Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 1995;92:2385-2390

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Calderone, A.
Right arrow Articles by Colucci, W. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Calderone, A.
Right arrow Articles by Colucci, W. S.

(Circulation. 1995;92:2385-2390.)
© 1995 American Heart Association, Inc.


Articles

Pressure- and Volume-Induced Left Ventricular Hypertrophies Are Associated With Distinct Myocyte Phenotypes and Differential Induction of Peptide Growth Factor mRNAs

Angelino Calderone, PhD; Nobuyuki Takahashi, MD; Nicholas J. Izzo Jr, PhD; Cynthia M. Thaik, MD; Wilson S. Colucci, MD

From the Cardiomyopathy Center and Cardiovascular Division, Departments of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, Mass.

Correspondence to Dr Wilson S. Colucci, Cardiomyopathy Center and Cardiovascular Division, Boston University Medical Center, 88 E Newton St, Boston, MA 02118.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background Chronic pressure and volume overload (PO and VO) result in morphologically and functionally distinct forms of myocardial hypertrophy. We tested the hypothesis that PO- and VO-induced left ventricular (LV) hypertrophies are associated with distinct molecular phenotypes and patterns of peptide growth factor induction.

Methods and Results mRNA levels were quantified in LV myocardium from rats with LV hypertrophy due to PO or VO caused by suprarenal aortic constriction or an abdominal aortocaval fistula, respectively, for 1 week. Although PO and VO caused comparable increases in LV weight and prepro–atrial natriuretic factor mRNA, PO but not VO increased mRNA levels for the fetal genes ß-myosin heavy chain and skeletal {alpha}-actin and reduced the mRNA level of sarcoplasmic reticulum Ca2+ATPase. In a myocyte-enriched myocardial fraction, transforming growth factor-ß3 and insulin-like growth factor-1 mRNA levels were increased with PO but not VO; acidic fibroblast growth factor mRNA was unchanged with PO but decreased with VO. In a nonmyocyte-enriched myocardial fraction, transforming growth factor-ß3 and insulin-like growth factor-1 mRNA levels were decreased with VO but unchanged with PO.

Conclusions PO- and VO-induced LV hypertrophies are associated with distinct molecular phenotypes and patterns of peptide growth factor induction. Stimulus-specific heterogeneity in the signaling events and peptide growth factors coupled to gene expression could play a role in determining the type of hypertrophy that is caused by various forms of hemodynamic overload.


Key Words: hypertrophy • myocardium • genes • RNA • growth substances


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Chronic PO and VO result in morphologically distinct forms of myocardial hypertrophy.1 2 PO (eg, secondary to aortic constriction) results in "concentric" hypertrophy, which is characterized by an increase in ventricular wall thickness, little or no chamber dilation, and the parallel addition of sarcomeres.3 4 VO (eg, secondary to arteriovenous shunting) results in "eccentric" hypertrophy, which is characterized by relatively little increase in wall thickness, a disproportionately large increase in chamber volume, and the serial addition of sarcomeres.5 6 Cooper and colleagues7 8 9 10 further suggested that the morphological differences in these forms of hypertrophy have functional correlates.

The molecular basis for the structural and functional differences between pressure- and volume-overloaded myocardium is not known. However, it has been shown that PO hypertrophy is associated with the reexpression of a fetal gene program characterized by induction of prepro-ANF, skeletal {alpha}-actin, smooth muscle {alpha}-actin, and ß-MHC.11 12 13 14 Likewise, in PO hypertrophy, several15 16 17 but not all18 studies have shown a reciprocal decrease in the expression of mRNA for SERCA2. By comparison, relatively little is known about the molecular changes associated with VO hypertrophy. In ventricular myocardium from rats with VO due to an arteriovenous fistula, there was reexpression of prepro-ANF19 and increased levels of the V3 myosin isoform,20 suggesting that VO hypertrophy may also be associated with the induction of a fetal gene program. However, the myocardial expression of mRNAs for skeletal {alpha}-actin, ß-MHC, and SERCA2 has not been characterized in VO hypertrophy.

In vitro, several peptide growth factors cause myocyte hypertrophy and the induction of fetal genes,21 and stimuli that induce myocyte hypertrophy (eg, {alpha}1-adrenergic agonists, angiotensin, and mechanical stretch) have been shown to induce peptide growth factor mRNA expression in myocardial cells,22 23 24 suggesting that peptide growth factors might play an autocrine/paracrine role in mediating myocardial hypertrophy.

To determine whether PO- and VO-induced myocardial hypertrophies are associated with distinct molecular and cellular events, we tested two hypotheses. The first hypothesis was that PO- and VO-induced hypertrophies are associated with distinct molecular phenotypes. To test this hypothesis, the mRNA levels for prepro-ANF, skeletal {alpha}-actin, ß-MHC, and SERCA2 were quantified in LV myocardium from rats with matched degrees of LV hypertrophy due to PO or VO that was caused by suprarenal aortic constriction or an abdominal aortocaval fistula, respectively. The second hypothesis was that PO- and VO-induced hypertrophies are associated with different patterns of peptide growth factor expression. To test this hypothesis, the mRNA levels of TGF-ß1, TGF-ß3, IGF-1, and aFGF were determined in myocyte- and nonmyocyte-enriched fractions obtained from enzyme-dissociated hearts with PO- and VO-induced hypertrophies.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Animal Models
Male Sprague-Dawley rats weighing 200 to 250 g were obtained from Charles River. An arteriovenous fistula was established between the abdominal aorta and the inferior vena cava with an 18-gauge needle as described by Garcia and Diebold.25 Sham-operated animals served as controls and were subjected to the same surgical procedure with the exception of a puncture. Aortic constriction was created as described by Morkin and Ashford.26 Sham-operated animals served as controls, were subjected to the same surgical procedure, and had placement of a loosely tied ligature at the same location. Animals were killed 3 and 7 days after the procedure.

Myocyte and Nonmyocyte Cell Fractions
Myocyte- and nonmyocyte-enriched fractions of adult ventricular myocardium were isolated by a modification of the technique of Claycomb and Palazzo,27 as described in detail previously.22 The myocyte- and nonmyocyte-enriched fractions were resuspended in denaturing solution for mRNA preparation (see below).

Northern Hybridization
The rats were anesthetized with ether, and the heart was rapidly excised and separated into the right and left ventricles (including septum) and atria. mRNA was isolated by a modification of the technique of Chomczynski and Sacchi,28 as previously described.29

Full-length cDNAs for rat prepro-ANF (courtesy of Dr Christine Seidman), rabbit SERCA2 (courtesy of Dr Jonathan Lytton), rat TGF-ß1 and mouse TGF-ß3 (courtesy of Dr Micheal Sporn), a 0.5-kb fragment of rat IGF-1 (courtesy of Dr Graeme Bell), a 0.47-kb fragment of human aFGF (courtesy of Dr Judith Abraham), and a 136-bp ECO121 fragment of human skeletal {alpha}-actin 3'-untranslated region pHM{alpha}A-3'UT-TNU (courtesy of Dr James L. Lessard) were labeled with 32P-dCTP (Dupont) to a specific activity of 1x106 to 2x106 cpm/ng cDNA by the random hexamer priming method and hybridized to nylon blots for 18 to 24 hours at 42°C, as previously described.30 Blots hybridized with prepro-ANF, SERCA2, TGF-ß1, TGF-ß3, and IGF-1 cDNAs were washed twice (15 minutes, room temperature) with 300 mmol/L NaCl/30 mmol/L trisodium citrate (pH 7.0) and 0.1% SDS and twice (15 minutes, 60°C) with 30 mmol/L NaCl/3 mmol/L trisodium citrate (pH 7.0) and 0.1% SDS. Blots hybridized with aFGF and skeletal {alpha}-actin cDNA were washed twice (15 minutes, room temperature) with 300 mmol/L NaCl/30 mmol/L trisodium citrate (pH 7.0) and 0.1% SDS and twice (10 minutes, 42°C) with 75 mmol/L NaCl/7.5 mmol/L trisodium citrate (pH 7.0) and 0.1% SDS.

A synthetic oligonucleotide probe 20 bases in length was constructed complementary to the 3' untranslated region of the rat ß-MHC mRNA (GGTCTCAGGGCTTCACAGGC).31 The probe was labeled with 32P-ATP (Dupont) at the 5' end to a specific activity of 2x107 cpm/µg by use of T4 polynucleotide kinase. Blots hybridized for skeletal {alpha}-actin and ß-MHC were washed twice (15 minutes, room temperature) with 700 mmol/L NaCl/30 mmol/L trisodium citrate (pH 7.0) and 0.1% SDS and twice (10 minutes, 42°C) with 700 mmol/L NaCl/30 mmol/L trisodium citrate (pH 7.0) and 0.1% SDS.

Blots were exposed to Kodak XAR film with an intensifying screen at -70°C, and films were scanned with a laser densitometer (Ultrascan 2202, LKB). The sizes of the hybridized messages were estimated with the 18S and 28S ribosomal RNA bands as standards. All blots were reprobed with a 32P-labeled oligonucleotide complementary to 18S rRNA as previously described,30 washed, and autoradiographed. All levels of mRNA reported in this article are normalized to the level of 18S rRNA to correct for potential differences in the amount of RNA loaded and/or transferred.

Statistical Methods
Data are presented as the mean±SEM. Statistical analysis was performed by Student's unpaired t tests (two-tailed), and a value of P<.05 was considered significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
LV Hypertrophy in PO and VO Rats
After aortic banding (PO rats), the LV–to–body weight ratio (mg/g) increased by 15±3% and 33±4% at 3 and 7 days, respectively, relative to sham-operated controls (P<.02 for each, n=5 to 7 for each) (Fig 1ADown). Likewise, after creation of the arteriovenous fistula (VO rats), the LV–to–body weight ratio increased by 16±2% and 34±3% at 3 and 7 days, respectively, relative to sham-operated controls (P<.01 for each, n=6 to 8 for each) (Fig 1ADown). Thus, the degrees of LV hypertrophy at both 3 and 7 days were comparable in the two models. Body, heart, and LV weights for PO, VO, and sham-operated rats are shown in the TableDown.




View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. Bar graphs showing effects of VO (aortocaval fistula, open bars) and PO (aortic constriction, solid bars) on the LV–to–body weight (LV/BW) ratio (A) and mRNA levels for prepro-ANF (B), skeletal {alpha}-actin (C), ß-MHC (D), and SERCA2 (E). All mRNA levels are normalized to the level of 18S rRNA as determined by hybridization with an oligonucleotide probe. Changes in mRNA levels for PO and VO are presented relative to the levels in sham-operated animals (dashed lines). The data depicted reflect six to eight animals in each group for VO and five animals in each group for PO (*P<.05 vs sham; +P<.005 vs VO).


View this table:
[in this window]
[in a new window]
 
Table 1. Morphological Changes Caused by VO and PO for 7 Days

Induction of Prepro-ANF mRNA
In PO rats, prepro-ANF mRNA was increased 4.2±1.0-fold (P<.01 versus sham; n=5) and 8.6±1.2-fold (P<.01 versus sham; n=5) at 3 and 7 days, respectively (Figs 1BUp and 2ADown). In VO rats, the level of prepro-ANF mRNA was increased 2.3±0.4-fold (P<.01 versus sham; n=6) at 3 days and 8.1±1.2-fold (P<.001 versus sham; n=6) at 7 days (Figs 1BUp and 2ADown). The increases in prepro-ANF mRNA levels were not different between the two models at 3 or 7 days. Furthermore, the fold increase in LV prepro-ANF mRNA correlated with the increase in LV–to–body weight ratio for each model separately (PO, r=.68, P=.03, n=10; VO, r=.56, P=.046, n=12) and for the two models combined (r=.61, P=.002, n=22).



View larger version (10K):
[in this window]
[in a new window]
 
Figure 2. Autoradiographs from representative Northern hybridizations of mRNA from LV myocardium of rats exposed to VO or PO. Animals were exposed to VO (aortocaval fistula), PO (aortic constriction), or the appropriate sham operation for 7 days (A and C) or 3 days (B). A, Skeletal {alpha}-actin, prepro-ANF, and 18S rRNA (18S). B, ß-MHC and 18S rRNA. C, SERCA2 and 18S rRNA.

Skeletal {alpha}-Actin mRNA
In PO rats, LV skeletal {alpha}-actin mRNA was increased 2.9±0.5-fold and 4.6±1.2-fold at 3 and 7 days, respectively (Figs 1CUp and 2AUp). In VO rats, there was no change in the level of skeletal {alpha}-actin mRNA at 3 or 7 days, and the increases with PO (versus VO) were significantly greater at both 3 and 7 days (Figs 1CUp and 2AUp).

ß-MHC mRNA
In PO rats, LV ß-MHC mRNA was increased by 2.6±0.4-fold and 6.5±2.9-fold at 3 and 7 days, respectively (Figs 1DUp and 2BUp). In VO rats, there was no change in the level of ß-MHC mRNA at 3 or 7 days. The increase with PO (versus VO) was significantly greater at 3 but not at 7 days (Figs 1DUp and 2BUp).

SERCA2 mRNA
In PO rats, the level of LV SERCA2 mRNA decreased by 31±15% and 31±2% at 3 and 7 days, respectively (Figs 1EUp and 2CUp). The decrease was significant at 7 days (sham, 0.97±0.04-fold; PO, 0.69±0.02-fold; P=.001; n=5) but not at 3 days. In VO rats, the level of SERCA2 mRNA was unchanged at 3 or 7 days (Figs 1EUp and 2CUp).

Distribution of Peptide Growth Factor mRNA Expression in Adult Rat Myocardium
Dissociation of the normal adult rat heart into myocyte- and nonmyocyte-enriched fractions revealed a heterogeneous distribution of peptide growth factor mRNAs. The preponderance of aFGF mRNA was detected in the myocyte fraction, whereas the preponderance of TGF-ß1, TGF-ß3, and IGF-1 mRNAs was detected in the nonmyocyte-enriched fractions (Fig 3Down).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. Bar graph showing relative levels of mRNA for TGF-ß1, TGF-ß3, IGF-1, and aFGF in myocyte-enriched (MYO) and nonmyocyte-enriched (NONMYO) fractions from adult rat hearts. All mRNA levels are normalized to the level of 18S rRNA as determined by hybridization with an oligonucleotide probe. For each growth factor, the levels are normalized to the fraction with the lower level of expression. Bars represent the means of observations in five to seven animals in each group (*P<.05 MYO vs NONMYO).

Myocardial Peptide Growth Factor mRNA Expression With PO
One week after abdominal aortic constriction, TGF-ß1 mRNA levels were increased (3.3±0.39-fold; P=.001; n=5) in the myocyte-enriched fraction but were unchanged (1.03±0.17-fold; P=.94; n=5) in the nonmyocyte-enriched fraction compared with sham. In rats with abdominal aortic constriction, TGF-ß3 (1.8±0.11-fold; P=.001; n=5) and IGF-1 (2.3±0.2-fold; P=.001; n=3) mRNA levels were also increased in the myocyte-enriched fraction but unchanged in the nonmyocyte-enriched fraction (Figs 4Down and 5Down). By contrast, aFGF mRNA levels were unchanged in the myocyte or nonmyocyte fractions from PO hearts (Figs 4Down and 5Down).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. Autoradiographs from representative Northern hybridizations of mRNA for TGF-ß1, TGF-ß3, IGF-1, and aFGF and 18S rRNA (18S) in myocyte- and nonmyocyte-enriched fractions obtained from the LV myocardium of rats exposed to VO (A) or PO (B) overload for 7 days. The data for the effect of PO on TGF-ß1 have been published previously.22




View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. Bar graphs showing changes in the levels of mRNA for TGF-ß1 (A), TGF-ß3 (B), IGF-1 (C), and aFGF (D) in myocyte- and nonmyocyte-enriched fractions obtained from the LV myocardium of rats exposed to VO (open bars) or PO (solid bars) for 7 days. Changes in mRNA levels for PO and VO are presented relative to the levels in sham-operated animals (dashed lines). All mRNA levels are normalized to the level of 18S rRNA as determined by hybridization with an oligonucleotide probe. The data depicted reflect six animals in each group for VO and five animals in each group for PO (*P<.05 vs sham; +P<.005 vs VO).

Myocardial Peptide Growth Factor mRNA Expression With VO
One week after the creation of an arteriovenous fistula, TGF-ß1 mRNA levels were increased (2.8±0.2-fold; P=.001; n=6) in the myocyte-enriched fraction but unchanged in the nonmyocyte-enriched fraction. Neither TGF-ß3 nor IGF-1 mRNA levels were induced in the myocyte fraction of the VO hearts. However, TGF-ß3 and IGF-1 mRNA levels were decreased by 45±11% (P=.001; n=4) and 39±7% (P=.001; n=4), respectively, in the nonmyocyte-enriched fractions from volume-overloaded hearts. aFGF mRNA levels were decreased by 32±7% (P=.001; n=6) in the myocyte fraction and unchanged in the nonmyocyte fraction from VO hearts (Figs 4Up and 5Up).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
A major new finding of this study is that the patterns of LV myocardial gene expression were different in rats with PO- and VO-induced hypertrophies. As previously observed by several groups,11 12 13 14 15 16 17 18 PO was associated with induction of fetal isoforms of actin and myosin mRNA (skeletal {alpha}-actin and ß-MHC) and downregulation of SERCA2 mRNA in LV myocardium. In contrast, the steady-state levels of skeletal {alpha}-actin, ß-MHC, and SERCA2 mRNA were not altered in VO rats. Thus, PO- and VO-induced myocardial hypertrophies are associated with distinct molecular phenotypes.

In contrast to the levels of skeletal {alpha}-actin, ß-MHC, and SERCA2 mRNA, the levels of prepro-ANF mRNA did not distinguish between the two forms of hemodynamic stimulus. Furthermore, when examined at 3 and 7 days, the level of LV prepro-ANF mRNA correlated with the extent of LV hypertrophy for both PO and VO. Thus, prepro-ANF mRNA appears to be a relatively quantitative marker for the degree of LV hypertrophy with both PO and VO. These findings suggest that whereas the induction of prepro-ANF is a relatively conserved molecular event in the hypertrophic process, the modulation of ß-MHC, skeletal {alpha}-actin, and SERCA2 mRNA levels by PO (but not VO) may reflect mechanisms that are less conserved and perhaps more stimulus specific.

Prepro-ANF, ß-MHC, and skeletal {alpha}-actin are generally viewed as components of a fetal gene program. However, our data suggest that, at least at the mRNA level, these genes can be regulated independently in response to different hypertrophic stimuli. In support of this concept, aFGF has been shown to cause directionally opposite changes in prepro-ANF and skeletal {alpha}-actin mRNA levels in cultured neonatal rat myocytes.32 Likewise, there is spatial and temporal dissociation of the accumulation of ß-MHC and skeletal {alpha}-actin mRNAs in the hypertrophied LV of the rat after aortic banding.11

Although aortic constriction has been widely used to study the molecular and cellular consequences of myocardial hypertrophy, relatively little comparable information is available for VO-induced LV hypertrophy, in part reflecting the difficulty of surgically creating VO in small animals. The recent description by Garcia and Diebold25 of a simple and reproducible method to create VO in the rat by use of a needle facilitated our study. This model was used by Ruzicka, Leenen, and colleagues33 34 35 36 to study the role of the renin-angiotensin system in the development and maintenance of LV hypertrophy. These investigators showed that with this technique, at 1 week there is eccentric LV hypertrophy with an {approx}25% increase in LV weight, an increase in LV internal diameter, and a decrease in the ratio of LV wall thickness to radius.33

We did not measure hemodynamics in the present study. However, the degree of LV hypertrophy observed at 1 week agrees well with that reported by others for both VO33 and PO.26 Furthermore, by design, we selected conditions that resulted in similar degrees of LV hypertrophy for the two models. In animals with PO, LV and arterial systolic pressures are elevated,37 whereas in animals with VO, LV and arterial systolic pressures are reduced and the LV end-diastolic pressure is elevated.33 Thus, in this study, it is likely that the hemodynamic loads placed on the LV in PO and VO animals differed in important qualitative ways.

The present study reflects the early phase of myocardial hypertrophy. Since there may be temporal differences in the activation of signaling pathways (eg, renin-angiotensin) that are involved in myocardial remodeling,38 the present results may not be representative of later events. In this regard, it is noteworthy that Mercadier et al20 found that the level of the V3 myosin isoenzyme was increased in 3 of 16 rats late (12 weeks) after establishment of VO. The increased V3 isoenzyme in these animals may reflect the more chronic nature of their VO and possibly the development of heart failure.18

The second major finding of this study is that PO and VO have different effects on the expression of mRNAs for at least three peptide growth factors in the myocardium. In the myocardial fraction enriched with myocytes, TGF-ß3 and IGF-1 mRNA levels were increased in PO (versus sham-operated animals) but not VO rats, and aFGF mRNA was unchanged in PO rats but decreased in VO rats. In the myocardial fraction enriched with nonmyocytes, the TGF-ß3 and IGF-1 mRNA levels were unchanged in PO but decreased in VO rats, whereas TGF-ß1 and aFGF mRNA levels were unchanged by PO or VO.

Peptide growth factors can cause many of the effects that are associated with myocardial hypertrophy, including myocyte hypertrophy, interstitial fibrosis, and increased fetal gene expression.21 39 Furthermore, there is evidence that some peptide growth factors, including TGF-ß1 and IGF-1, are induced in cultured myocytes in response to hypertrophic stimuli22 23 24 or in myocardium in response to mechanical or hormonal stimulation.22 40 The mechanism(s) responsible for the distinct patterns of peptide growth factor mRNA expression in both the myocyte and nonmyocyte fractions in these models of hypertrophy remains to be defined but may in part reflect differences in the inherent nature of the initiating hemodynamic load (pressure versus volume) and/or the neurohormonal milieu. In this regard, it is of interest that endothelin-1, which can stimulate peptide growth factor expression in cardiac myocytes (N. Takahashi and W. Colucci, unpublished data), is induced in the myocardium of rats with PO- but not VO-induced hypertrophy.41

In summary, PO- and VO-induced LV hypertrophies are associated with distinct myocyte phenotypes. Furthermore, these differences in myocyte gene expression are associated with distinct patterns of peptide growth factor regulation in both myocytes and nonmyocytes. Although the relation between peptide growth factors and gene expression in these models remains to be demonstrated, these observations raise the possibility that the distinct myocyte phenotypes observed in PO- and VO-induced LV hypertrophies reflect stimulus- and/or model-specific heterogeneity in autocrine and/or paracrine signaling pathways. Elucidating the divergent aspects of these signaling pathways may lead to a better understanding of the mechanisms that govern physiological and pathological myocardial hypertrophy.


*    Selected Abbreviations and Acronyms
 
ß-MHC = b-myosin heavy chain
aFGF = acidic fibroblast growth factor
IGF-1 = insulin-like growth factor-1
LV = left ventricular
PO = pressure overload
prepro-ANF = prepro–atrial natriuretic factor
SERCA2 = sarcoplasmic reticulum Ca2+ATPase
TGF = transforming growth factor
VO = volume overload


*    Acknowledgments
 
This work was supported in part by a grant from the NIH (HL-42539). Dr Calderone was the recipient of postdoctoral fellowships from le Fonds de la Recherche en Santé du Québec (1992 and 1993) and the Medical Research Council of Canada (1993 through 1995). Dr Thaik was the recipient of a National Research Service Award from the NIH. We gratefully acknowledge Olga Smirnova for excellent technical assistance and Paula McColgan for expert typing.

Received January 26, 1995; revision received August 31, 1995; accepted September 1, 1995.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Grossman W, Jones D, McLaurin LP. Wall stress and patterns of hypertrophy in the human left ventricle. J Clin Invest. 1975;56:56-64.

2. Anversa P, Ricci R, Olivetti R. Quantitative structural analysis of the myocardium during physiologic growth and induced cardiac hypertrophy: a review. J Am Coll Cardiol. 1986;7:1140-1149. [Abstract]

3. Anversa P, Olivetti G, Melissari M, Loud AV. Stereological measurement of cellular and subcellular hypertrophy and hyperplasia in the papillary muscle of adult rat. J Mol Cell Cardiol. 1980;12:781-795. [Medline] [Order article via Infotrieve]

4. Morkin E. Postnatal muscle fiber assembly: localization of newly synthesized myofibrillar proteins. Science. 1970;167:1499-1501. [Abstract/Free Full Text]

5. Anversa P, Levicky V, Beghi C, McDonald SL, Kikkawa Y. Morphometry of exercise-induced right ventricular hypertrophy in the rat. Circ Res. 1983;52:57-64. [Abstract/Free Full Text]

6. Gerdes AM, Campbell SE, Hilbelink DR. Structural remodeling of cardiac myocytes in rats with arteriovenous fistulas. Lab Invest. 1988;59:857-861. [Medline] [Order article via Infotrieve]

7. Marino TA, Kent RL, Uboh CE, Fernandez E, Thompson EW, Cooper G IV. Structural analysis of pressure versus volume overload hypertrophy of cat right ventricle. Am J Physiol. 1985;249 (Heart Circ Physiol 18):H371-H379.

8. Mann DL, Urabe Y, Kent RL, Vinciguerra S, Cooper G IV. Cellular versus myocardial basis for the contractile dysfunction of hypertrophied myocardium. Circ Res. 1991;68:402-415. [Abstract/Free Full Text]

9. Urabe Y, Hamada Y, Spinale FG, Carabello BA, Kent RL, Cooper G IV, Mann DL. Cardiocyte contractile performance in experimental biventricular volume-overload hypertrophy. Am J Physiol. 1993;264:H1615-H1623. [Abstract/Free Full Text]

10. Tsutsui H, Ishihara K, Cooper G IV. Cytoskeletal role in the contractile dysfunction of hypertrophied myocardium. Science. 1993;260:682-687. [Abstract/Free Full Text]

11. Schwartz K, de la Bastie D, Bouveret P, Oliviéro P, Alonso S, Buckingham M. Nonsynchronous accumulation of {alpha}-skeletal actin and ß-myosin heavy chain mRNA's during early stages of pressure-overload-induced cardiac hypertrophy demonstrated by in situ hybridization. Circ Res. 1989;64:937-948. [Abstract/Free Full Text]

12. Izumo S, Nadal-Ginard B, Mahdavi V. Proto-oncogene induction and reprogramming of the cardiac gene expression produced by pressure overload. Proc Natl Acad Sci U S A. 1988;85:339-343. [Abstract/Free Full Text]

13. Schiaffino S, Samuel JL, Sassoon D, Lompre AM, Garner I, Marotte F, Buckingham M, Rappaport L, Schwartz K. Nonsynchronous accumulation of {alpha}-skeletal actin and ß-myosin heavy chain mRNAs during early stages of pressure-overload-induced cardiac hypertrophy demonstrated by in situ hybridization. Circ Res. 1989;64:937-948.

14. Black FM, Packer SE, Parker TG, Michael LH, Roberts R, Schwartz RJ, Schneider MD. The vascular smooth muscle {alpha}-actin gene is reactivated during cardiac hypertrophy provoked by load. J Clin Invest. 1991;88:1581-1588.

15. de la Bastie D, Levitsky D, Rappaport L, Mercadier J-J, Marotte F, Wisnewsky C, Brovkovich V, Schwartz K, Lompre A-M. Function of the sarcoplasmic reticulum and expression of its Ca2+-ATPase gene in pressure overload-induced cardiac hypertrophy in the rat. Circ Res. 1990;66:554-564. [Abstract/Free Full Text]

16. Nagai R, Zarain-Herzberg A, Brandl CJ, Fujii J, Tada M, MacLennan DH, Alpert NR, Periasamy M. Regulation of myocardial Ca2+-ATPase and phospholamban mRNA expression in response to pressure overload and thyroid hormone. Proc Natl Acad Sci U S A. 1989;86:2966-2970. [Abstract/Free Full Text]

17. Arai M, Matsui H, Periasamy M. Sarcoplasmic reticulum gene expression in cardiac hypertrophy and heart failure. Circ Res. 1994;74:555-564. [Free Full Text]

18. Feldman ARM, Weinberg EO, Ray PE, Lorell BH. Selective changes in cardiac gene expression during compensated hypertrophy and the transition to cardiac decompensation in rats with chronic aortic banding. Circ Res. 1993;73:184-192. [Abstract]

19. Lattion A-L, Michel J-B, Arnauld E, Corvol P, Soubrier F. Myocardial recruitment during ANF mRNA increase with volume overload in the rat. Am J Physiol. 1986;251:H890-H896. [Abstract/Free Full Text]

20. Mercadier J-J, Lompre A-M, Wisnewsky C, Samuel J-L, Bercovici J, Swynghedauw B, Schwartz K. Myosin isoenzymic changes in several models of rat cardiac hypertrophy. Circ Res. 1981;49:525-532. [Abstract/Free Full Text]

21. Parker TG, Packer SE, Schneider MD. Peptide growth factors can provoke "fetal" contractile protein gene expression in rat cardiac myocytes. J Clin Invest. 1990;85:507-514.

22. Takahashi N, Calderone A, Izzo NJ, Maki TM, Marsh JD, Colucci WS. Hypertrophic stimuli induce transforming growth factor ß1 expression in rat ventricular myocytes. J Clin Invest. 1994;94:1470-1476.

23. Sadoshima J, Izumo S. Molecular characterization of angiotensin II-induced hypertrophy of cardiac myocytes and hyperplasia of cardiac fibroblasts. Circ Res. 1993;73:413-423. [Abstract/Free Full Text]

24. Sadoshima J, Jahn L, Takahashi T, Kulik TJ, Izumo S. Molecular characterization of the stretch-induced adaptation of cultured cardiac cells, an in vitro model of load-induced cardiac hypertrophy. J Biol Chem. 1992;267:10551-10560. [Abstract/Free Full Text]

25. Garcia R, Diebold S. Simple, rapid, and effective method of producing aortocaval shunts in the rat. Cardiovasc Res. 1990;24:430-432. [Abstract/Free Full Text]

26. Morkin E, Ashford TP. Myocardial DNA synthesis in experimental cardiac hypertrophy. Am J Physiol. 1968;215:1409-1413.

27. Claycomb WC, Palazzo MC. Culture of the terminally differentiated adult cardiac muscle cell: a light scanning electron microscope study. Dev Biol. 1980;80:466-482. [Medline] [Order article via Infotrieve]

28. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Ann Biochem. 1987;162:156-159.

29. Takahashi T, Schunkert H, Isoyama S, Wei JY, Nadal-Ginard B, Grossman W, Izumo S. Age-related differences in the expression of proto-oncogene and contractile protein genes in response to pressure overload in the rat myocardium. J Clin Invest. 1992;89:939-946.

30. Izzo NJ, Tulenko TN, Colucci WS. Phorbol esters and norepinephrine destabilize {alpha}1B-adrenergic receptor mRNA in vascular smooth muscle cells. J Biol Chem. 1994;269:1705-1710. [Abstract/Free Full Text]

31. Gustafson TA, Markham BE, Morkin E. Analysis of thyroid hormone effects on myosin heavy chain gene expression in cardiac and soleus muscles using a novel dot-blot mRNA assay. Biochem Biophys Res Commun. 1985;130:1161-1167. [Medline] [Order article via Infotrieve]

32. Parker TG, Chow K-L, Schwartz RJ, Schneider MD. Differential regulation of skeletal {alpha}-actin transcription in cardiac muscle by two fibroblast growth factors. Proc Natl Acad Sci U S A. 1990;87:7066-7070. [Abstract/Free Full Text]

33. Ruzicka M, Yuan B, Harmsen E, Leenen FHH. The renin-angiotensin system and volume overload-induced cardiac hypertrophy in rats: effects of angiotensin converting enzyme inhibitor versus angiotensin II receptor blocker. Circulation. 1993;87:921-930. [Abstract/Free Full Text]

34. Ruzicka M, Yuan B, Leenen FHH. Effects of enalapril versus losartan on regression of volume overload-induced cardiac hypertrophy in rats. Circulation. 1994;90:484-491. [Abstract/Free Full Text]

35. Ruzicka M, Leenen FHH. Relevance of blockade of cardiac and circulatory angiotensin-converting enzyme for the prevention of volume overload-induced cardiac hypertrophy. Circulation. 1995;91:16-19. [Abstract/Free Full Text]

36. Ruzicka M, Keeley FW, Leenen FHH. The renin-angiotensin system and volume overload–induced changes in cardiac collagen and elastin. Circulation. 1994;90:1989-1996. [Abstract/Free Full Text]

37. Dowell RT, McManus RE III. Pressure-induced cardiac enlargement in neonatal and adult rats. Circ Res. 1978;42:303-310. [Free Full Text]

38. Lindpaintner K, Lu W, Niedermajer N, Schieffer B, Just H, Ganten, Drexler H. Selective activation of cardiac angiotensinogen gene expression in post-infarction ventricular remodeling in the rat. J Mol Cell Cardiol. 1993;25:133-143. [Medline] [Order article via Infotrieve]

39. Eghbali M, Tomek R, Sukhatme VP, Woods C, Bhambi B. Differential effects of transforming growth factor-ß1 and phorbol myristate acetate on cardiac fibroblasts: regulation of fibrillar collagen mRNAs and expression of early transcription factors. Circ Res. 1991;69:483-490. [Abstract/Free Full Text]

40. Donohue TJ, Dworkin LD, Lango MN, Fleigner K, Lango RP, Benstein JA, Slater WR, Catanese VM. Induction of myocardial insulin-like growth factor-1 gene expression in left ventricular hypertrophy. Circulation. 1994;89:799-809. [Abstract/Free Full Text]

41. Sakai S, Yerikane R, Miyauchi T, Sakurai T, Yamaguchi I, Sugishita Y, Goto K. Increased mRNA and peptide levels of endothelin-1 in the hypertrophied rat heart due to pressure but not volume overload. Circulation. 1994;90(pt 2):I-260. Abstract.




This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. C. Gupta, K. D. Varian, N. C. Bal, J. L. Abraham, M. Periasamy, and P. M. L. Janssen
Pulmonary artery banding alters the expression of Ca2+ transport proteins in the right atrium in rabbits
Am J Physiol Heart Circ Physiol, June 1, 2009; 296(6): H1933 - H1939.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
M.-C. Aubin, C. Lajoie, R. Clement, H. Gosselin, A. Calderone, and L. P. Perrault
Female Rats Fed a High-Fat Diet Were Associated with Vascular Dysfunction and Cardiac Fibrosis in the Absence of Overt Obesity and Hyperlipidemia: Therapeutic Potential of Resveratrol
J. Pharmacol. Exp. Ther., June 1, 2008; 325(3): 961 - 968.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
J. A. Hill and E. N. Olson
Cardiac Plasticity
N. Engl. J. Med., March 27, 2008; 358(13): 1370 - 1380.
[Full Text] [PDF]


Home page
Circ. Res.Home page
P. Li, D. Wang, J. Lucas, S. Oparil, D. Xing, X. Cao, L. Novak, M. B. Renfrow, and Y.-F. Chen
Atrial Natriuretic Peptide Inhibits Transforming Growth Factor {beta}-Induced Smad Signaling and Myofibroblast Transformation in Mouse Cardiac Fibroblasts
Circ. Res., February 1, 2008; 102(2): 185 - 192.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. M. MacDonnell, H. Kubo, D. M. Harris, X. Chen, R. Berretta, M. F. Barbe, S. Kolwicz, P. O. Reger, A. Eckhart, B. F. Renna, et al.
Calcineurin inhibition normalizes beta-adrenergic responsiveness in the spontaneously hypertensive rat
Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H3122 - H3129.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. Yue, T. Arai, M. Terashima, A. Y. Sheikh, F. Cao, D. Charo, G. Hoyt, R. C. Robbins, E. A. Ashley, J. Wu, et al.
Magnetic resonance imaging of progressive cardiomyopathic changes in the db/db mouse
Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2106 - H2118.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. J. Belin, M. P. Sumandea, T. Kobayashi, L. A. Walker, V. L. Rundell, D. Urboniene, M. Yuzhakova, S. H. Ruch, D. L. Geenen, R. J. Solaro, et al.
Left ventricular myofilament dysfunction in rat experimental hypertrophy and congestive heart failure
Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2344 - H2353.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. M. Katz and M. R. Zile
New Molecular Mechanism in Diastolic Heart Failure
Circulation, April 25, 2006; 113(16): 1922 - 1925.
[Full Text] [PDF]


Home page
CirculationHome page
L. van Heerebeek, A. Borbely, H. W.M. Niessen, J. G.F. Bronzwaer, J. van der Velden, G. J.M. Stienen, W. A. Linke, G. J. Laarman, and W. J. Paulus
Myocardial Structure and Function Differ in Systolic and Diastolic Heart Failure
Circulation, April 25, 2006; 113(16): 1966 - 1973.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. Bianchi, O. Kunduzova, E. Masini, C. Cambon, D. Bani, L. Raimondi, M.-H. Seguelas, S. Nistri, W. Colucci, N. Leducq, et al.
Oxidative Stress by Monoamine Oxidase Mediates Receptor-Independent Cardiomyocyte Apoptosis by Serotonin and Postischemic Myocardial Injury
Circulation, November 22, 2005; 112(21): 3297 - 3305.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
F. Prunier, Y. Chen, B. Gellen, M. Heimburger, C. Choqueux, B. Escoubet, J.-B. Michel, and J.-J. Mercadier
Left ventricular SERCA2a gene down-regulation does not parallel ANP gene up-regulation during post-MI remodelling in rats
Eur J Heart Fail, August 1, 2005; 7(5): 739 - 747.
[Abstract] [Full Text] [PDF]


Home page
Eur. J. Cardiothorac. Surg.Home page
T. Karamlou, I. Shen, B. Alsoufia, G. Burch, M. Reller, M. Silberbach, and R. M. Ungerleider
The influence of valve physiology on outcome following aortic valvotomy for congenital bicuspid valve in children: 30-year results from a single institution
Eur. J. Cardiothorac. Surg., January 1, 2005; 27(1): 81 - 85.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
J. W. Holmes
Candidate mechanical stimuli for hypertrophy during volume overload
J Appl Physiol, October 1, 2004; 97(4): 1453 - 1460.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
R.P. Dai, S.T. Dheen, B.P. He, and S.S.W. Tay
Differential expression of cytokines in the rat heart in response to sustained volume overload
Eur J Heart Fail, October 1, 2004; 6(6): 693 - 703.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
N. Frey, H. A. Katus, E. N. Olson, and J. A. Hill
Hypertrophy of the Heart: A New Therapeutic Target?
Circulation, April 6, 2004; 109(13): 1580 - 1589.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
P. A. Modesti, S. Vanni, I. Bertolozzi, I. Cecioni, C. Lumachi, A. M. Perna, M. Boddi, and G. F. Gensini
Different Growth Factor Activation in the Right and Left Ventricles in Experimental Volume Overload
Hypertension, January 1, 2004; 43(1): 101 - 108.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Y. Nakaoka, K. Nishida, Y. Fujio, M. Izumi, K. Terai, Y. Oshima, S. Sugiyama, S. Matsuda, S. Koyasu, K. Yamauchi-Takihara, et al.
Activation of gp130 Transduces Hypertrophic Signal Through Interaction of Scaffolding/Docking Protein Gab1 With Tyrosine Phosphatase SHP2 in Cardiomyocytes
Circ. Res., August 8, 2003; 93(3): 221 - 229.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
D. Kennedy, E. Omran, S. M. Periyasamy, J. Nadoor, A. Priyadarshi, J. C. Willey, D. Malhotra, Z. Xie, and J. I. Shapiro
Effect of Chronic Renal Failure on Cardiac Contractile Function, Calcium Cycling, and Gene Expression of Proteins Important for Calcium Homeostasis in the Rat
J. Am. Soc. Nephrol., January 1, 2003; 14(1): 90 - 97.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. G.F Bronzwaer, C. Zeitz, C. A Visser, and W. J Paulus
Endomyocardial nitric oxide synthase and the hemodynamic phenotypes of human dilated cardiomyopathy and of athlete's heart
Cardiovasc Res, August 1, 2002; 55(2): 270 - 278.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
P. Della Bella, A. Pappalardo, S. Riva, C. Tondo, G. Fassini, and N. Trevisi
Non-contact mapping to guide catheter ablation of untolerated ventricular tachycardia
Eur. Heart J., May 1, 2002; 23(9): 742 - 752.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
C. F. Deschepper, I. Boutin-Ganache, A. Zahabi, and Z. Jiang
In Search of Cardiovascular Candidate Genes: Interactions Between Phenotypes and Genotypes
Hypertension, February 1, 2002; 39(2): 332 - 336.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
D. Hilfiker-Kleiner, A. Hilfiker, B. Schieffer, D. Engel, D. L Mann, K. C Wollert, and H. Drexler
TNF{alpha} decreases {alpha}MHC expression by a NO mediated pathway: role of E-box transcription factors for cardiomyocyte specific gene regulation
Cardiovasc Res, February 1, 2002; 53(2): 460 - 469.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
A. Calderone, R. J. L. Murphy, J. Lavoie, F. Colombo, and L. Beliveau
TGF-{beta}1 and prepro-ANP mRNAs are differentially regulated in exercise-induced cardiac hypertrophy
J Appl Physiol, August 1, 2001; 91(2): 771 - 776.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
N. Abdelaziz, F. Colombo, I. Mercier, and A. Calderone
Nitric Oxide Attenuates the Expression of Transforming Growth Factor-{beta}3 mRNA in Rat Cardiac Fibroblasts via Destabilization
Hypertension, August 1, 2001; 38(2): 261 - 266.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. H. Sugden
Mechanotransduction in Cardiomyocyte Hypertrophy
Circulation, March 13, 2001; 103(10): 1375 - 1377.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
B. K. Podesser, D. A. Siwik, F. R. Eberli, F. Sam, S. Ngoy, J. Lambert, K. Ngo, C. S. Apstein, and W. S. Colucci
ETA-receptor blockade prevents matrix metalloproteinase activation late postmyocardial infarction in the rat
Am J Physiol Heart Circ Physiol, March 1, 2001; 280(3): H984 - H991.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
K. Freeman, C. Colon-Rivera, M. C. Olsson, R. L. Moore, H. D. Weinberger, I. L. Grupp, K. L. Vikstrom, G. Iaccarino, W. J. Koch, and L. A. Leinwand
Progression from hypertrophic to dilated cardiomyopathy in mice that express a mutant myosin transgene
Am J Physiol Heart Circ Physiol, January 1, 2001; 280(1): H151 - H159.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. A. Modesti, S. Vanni, I. Bertolozzi, I. Cecioni, G. Polidori, R. Paniccia, B. Bandinelli, A. Perna, P. Liguori, M. Boddi, et al.
Early sequence of cardiac adaptations and growth factor formation in pressure- and volume-overload hypertrophy
Am J Physiol Heart Circ Physiol, September 1, 2000; 279(3): H976 - H985.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
F. Sam, D. B. Sawyer, D. L.-F. Chang, F. R. Eberli, S. Ngoy, M. Jain, J. Amin, C. S. Apstein, and W. S. Colucci
Progressive left ventricular remodeling and apoptosis late after myocardial infarction in mouse heart
Am J Physiol Heart Circ Physiol, July 1, 2000; 279(1): H422 - H428.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
C. Ruwhof and A. van der Laarse
Mechanical stress-induced cardiac hypertrophy: mechanisms and signal transduction pathways
Cardiovasc Res, July 1, 2000; 47(1): 23 - 37.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. D. Sehl, J. T. N. Tai, K. J. Hillan, L. A. Brown, A. Goddard, R. Yang, H. Jin, and D. G. Lowe
Application of cDNA Microarrays in Determining Molecular Phenotype in Cardiac Growth, Development, and Response to Injury
Circulation, April 25, 2000; 101(16): 1990 - 1999.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
C. FINK, S. ERGÜN, D. KRALISCH, U. REMMERS, J. WEIL, and T. ESCHENHAGEN
Chronic stretch of engineered heart tissue induces hypertrophy and functional improvement
FASEB J, April 1, 2000; 14(5): 669 - 679.
[Abstract] [Full Text]


Home page
Circ. Res.Home page
G. G. N. Serneri, I. Cecioni, S. Vanni, R. Paniccia, B. Bandinelli, A. Vetere, X. Janming, I. Bertolozzi, M. Boddi, G. F. Lisi, et al.
Selective Upregulation of Cardiac Endothelin System in Patients With Ischemic but Not Idiopathic Dilated Cardiomyopathy : Endothelin-1 System in the Human Failing Heart
Circ. Res., March 3, 2000; 86(4): 377 - 385.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
F. Yoshihara, T. Nishikimi, T. Horio, C. Yutani, N. Nagaya, H. Matsuo, T. Ohe, and K. Kangawa
Ventricular adrenomedullin concentration is a sensitive biochemical marker for volume and pressure overload in rats
Am J Physiol Heart Circ Physiol, February 1, 2000; 278(2): H633 - H642.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Y. Nagatomo, B. A. Carabello, M. Hamawaki, S. Nemoto, T. Matsuo, and P. J. McDermott
Translational mechanisms accelerate the rate of protein synthesis during canine pressure-overload hypertrophy
Am J Physiol Heart Circ Physiol, December 1, 1999; 277(6): H2176 - H2184.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
D. A. Siwik, J. D. Tzortzis, D. R. Pimental, D. L.-F. Chang, P. J. Pagano, K. Singh, D. B. Sawyer, and W. S. Colucci
Inhibition of Copper-Zinc Superoxide Dismutase Induces Cell Growth, Hypertrophic Phenotype, and Apoptosis in Neonatal Rat Cardiac Myocytes In Vitro
Circ. Res., July 23, 1999; 85(2): 147 - 153.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
G. G. N. Serneri, P. A. Modesti, M. Boddi, I. Cecioni, R. Paniccia, M. Coppo, G. Galanti, I. Simonetti, S. Vanni, L. Papa, et al.
Cardiac Growth Factors in Human Hypertrophy : Relations With Myocardial Contractility and Wall Stress
Circ. Res., July 9, 1999; 85(1): 57 - 67.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Masciotra, S. Picard, and C. F. Deschepper
Cosegregation Analysis in Genetic Crosses Suggests a Protective Role for Atrial Natriuretic Factor Against Ventricular Hypertrophy
Circ. Res., June 25, 1999; 84(12): 1453 - 1458.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. L. Skolnick, S. E. Litwin, W. H. Barry, and K. W. Spitzer
Effect of ANG II on pHi, [Ca2+]i, and contraction in rabbit ventricular myocytes from infarcted hearts
Am J Physiol Heart Circ Physiol, November 1, 1998; 275(5): H1788 - H1797.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
S. Brodsky, K. Gurbanov, Z. Abassi, A. Hoffman, R. R. Ruffolo Jr, G. Z. Feuerstein, and J. Winaver
Effects of Eprosartan on Renal Function and Cardiac Hypertrophy in Rats With Experimental Heart Failure
Hypertension, October 1, 1998; 32(4): 746 - 752.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
C. Communal, K. Singh, D. R. Pimentel, and W. S. Colucci
Norepinephrine Stimulates Apoptosis in Adult Rat Ventricular Myocytes by Activation of the ß-Adrenergic Pathway
Circulation, September 29, 1998; 98(13): 1329 - 1334.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
N. Tanaka, T. Ryoke, M. Hongo, L. Mao, H. A. Rockman, R. G. Clark, and J. Ross Jr.
Effects of growth hormone and IGF-I on cardiac hypertrophy and gene expression in mice
Am J Physiol Heart Circ Physiol, August 1, 1998; 275(2): H393 - H399.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. Yue, B. M. Massie, P. C. Simpson, and C. S. Long
Cytokine expression increases in nonmyocytes from rats with postinfarction heart failure
Am J Physiol Heart Circ Physiol, July 1, 1998; 275(1): H250 - H258.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. S. Ross, C. Pham, S.-Y. Shai, J. I. Goldhaber, C. Fenczik, C. C. Glembotski, M. H. Ginsberg, and J. C. Loftus
ß1 Integrins Participate in the Hypertrophic Response of Rat Ventricular Myocytes
Circ. Res., June 15, 1998; 82(11): 1160 - 1172.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Kometiani, J. Li, L. Gnudi, B. B. Kahn, A. Askari, and Z. Xie
Multiple Signal Transduction Pathways Link Na+/K+-ATPase to Growth-related Genes in Cardiac Myocytes. THE ROLES OF Ras AND MITOGEN-ACTIVATED PROTEIN KINASES
J. Biol. Chem., June 12, 1998; 273(24): 15249 - 15256.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
K. L. Vikstrom, T. Bohlmeyer, S. M. Factor, and L. A. Leinwand
Hypertrophy, Pathology, and Molecular Markers of Cardiac Pathogenesis
Circ. Res., April 20, 1998; 82(7): 773 - 778.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. L. Segar, T. D. Scholz, K. A. Bedell, O. M. Smith, D. J. Huss, and E. N. Guillery
Angiotensin AT1 receptor blockade fails to attenuate pressure-overload cardiac hypertrophy in fetal sheep
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 1997; 273(4): R1501 - R1508.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
G. R. Norton, J. Tsotetsi, B. Trifunovic, C. Hartford, G. P. Candy, and A. J. Woodiwiss
Myocardial Stiffness Is Attributed to Alterations in Cross-Linked Collagen Rather Than Total Collagen or Phenotypes in Spontaneously Hypertensive Rats
Circulation, September 16, 1997; 96(6): 1991 - 1998.
[Abstract] [Full Text]


Home page
HypertensionHome page
A. Wickman, P. Friberg, M. A. Adams, G. L. Matejka, C. Brantsing, G. Guron, and J. Isgaard
Induction of Growth Hormone Receptor and Insulin-Like Growth Factor-I mRNA in Aorta and Caval Vein During Hemodynamic Challenge
Hypertension, January 1, 1997; 29(1): 123 - 130.
[Abstract] [Full Text]


Home page
CirculationHome page
S. Kobayashi, M. Yano, M. Kohno, M. Obayashi, Y. Hisamatsu, T. Ryoke, T. Ohkusa, K. Yamakawa, and M. Matsuzaki
Influence of Aortic Impedance on the Development of Pressure-Overload Left Ventricular Hypertrophy in Rats
Circulation, December 15, 1996; 94(12): 3362 - 3368.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K. C. Wollert, T. Taga, M. Saito, M. Narazaki, T. Kishimoto, C. C. Glembotski, A. B. Vernallis, J. K. Heath, D. Pennica, W. I. Wood, et al.
Cardiotrophin-1 Activates a Distinct Form of Cardiac Muscle Cell Hypertrophy
J. Biol. Chem., April 19, 1996; 271(16): 9535 - 9545.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Calderone, A.
Right arrow Articles by Colucci, W. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Calderone, A.
Right arrow Articles by Colucci, W. S.