Carol Ann Satler, MD, PhD

From the Cardiovascular Division, Brigham and Women's Hospital, Boston, Mass (D.W.B., C.E.S.); the Department of Genetics, Howard Hughes Medical Institute, Boston, Mass (C.A.M., J.G.S.); and the Department of Cardiology, Children's Hospital, Boston, Mass (M.R.V., C.A.S.).

Correspondence to Carol Ann Satler, MD, PhD, Children's Hospital, Department of Cardiology, 300 Longwood Ave, Enders 13, Boston, MA 02115. E-mail satler@phenix.tch.harvard.edu.

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background Long QT syndrome (LQT) is an inherited cardiac disorder that results in syncope, seizures, and sudden death. In a family with LQT, we identified a novel mutation in human ether-a-go-go–related gene (HERG), a voltage-gated potassium channel.

Methods and Results We used DNA sequence analysis, restriction enzyme digestion analysis, and allele-specific oligonucleotide hybridization to identify the HERG mutation. A single nucleotide substitution of thymidine to guanine (T1961G) changed the coding sense of HERG from isoleucine to arginine (Ile593Arg) in the channel pore region. The mutation was present in all affected family members; the mutation was not present in unaffected family members or in 100 normal, unrelated individuals.

Conclusions We conclude that the Ile593Arg missense mutation in HERG is the cause of LQT in this family because it segregates with disease, its presence was confirmed in three ways, and it is not found in normal individuals. The Ile593Arg mutation may result in a change in potassium selectivity and permeability leading to a loss of HERG function, thereby resulting in LQT.

Key Words: tachycardia • syncope • genetics • torsade de pointes

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
As reported by Ward¹ and Romano et al,² the long QT syndrome (LQT) is an autosomal dominant disorder characterized by prolongation of the QT interval; affected individuals may experience symptoms of syncope, cardiac arrest, and sudden death. These symptoms are presumed to be due to the occurrence of polymorphic ventricular tachycardia, which has been termed torsade de pointes.³ The risk of sudden death and recurrence of syncope in affected individuals make LQT an important clinical problem.⁴

The inherited basis of LQT has been clearly established through genetic linkage analysis. Four LQT loci on chromosome 11p15.5 (LQT1), chromosome 7q35 (LQT2), chromosome 3p21 (LQT3), and chromosome 4q25-27 (LQT4) have been identified.^{5 6 7} Recently, LQT1 was shown to result from mutations in KVLQT1, a presumed voltage-gated potassium channel.⁸ LQT2 was shown to be due to mutations in human ether-a-go-go–related gene (HERG),⁹ a voltage-gated potassium channel with rectification properties implicating it as a component of I_kr.^{10 11} LQT3 was shown to be due to mutations in SCN5A, the cardiac sodium channel gene.¹²

This report describes a new missense HERG mutation in affected members of a family with autosomal dominant LQT. The location and character of the new mutation suggests that LQT in this family results from a change in potassium selectivity and permeability, thereby leading to a loss of function of this potassium channel.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Family Studies
Twenty-four members of Family LQTS003 were evaluated by history, physical examination, and ECG. After informed consent, a blood sample was obtained for genetic analysis. All studies were carried out in accordance with the guidelines of the Children's Hospital Committee on Clinical Investigation and the Brigham and Women's Hospital Human Subjects Committee. Affected individuals were defined as those with QT_c0.47 second in lead II or QT_c0.45 second in patients with syncope, documented torsade de pointes, or sudden death.⁵

Genomic DNA Isolation
DNA was isolated from peripheral blood lymphocytes with a Puregene kit or by red cell lysis, digestion with proteinase K, phenol-chloroform extraction, and ethanol precipitation.¹³

Amplification of HERG
On the basis of published intronic sequence,⁹ exons I and II were amplified with the use of polymerase chain reaction (PCR) with 100 ng of genomic DNA and 250 ng of each of the two priming nucleotides. Exon I was amplified with GACGTGCTGCCTGAGTACAAGCTGC (5F) and TACACCACCTGCCTCCTTGCTGA (9R). Exon II was amplified with TGCCCCATCAACGGAATGTGC (4L) and GCCCGCCCCTGGGCACACTCA (12R). Oligonucleotides 9R, 4L, and 12R were previously published.⁹ After incubation of the reaction for 2 to 5 minutes at 95°C, the reaction was run through 30 cycles of denaturation, annealing, and polymerization. Each cycle consisted of 20 seconds at 94°C, 40 seconds at 60°C, and 50 seconds at 72°C. Nucleotide sequence is given in 5'-3' orientation.

DNA Sequencing of PCR Products
After PCR amplification, cycle sequencing was accomplished with use of the Cyclist Taq DNA sequencing kit (Stratgene) and internal primers labeled with -³²P (specific activity, 3000 Ci/mmol). Sequencing was obtained directly from PCR products or gel-purified PCR products. In exon I, sequencing was performed using the primers CCGCCTGCTACCGAGTGTGGCTACG (6F) and CCACAATGAACATGATGTCCACG (10R) and in exon II using TCGGCAACATGGAGCAGCCACACATG (8F) and GGTTTGCCTATCTGGTCGCCCAGGT (8R).

Mnl I Enzyme Digest
PCR product was ethanol-precipitated, resuspended in enzyme digestion buffer, and incubated with Mnl I for 2 hours at 37°C. Digested PCR products were resolved by agarose gel electrophoresis.

Allele-Specific Oligonucleotide Hybridization
Allele-specific oligonucleotide (17 mers) probes were made to the region surrounding the mutation (nt 1953-1969). The oligonucleotide probes were CGACCAGAGAGGCAAAC (mutation) and CGACCAGATAGGCAAAC (wild type). PCR-amplified DNA was denatured and applied to nylon membrane using a slot blot apparatus. The probes were 5' end-labeled with -³²P (specific activity, 3000 Ci/mmol) and hybridized in sodium chloride/sodium citrate (0.9 mol/L/0.09 mol/L) at 37°C. After washing at 52°C, the blots were imaged on a Molecular Dynamics Phosphoimager, and the signals were analyzed quantitatively. This evaluation was performed in family members as well as 100 normal, unrelated individuals.

Linkage Analysis
Using the mutation as an allele, we performed linkage analysis with the assumption of disease penetrance of 100%. Lod scores were calculated with the use of MLINK.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Because LQT mutations have been identified in HERG,⁹ we screened this gene for defects in a large pedigree (LQTS003) with this disorder. Clinical features of LQT in this family include the absence of hearing loss, prolonged QT_c of 0.45 to 0.60 second (mean, 0.55 second) in eight affected individuals, and normal QT_c of 0.35 to 0.45 second (mean, 0.39 second) in 16 unaffected family members (Fig 1). A previously asymptomatic individual (II-6) died suddenly during sleep at age 24 years while on a ship at sea; there are no records to permit determination of this individual's phenotype. No other family members are believed to have died as a result of LQT, but six of eight affected members (II-3, III-1, III-2, III-3, III-4, and III-5) experienced syncope in adulthood.

View larger version (18K): [in this window] [in a new window]   Figure 1. Pedigree structure of family. Men are denoted by squares and women by circles. Clinical affection status is indicated: darkened symbols affected and clear symbols unaffected. The QTc for each individual is noted below the symbol.

DNA sequencing in six affected individuals identified a thymidine to guanine (T to G) substitution at position 1961 of the HERG cDNA (Fig 2); this substitution changes the sense of HERG coding sequence from isoleucine to arginine (Ile593Arg). The T to G substitution created a new Mnl I restriction enzyme site that allowed independent confirmation of the mutation by enzyme digest (not shown).

View larger version (146K): [in this window] [in a new window]   Figure 2. Detection of T to G substitution. Left, Results of cycle sequencing in one affected (A) and three unaffected (U) individuals. Sequence ladder on the right is from an unaffected individual. The T->G symbol indicates the site of the nucleotide substitution (mutation). Right, Slot blot analysis of the 24 members of Family LQTS003 using allele-specific oligonucleotides. Hybridization with the wild-type probe (top) and the mutant probe (bottom) identified eight affected individuals (III-1, III-2, III-3, III-4, III-5, II-2, II-3, and IV-1). Note that affected individuals have one wild-type (normal) and one mutant allele, whereas normal individuals have two wild-type alleles. Signal variation in hybridization is due to variation in DNA amounts and the homozygote (unaffected) vs heterozygote (affected) status. In every case, when the two blots are compared, the slot blot signal is greater for the wild-type probe for unaffected individuals and for the mutant probe for the affected individuals.

To determine the segregation of the Ile593Arg mutation in family LQTS003, DNA from all family members was analyzed with Mnl I digestion and an allele-specific oligonucleotide probe (Fig 2). DNA from all clinically affected but from none of the clinically unaffected family members carried the T to G substitution. The Ile593Arg mutation also was absent in 100 normal, unrelated individuals. The calculated lod score for coinheritance of the HERG Ile593Arg mutation and LQT in this family was 3.0 (=0), providing odds of 1000:1 that this HERG mutation is genetically linked to disease in Family LQTS003.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
We conclude that an Ile593Arg missense mutation in the potassium channel, HERG, causes LQT. This mutation segregates with clinical disease status in Family LQTS003; this has been independently confirmed by three techniques and is not found in unrelated, unaffected individuals. The T to G substitution predicts the substitution of an arginine for isoleucine in the extracellular loop near the presumed pore-forming region, between the S5 and S6 domains. The location and character of this new mutation suggests that LQT results from a change in the selectivity and permeability of this potassium channel. The wide range of QT_c and varied clinical course in affected individuals typify the puzzling aspects of phenotypic heterogeneity in this genetic disease.

The regulation of membrane permeability to potassium is a ubiquitous phenomenon, and many different classes of potassium channels have evolved to serve this function.¹⁴ The largest class are the potassium channel forming proteins characterized by having six transmembrane domains (S1-S6); this motif is shared by voltage-dependent sodium and calcium channels. There has been considerable interest in relating the protein structure to channel function. Analysis to date suggests that the S4 domain, which contains positively charged amino acids alternating with nonpolar amino acids, functions as the voltage sensor in voltage-dependent sodium, calcium, and potassium channels. Furthermore, the specific amino acids that line the pore as well as the entire linker between transmembrane domains S5 and S6 clearly confer specific rectification and ion conductance properties in this family of potassium channels.¹⁴ This has been studied extensively in several subfamilies, but little is known of such structure-function relationships for members of the ether-a-go-go (eag) subfamily.

The eag gene was originally identified on the basis of its leg shaking phenotype in Drosophila. Molecular studies have revealed that eag encodes a polypeptide with structural similarities to both voltage-gated ion channels and cyclic nucleotide–gated channels. The cDNA for HERG was obtained from a human hippocampus cDNA library.¹⁵ On the basis of sequence homology, especially in the N-terminus, pore region, and a potential cyclic nucleotide binding site, HERG is considered an eag counterpart. However, despite this homology with outwardly rectifying eag family members, when expressed in Xenopus oocytes, HERG functions as a potassium channel with inward rectifying properties.^{10 11} Furthermore, despite a segment homologous to a cyclic nucleotide binding domain, exposure to cyclic nucleotides had no significant effect on electrophysiological characteristics of HERG.¹⁰ These functional differences between eag family members may be important for consideration of how mutation of a residue that is not conserved in all family members might have a profound effect on function in a specific eag family member. For example, the isoleucine at HERG residue 593 is conserved in mouse, rat, and human eag but not in Drosophila eag or elk (eag-like potassium channel) cDNAs.^{15 16} Given that isoleucine is highly conserved in mammalian eag homologues with presumably similar function, we speculate that the isoleucine is a critical residue at position 593 for the function of HERG.

Although several HERG mutations have been described (Fig 3), the precise molecular mechanism by which the defects cause LQT has not been elucidated. Since a delay in cardiac repolarization, as manifest by prolongation of the QT interval, may be due to increased action potential duration, it has been hypothesized that mutations associated with LQT prolong the cardiac action potential. Bennett et al¹⁷ recently provided support for this hypothesis by demonstrating that mutant SCN5A channels show persistent inward sodium current during membrane depolarization. Sustained inward current provides an explanation for prolongation of the cardiac action potential. The way in which HERG might prolong action potential duration is more complicated, because potassium channels assemble as tetramers.¹⁸ Mutant HERG subunits may have a so-called dominant-negative effect if their assembly with normal subunits reduces function. Alternatively, some mutations may result in failure of HERG assembly, thereby affecting potassium channel stoichiometry; reduced channel number may also lead to reduced function. In either case, the pathophysiological basis for prolongation of repolarization may be loss of HERG function. As opposed to other mutations that may affect assembly of proteins in the sarcolemma, the Ile593Arg mutation reported here may modify inactivating characteristics or alter sarcolemmal potassium permeability by modifying pore function.

View larger version (20K): [in this window] [in a new window]   Figure 3. Hypothetical membrane folding model for human ether-a-go-go–related gene. The amino (NH3+) and carboxyl (COO-) termini and the six-membrane–spanning domains (S1-S6) are indicated. The relative locations of the mutations previously reported by Curran et al9 are illustrated. The mutation in the present report is shown by an arrow in the S5 to S6 linker (P region), which includes the pore. D indicates aspartic acid; G, glycine; N, asparagine; V, valine; A, alanine, I, isoleucine; R, arginine; and S, serine. *Amino acid deletion.

	Acknowledgments

 
These studies were supported in part by grants from the Walden W. and Jean Young Shaw Foundation (D.W.B.); Feinberg Cardiovascular Research Institute, Northwestern University, Chicago, Ill (D.W.B.); National Institutes of Health (HL-02786) (C.A.S.); Gustavus and Louise Pfeiffer Research Foundation (C.A.S.); Charles H. Hood Foundation (C.A.S.); Edward Mallinckrodt Jr Foundation (C.A.S.); Marquette Electronics (C.A.S.); Hewlett-Packard Co (C.A.S.); and Howard Hughes Medical Institute (C.A.M., J.G.S., C.E.S.). C.A.M. is a Wellcome Trust (UK) Research Training Fellow. We are in-debted to the members of LQTS003 for their participation and to Christine Dindy and Priya Duggal for technical assistance.

Received February 5, 1996; revision received February 27, 1996; accepted March 13, 1996.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Ward OC. A new familial cardiac syndrome in children. J Irish Med Assoc. 1964;54:103-106. [Medline] [Order article via Infotrieve]

2. Romano C, Gemme G, Pongiglione R. Artimie cardiache rare dell'eta pediatrica. Clin Pediatr. 1963;45:658-683.

3. Roden DM. Torsade de pointes. Clin Cardiol. 1993;16:683-686. [Medline] [Order article via Infotrieve]

4. Moss AJ, Schwartz PJ, Crampton RS, Tzivoni D, Locati EH, MacCluer J, Hall WJ, Weitkamp L, Vincent GM, Garson A Jr, Robinson JL, Benhorin J, Choi S. The long QT syndrome: prospective longitudinal study of 328 families. Circulation. 1991;84:1136-1144. [Abstract/Free Full Text]

5. Keating M, Atkinson D, Dunn C, Timothy K, Vincent GM, Leppert M. Linkage of a cardiac arrhythmia, the long QT syndrome and the Harvey ras-1 gene. Science. 1991;252:704-706. [Abstract/Free Full Text]

6. Jiang C, Atkinson D, Towbin JA, Splawski I, Lehman MH, Li H, Timothy K, Taggart RT, Schwartz PJ, Vincent GM, Moss AJ, Keating MT. Two long QT syndrome loci map to chromosomes 3 and 7 with evidence for further heterogeneity. Nat Genet. 1994;8:141-147. [Medline] [Order article via Infotrieve]

7. Schott J-J, Charpentier F, Peltier S, Foley P, Drouin E, Bouhour J-B, Donnelly P, Vergnaud G, Bachner L, Moisan J-P, Le Marec H, Pascal O. Mapping of a gene for long QT syndrome to chromosome 4q25-27. Am J Hum Genet. 1995;57:1114-1122. [Medline] [Order article via Infotrieve]

8. Wang Q, Curran ME, Splawski I, Burn TC, Millholland JM, VanRaay TJ, Shen J, Timothy KW, Vincent GM, de Jager T, Schwartz PJ, Towbin JA, Moss AJ, Atkinson DL, Landes GM, Connors TD, Keating MT. Positional cloning of a novel potassium channel gene: KVLQT1 mutations cause cardiac arrhythmias. Nat Genet. 1996;12:17-23. [Medline] [Order article via Infotrieve]

9. Curran ME, Splawski I, Timothy KW, Vincent GM, Green ED, Keating MT. A molecular basis for cardiac arrhythmia: HERG mutations cause long QT syndrome. Cell. 1995;80:795-803. [Medline] [Order article via Infotrieve]

10. Sanguinetti MC, Jiang C, Curran ME, Keating MT. A mechanistic link between an inherited and an acquired cardiac arrhythmia: HERG encodes the I_Kr potassium channel. Cell. 1995;81:299-307. [Medline] [Order article via Infotrieve]

11. Trudeau MC, Warmke JW, Ganetzky B, Robertson GA. HERG, a human inward rectifier in the voltage-gated potassium channel family. Science.. 1995;269:92-95.[Abstract/Free Full Text]

12. Wang Q, Shen J, Splawski I, Atkinson D, Li Z, Robinson JL, Moss AJ, Towbin JA, Keating MT. SCN5A mutations associated with an inherited cardiac arrhythmia, long QT syndrome. Cell. 1995;80:805-811. [Medline] [Order article via Infotrieve]

13. Tanigawa G, Jarcho JA, Kass S, Solomon SD, Vosberg H-P, Seidman JG, Seidman CE. A molecular basis for familial hypertrophic cardiomyopathy: an /ß cardiac myosin heavy chain hybrid gene. Cell. 1990;62:991-998. [Medline] [Order article via Infotrieve]

14. Kukuljan M, Labarca P, Latorre R. Molecular determinants of ion conduction and inactivation in K⁺ channels. Am J Physiol. 1995;268:C535-C556. [Abstract/Free Full Text]

15. Warmke JW, Ganetzky B. A family of potassium channel genes related to eag in Drosophila and mammals. Proc Natl Acad Sci U S A. 1994;91:3438-3442. [Abstract/Free Full Text]

16. Ludwig J, Terlau H, Wunder F, Bruggeman A, Pardo LA, Marquardt A, Stuhmer W, Pongs O. Functional expression of a rat homologue of the voltage gated ether á go-go potassium channel reveals differences in selectivity and activation kinetics between the Drosophila channel and its mammalian counterpart. EMBO J. 1994;13:4451-4458. [Medline] [Order article via Infotrieve]

17. Bennett PB, Yazawa K, Makita N, George AL Jr. Molecular mechanism for an inherited cardiac arrhythmia. Nature. 1995;376:683-685. [Medline] [Order article via Infotrieve]

18. MacKinnon R. Determination of the subunit stoichiometry of a voltage-activated potassium channel. Nature. 1991;350:232-235.[Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				S. G. Priori, R. Bloise, and L. Crotti The long QT syndrome Europace, January 1, 2001; 3(1): 16 - 27. [PDF]

				C.-C. Shieh, M. Coghlan, J. P. Sullivan, and M. Gopalakrishnan Potassium Channels: Molecular Defects, Diseases, and Therapeutic Opportunities Pharmacol. Rev., December 1, 2000; 52(4): 557 - 594. [Abstract] [Full Text] [PDF]

				C. Y. Ho, H. M. Lever, R. DeSanctis, C. F. Farver, J. G. Seidman, and C. E. Seidman Homozygous Mutation in Cardiac Troponin T : Implications for Hypertrophic Cardiomyopathy Circulation, October 17, 2000; 102(16): 1950 - 1955. [Abstract] [Full Text] [PDF]

				I. Splawski, J. Shen, K. W. Timothy, M. H. Lehmann, S. Priori, J. L. Robinson, A. J. Moss, P. J. Schwartz, J. A. Towbin, G. M. Vincent, et al. Spectrum of Mutations in Long-QT Syndrome Genes : KVLQT1, HERG, SCN5A, KCNE1, and KCNE2 Circulation, September 5, 2000; 102(10): 1178 - 1185. [Abstract] [Full Text] [PDF]

				C.-E. Chiang and D. M. Roden The long QT syndromes: genetic basis and clinical implications J. Am. Coll. Cardiol., July 1, 2000; 36(1): 1 - 12. [Abstract] [Full Text] [PDF]

				T. Nakajima, T. Furukawa, Y. Hirano, T. Tanaka, H. Sakurada, T. Takahashi, R. Nagai, T. Itoh, Y. Katayama, Y. Nakamura, et al. Voltage-shift of the current activation in HERG S4 mutation (R534C) in LQT2 Cardiovasc Res, November 1, 1999; 44(2): 283 - 293. [Abstract] [Full Text] [PDF]

				F. Lehmann-Horn and K. Jurkat-Rott Voltage-Gated Ion Channels and Hereditary Disease Physiol Rev, October 1, 1999; 79(4): 1317 - 1372. [Abstract] [Full Text] [PDF]

				J. Chen, A. Zou, I. Splawski, M. T. Keating, and M. C. Sanguinetti Long QT Syndrome-associated Mutations in the Per-Arnt-Sim (PAS) Domain of HERG Potassium Channels Accelerate Channel Deactivation J. Biol. Chem., April 9, 1999; 274(15): 10113 - 10118. [Abstract] [Full Text] [PDF]

				C. T. Basson, T. Huang, R. C. Lin, D. R. Bachinsky, S. Weremowicz, A. Vaglio, R. Bruzzone, R. Quadrelli, M. Lerone, G. Romeo, et al. Different TBX5 interactions in heart and limb defined by Holt-Oram syndrome mutations PNAS, March 16, 1999; 96(6): 2919 - 2924. [Abstract] [Full Text] [PDF]

				K. Petrecca, R. Atanasiu, A. Akhavan, and A. Shrier N-linked glycosylation sites determine HERG channel surface membrane expression J. Physiol., February 15, 1999; 515(1): 41 - 48. [Abstract] [Full Text] [PDF]

				H. J. Granger Cardiovascular physiology in the twentieth century: great strides and missed opportunities Am J Physiol Heart Circ Physiol, December 1, 1998; 275(6): H1925 - H1936. [Abstract] [Full Text] [PDF]

				P. Babij, G. R. Askew, B. Nieuwenhuijsen, C.-M. Su, T. R. Bridal, B. Jow, T. M. Argentieri, J. Kulik, L. J. DeGennaro, W. Spinelli, et al. Inhibition of Cardiac Delayed Rectifier K+ Current by Overexpression of the Long-QT Syndrome HERG G628S Mutation in Transgenic Mice Circ. Res., September 21, 1998; 83(6): 668 - 678. [Abstract] [Full Text] [PDF]

				T. Nakajima, T. Furukawa, T. Tanaka, Y. Katayama, R. Nagai, Y. Nakamura, and M. Hiraoka Novel Mechanism of HERG Current Suppression in LQT2 : Shift in Voltage Dependence of HERG Inactivation Circ. Res., August 24, 1998; 83(4): 415 - 422. [Abstract] [Full Text] [PDF]

				Z. Zhou, Q. Gong, M. L. Epstein, and C. T. January HERG Channel Dysfunction in Human Long QT Syndrome. INTRACELLULAR TRANSPORT AND FUNCTIONAL DEFECTS J. Biol. Chem., August 14, 1998; 273(33): 21061 - 21066. [Abstract] [Full Text] [PDF]

				H. Niimura, L. L. Bachinski, S. Sangwatanaroj, H. Watkins, A. E. Chudley, W. McKenna, A. Kristinsson, R. Roberts, M. Sole, B. J. Maron, et al. Mutations in the Gene for Cardiac Myosin-Binding Protein C and Late-Onset Familial Hypertrophic Cardiomyopathy N. Engl. J. Med., April 30, 1998; 338(18): 1248 - 1257. [Abstract] [Full Text] [PDF]

				B. London, M. C. Trudeau, K. P. Newton, A. K. Beyer, N. G. Copeland, D. J. Gilbert, N. A. J enkins, C. A. Satler, and G. A. Robertson Two Isoforms of the Mouse Ether-a-go-go–Related Gene Coassemble to Form Channels With Properties Similar to the Rapidly Activating Component of the Cardiac Delayed Rectifier K+ Current Circ. Res., November 19, 1997; 81(5): 870 - 878. [Abstract] [Full Text]

				T. Tanaka, R. Nagai, H. Tomoike, S. Takata, K. Yano, K. Yabuta, N. Haneda, O. Nakano, A. Shibata, T. Sawayama, et al. Four Novel KVLQT1 and Four Novel HERG Mutations in Familial Long-QT Syndrome Circulation, February 4, 1997; 95(3): 565 - 567. [Abstract] [Full Text]

				D. M. Roden, R. Lazzara, M. Rosen, P. J. Schwartz, J. Towbin, and G. M. Vincent Multiple Mechanisms in the Long-QT Syndrome: Current Knowledge, Gaps, and Future Directions Circulation, October 15, 1996; 94(8): 1996 - 2012. [Abstract] [Full Text]

This Article Abstract Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Benson, D. W. Articles by Satler, C. A. Search for Related Content PubMed PubMed Citation Articles by Benson, D. W. Articles by Satler, C. A.