(Circulation. 1995;92:2036-2040.)
© 1995 American Heart Association, Inc.
Articles |
Identification and Molecular Analysis of Two ApoB Gene Mutations Causing Low Plasma Cholesterol Levels
From the Lipid Metabolism Laboratory, Jean Mayer USDA Human Nutrition Research Center on Aging, Tufts University, Boston, Mass (F.K.W., J.O., E.J.S.); the Framingham (Mass) Heart Study (P.W.F.W); and the Gladstone Institute of Cardiovascular Disease, San Francisco, and the Cardiovascular Research Institute and the Department of Medicine, University of California, San Francisco (S.G.Y.).
Correspondence to Francine K. Welty, MD, PhD, Kennedy Hall 5th Floor, 1 Autumn St, Boston, MA 02215.
 |
Abstract |
|---|
 Top Abstract IntroductionMethods Results Discussion References |
|---|
Background Familial hypobetalipoproteinemia (FHB) is an autosomal codominant disorder characterized by abnormally low plasma levels of apoB and LDL cholesterol. Heterozygotes for FHB almost always have plasma LDL cholesterol levels <70 mg/dL and are asymptomatic. Because the low cholesterol levels may protect FHB heterozygotes from coronary heart disease, the mechanisms for FHB are of considerable interest.
Methods and Results The plasma lipoproteins of 29 subjects with LDL cholesterol levels <70 mg/dL were examined by SDS-PAGE. One subject who had virtually undetectable levels of LDL cholesterol had a truncated apoB, apoB-44.4, in his lipoproteins; a second subject with an LDL cholesterol level of 44 mg/dL had apoB-55 in his lipoproteins. The apoB-44.4 (2014 amino acids in length) resulted from a frameshift caused by an 11-bp insertion in exon 26 of the apoB gene; the apoB-55 (2494 amino acids) was caused by a nonsense mutation in exon 26 of the apoB gene. The apoB-55 mutation occurred at a CpG dinucleotide pair, a mutational hot spot, and was identical to a mutation described previously in a subject with hypobetalipoproteinemia. Our subject with apoB-55, however, had a different haplotype than the subject described previously, suggesting that the two apoB-55 mutations may have arisen independently. Of note, the apoB-55 proband's father, who had very low cholesterol levels and who probably carried the apoB-55 mutation, had significant coronary and aortic atherosclerosis at autopsy.
Conclusions In a study of adults with low LDL cholesterol levels, we discovered two subjects with truncated apoB proteins and identified the responsible mutations. ApoB gene mutations causing truncated apoB are not particularly rare in subjects with low cholesterol levels. The role of these mutations in preventing atherosclerosis deserves further study.
Key Words: molecular biology • lipoproteins • apolipoproteins • arteriosclerosis • cholesterol
|
Introduction |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
The B apolipoproteins, apoB-48 and apoB-100, play important roles in lipoprotein metabolism. Whereas apoB-48 has an obligatory role in the formation of chylomicrons in the intestine,1 apoB-100 is synthesized by the liver and secreted in triglyceride-rich VLDL particles.2 VLDL undergoes extensive metabolism in the plasma and is eventually transformed into cholesteryl ester–enriched LDL. Genetic, epidemiological, and experimental studies have indicated that high plasma levels of LDL cholesterol are causally related to the development of coronary heart disease.2
For many years, it has been suggested that individuals with low levels of LDL cholesterol might be protected from the development of coronary artery disease. In recent years, it has been shown that familial hypobetalipoproteinemia (FHB), a condition characterized by low plasma levels of apoB and LDL cholesterol, can be caused by apoB gene mutations.3 4 5 6 7 8 Nearly all the mutations identified as causing FHB interfere with the formation of a full-length apoB-100 molecule. Heterozygotes for FHB typically are asymptomatic and have LDL cholesterol levels of 20 to 50 mg/dL; homozygotes typically have almost undetectable levels of LDL cholesterol. The clinical phenotype of FHB homozygotes is highly variable but in severe cases may include neurological complications resulting from the intestinal malabsorption of vitamin E.5 Although it is reasonable to postulate that the low cholesterol levels in FHB might protect affected subjects from coronary artery disease, little definitive data on this issue exist.
We have recently screened a group of 29 subjects with LDL cholesterol levels that were <70 mg/dL. We identified two subjects with apoB gene mutations that led to the formation of truncated apoB proteins. In this study, we have characterized these mutations on the biochemical and molecular levels.
|
Methods |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
Human Subjects and Lipoprotein Analysis
Subjects in the Framingham Offspring Study and an adult volunteer for a metabolic research study had fasting lipoprotein profiles measured as described previously.8 9 In 29 subjects with LDL cholesterol levels <70 mg/dL, VLDL, LDL, and HDL fractions were examined by SDS-PAGE as described previously.8 In two subjects, truncated apoBs, apoB-55, and apoB-44.4 (see "Results") were identified. The ratio of the amount of apoB-100 to the amount of the truncated apoB in the VLDL was determined from SDS-polyacrylamide gels through gel scanning and peak integration with an LKB Ultrascan XL laser densitometer.
Enzymatic Amplification of DNA and DNA Sequencing
To
determine the mutation in the apoB gene responsible for
apoB-44.4, an 867-bp segment of exon 26 of the apoB gene (apoB cDNA
nucleotides 5794 through 6660) was enzymatically amplified
using Taq DNA polymerase, oligonucleotides
B44-1 (5' CACTGaATTcCAGCAATGTCT 3', apoB cDNA nucleotides
5794 through 5814) and B44-2 (5' TATATGTCTGCAGTTGAGATAG 3',
complementary to apoB cDNA nucleotides 6660 through 6639),
and 0.5 µg genomic DNA prepared from white blood cells. Two base
mismatches (lower-case letters above) were included in
oligonucleotide B44-1 to generate an EcoRI
site. Oligonucleotide B44-2 contained a native
Pst I site. To determine the mutation in the apoB gene
responsible for apoB-55, a 1040-bp segment of exon 26 of the apoB gene
(apoB cDNA nucleotides 7151 through 8190) was enzymatically
amplified with oligonucleotides B55-1 (5'
CCATGAaTTcATCGAGAGGTATGAAGTAG 3', apoB cDNA nucleotides
7151 through 7179) and B55-2 (5' CGGGCCACTGCAGCTCACTGTTC 3',
complementary to apoB cDNA nucleotides 8190 through 8168).
Two base mismatches (lowercase letters above) were included in B55-1 to
create an EcoRI site; B55-2 contained a native
Pst I site. For both mutations, the amplified DNA was
purified from a polyacrylamide gel, digested with
EcoRI and Pst I, and cloned into pGEM for DNA
sequencing. DNA sequencing was performed with the dideoxy
chain-termination technique on an ABI 373A DNA Sequencer
(Perkin-Elmer, Applied Biosystems).10
|
Results |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
FHB Associated With ApoB-44.4
The proband of the apoB-44.4 kindred was a healthy, well-developed, and asymptomatic 48-year-old man with total and HDL cholesterol levels of 34 and 25 mg/dL, respectively. The LDL cholesterol levels were undetectable. His nonfasting triglyceride level was 83 mg/dL. The extraordinarily low total and LDL cholesterol levels are typical for a compound heterozygote for FHB and are much lower than those observed in adults with the heterozygous form of FHB.5 SDS-PAGE of the VLDL, LDL, and HDL fractions revealed the presence of a truncated apoB, apoB-44.4 (Fig 1A
and 1B). Both the VLDL and LDL fractions of the
proband also contained a full-length apoB-100. It is noteworthy,
however, that the amount of apoB-100 in the VLDL fraction of the
apoB-44.4 proband was very low. The ratio of apoB-100 to apoB-44.4 in
the VLDL, as assessed by laser densitometry gel scanning, was very low,
0.31:1. In our prior studies of subjects with the heterozygous form of
FHB.8 11 12 13 14 15
we documented that the amount of apoB-100
invariably exceeds the amount of the truncated apoB in the VLDL
fraction, with a typical ratio of apoB-100 to truncated apoB in the
VLDL of 5:1 or 10:1 and occasionally greater. The fact that the
apoB-44.4 proband had an extremely low level of apoB-100 in his VLDL
fraction represents additional evidence in favor of the
argument that he is a compound heterozygote for FHB, with one mutant
apoB allele yielding apoB-44.4, and the other yielding very low
levels of a full-length apoB-100.5
|
A review of the medical
records of the proband's only known
relatives (his deceased mother, two sons, and a half brother) revealed
that all had total cholesterol levels that were less than
the fifth percentile for age- and sex-matched control subjects,
strongly suggesting that each of these individuals had the heterozygous
form of FHB. A half brother of the proband had total and LDL
cholesterol levels of 103 and 45 mg/dL, respectively, and
had apoB-44.4 in his VLDL (Fig 1B
). These cholesterol
levels are typical of those observed in adults with the heterozygous
form of FHB5 and are significantly higher than those
observed in the apoB-44.4 proband. In comparing the VLDL of the half
brother to that of the apoB-44.4 proband (Fig 1B), we see one
noteworthy similarity and one noteworthy difference. The similarity was
that both subjects had approximately the same amount of apoB-44.4 in
their VLDL fractions (per milliliter of plasma). The difference was
that the VLDL of the half brother contained a much greater amount of
apoB-100 relative to apoB-44.4. As judged by gel scanning, the ratio of
apoB-100 to apoB-44.4 in the VLDL of the half brother was 19.4:1. Thus,
the ratio of apoB-100 to apoB-44 in the VLDL fractions of the proband
and the proband's half brother differed by >60-fold, without
significantly different amounts of apoB-44.4 in their VLDL fractions.
We strongly suspect that the reason for this difference is that the
proband was a compound heterozygote for FHB and possessed, in addition
to the mutant apoB-44.4 allele, a second mutant allele
associated with very low levels of apoB-100.
One of the two offspring
of the apoB-44.4 proband, a 12-year-old
boy, agreed to give a sample of blood for this study. This subject did
not have apoB-44.4 in his lipoproteins (Fig 1B), but his
cholesterol levels were quite low. The total and LDL
cholesterol levels were 76 and 8 mg/dL, respectively. These
levels are less than the fifth percentile for age- and sex-matched
control subjects and are very similar to the cholesterol
levels in other FHB heterozygotes of a similar age.12 The
12-year-old son did not inherit the apoB-44.4 allele from his
father but almost certainly inherited a mutant allele associated
with markedly reduced amounts of apoB-100.
To determine the molecular
defect accounting for the production
of apoB-44.4, we cloned an enzymatically amplified segment of exon 26
into pGEM. Sequencing revealed that 5 of 10 pGEM clones contained a
duplication of 11 bp: cDNA nucleotides 6231 through 6241
inserted between cDNA nucleotides 6243 and 6244. This 11-bp
duplication produced three novel amino acids followed by a premature
stop codon (Fig 1C). The apoB-44.4 mutation creates two new
restriction
sites, BsaBI and Mam I, both at apoB cDNA
nucleotide 6232. The apoB-44.4 is predicted to contain 2014
amino acids.
FHB Associated With ApoB-55
In screening 28 Framingham
offspring, we identified a
57-year-old man who had apoB-55 in his plasma lipoproteins (Fig
2A). The ratio of apoB-100 to apoB-55 in the VLDL, as
determined by gel scanning, was 34.9. The proband was
asymptomatic and had total, HDL, and LDL
cholesterol levels of 108, 62, and 44 mg/dL, respectively.
The triglyceride concentration was 21 mg/dL. Funduscopic
examination of the proband revealed a normal retina with no signs of
retinitis pigmentosa. To identify the responsible mutation, the
relevant segment of exon 26 was amplified and subcloned into pGEM for
sequencing. Of 9 pGEM clones, 5 contained a C-to-T transition at apoB
cDNA nucleotide 7692 that resulted in a nonsense mutation
at codon 2495. The single nucleotide substitution creates a
new Bsa I restriction site (at apoB cDNA
nucleotide 7687). Restriction fragment digestion of
amplified DNA from the apoB-55 proband revealed that neither of his two
apoB alleles contained the polymorphic Xba I site in
exon 26 of the apoB gene (at apoB cDNA nucleotide
7674).
|
A son of the proband with apoB-55 had total, HDL, and LDL cholesterol levels of 194, 33, and 139 mg/dL, respectively. The mother of the proband had total cholesterol measurements of 194, 223, 230, and 250 mg/dL. Analysis of their plasma VLDL and LDL fractions revealed that neither carried the apoB-55 mutation. Medical records revealed that two of six first-degree relatives (a brother and daughter who were not available for blood sampling) had total cholesterol levels less than the fifth percentile for age- and sex-matched control subjects, suggesting that they probably carried the apoB-55 mutation. The proband's father had Parkinson's disease; as a result of this disorder, he fell and died from head injuries in 1965 at 71 years of age. Framingham Heart Study records revealed that he had total cholesterol levels of 126 mg/dL in 1950, 124 mg/dL in 1952, 110 mg/dL in 1954, 129 mg/dL in 1956, 124 mg/dL in 1958, 128 mg/dL in 1960, 125 mg/dL in 1962, and 143 mg/dL in 1964. These very low cholesterol levels strongly suggest that he carried the apoB-55 mutation. Interestingly, although the proband's father did not have symptoms of coronary heart disease, an autopsy revealed multiple large atheroma in the left main, left anterior descending, circumflex, and right coronary arteries. In addition, the aorta and iliac arteries had calcified and ulcerated atheroma. The only atherosclerotic risk factor of the proband's father was borderline hypertension, with diastolic blood pressure readings of 88 to 96 mm Hg over a 16-year period. He did not smoke, have diabetes mellitus, or have a family history of premature atherosclerotic heart disease.
|
Discussion |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
In this article, we describe two new kindreds with FHB, each associated with a truncated form of apoB. The apoB-44.4 mutation was identified in a 48-year-old man with undetectable levels of LDL cholesterol and a total cholesterol level of 34 mg/dL. These remarkably low cholesterol levels are typical of those found in compound heterozygotes for FHB and are significantly lower than levels typically observed in FHB heterozygotes.5 We therefore strongly suspect that the apoB-44.4 proband was a compound heterozygote for FHB, with one allele yielding apoB-44.4 and a second allele associated with markedly decreased levels of apoB-100. Another reason for suspecting that the apoB-44.4 proband was a compound heterozygote for FHB was supplied by examination of the VLDL fractions in the family. In the VLDL of FHB heterozygotes, we previously documented that the amount of apoB-100 invariably exceeds the amount of the truncated apoB.5 8 11 13 14 15 Consistent with these prior findings, the ratio of apoB-100 to apoB-44.4 in the VLDL of a half brother of the apoB-44.4 proband (a FHB heterozygote) was 19.4:1. In contrast, a high ratio of apoB-100 to apoB-44.4 was not observed in the VLDL of the apoB-44.4 proband. Despite having a similar absolute amount of VLDL–apoB-44.4 (compared with his half brother), the ratio of apoB-100 to apoB-44.4 in the proband's VLDL fraction was 0.31:1. We strongly suspect that the low levels of apoB-100 in the VLDL fraction of the proband were due to a second mutant allele associated with very low levels of a full-length apoB-100. This idea was supported by analysis of the proband's 12-year-old son. That subject almost certainly inherited the mutant allele associated with low levels of apoB-100; he clearly had FHB (LDL cholesterol level of 8 mg/dL), but he did not inherit the apoB-44.4 mutation. Because of the small size of the apoB-44.4 family, we could not perform the haplotyping studies required to prove that the allele yielding low levels of apoB-100 was truly a mutant apoB allele, as opposed to a mutant allele of some other dominantly inherited, yet-to-be-identified cholesterol-lowering gene.16 However, one could argue that the latter possibility is unlikely. If the proband had some other non-apoB cholesterol-lowering gene, one might expect that he would have low levels of both apoB-44.4 and apoB-100. This was not the case; comparison of the VLDL fractions of the proband and the half brother revealed that the proband had a selective decrease in the amount of apoB-100. Moreover, there have been several prior reports of well-characterized FHB compound heterozygotes who had one mutant apoB allele yielding a truncated apoB and a second mutant apoB allele yielding low levels of apoB-100.3 6 12 13 Like the apoB-44.4 proband in this study, the VLDL of these compound heterozygotes also contained low levels of apoB-100 relative to the level of the truncated apoB.
The mutation responsible for the production of apoB-44.4 was an 11-bp insertion within exon 26 of the apoB gene. Insertional mutations are much less common than deletions. Except for a single mutation involving an insertion of one adenine into a stretch of seven consecutive adenines,17 no prior insertional mutations have been described in the apoB gene. In contrast, more than 10 short deletions have been identified in the apoB gene.5 Insertional mutations are likewise rare in other genetic diseases. Of 82 different mutations causing cystic fibrosis, only 6 were insertions.18 Similarly, of 150 different mutations in the LDL receptor gene causing familial hypercholesterolemia, only 9 were insertions.19
The second case of hypobetalipoproteinemia was a 57-year-old man with an LDL cholesterol level of 44 mg/dL, a level quite typical for the heterozygous form of FHB. He had apoB-55 in his lipoproteins, the result of a nonsense mutation in exon 26 of the apoB gene. The same mutation was previously identified in an 80-year-old man with heterozygous hypobetalipoproteinemia and atypical retinitis pigmentosa.7 In that case, the retinitis pigmentosa appeared to be etiologically unrelated to the FHB, and the absence of retinitis pigmentosa in our subject supports this conclusion. Of note, the two independently identified subjects with apoB-55 did not share an identical apoB haplotype. In our subject with apoB-55, both apoB alleles lacked the polymorphic Xba I site in exon 26 of the apoB gene; in the other patient with the apoB-55 mutation, both alleles contained the Xba I polymorphism. It is quite possible that the two apoB-55 mutations occurred independently, as the mutation occurred at a CpG dinucleotide, a mutational hot spot.20 21 In any case, this report documents the first example of the same mutation causing hypobetalipoproteinemia in more than one kindred.
Truncated forms of apoB can cause low levels of LDL cholesterol and may be common causes of FHB. Intuitively, one would expect that these mutations would prevent the development of coronary artery disease; therefore, it is interesting that the father of the apoB-55 proband, who almost certainly carried the mutation, had significant atherosclerotic disease at autopsy. In the future, noninvasive studies of the carotid arteries could provide important information on the incidence of atherosclerosis in subjects with FHB.
|
Acknowledgments |
|---|
This work was supported by NHLBI grants HL-02626 (F.K.W.) and HL-41633 (S.G.Y.). Dr Welty was a Research and Teaching Scholar of the American College of Physicians. We gratefully acknowledge the assistance of Dr Richard Karas in this research. We express deep appreciation to the apoB-44.4 and apoB-55 families for their participation in this research.
Received March 23, 1995; revision received July 10, 1995; accepted August 18, 1995.
|
References |
|---|
|
TopAbstractIntroductionMethods Results Discussion References |
|---|
-
Chen S-H, Habib G, Yang C-Y, Gu Z-W, Lee BR, Weng
S-A, Silberman SR, Cai S-J, Deslypere JP, Rosseneu M, Gotto AM Jr, Li
W-H, Chan L. Apolipoprotein B-48 is the product of a
messenger RNA with an organ-specific in-frame stop
codon. Science. 1987;238:363-366.
[Abstract/Free Full Text]
-
Young SG. Recent progress in understanding
apolipoprotein B. Circulation. 1990;82:1574-1594.
[Abstract/Free Full Text]
-
Collins DR, Knott TJ, Pease RJ, Powell LM, Wallis SC,
Robertson S, Pullinger CR, Milne RW, Marcel YL, Humphries SE, Talmud
PJ, Lloyd JK, Miller NE, Muller D, Scott J. Truncated variants
of apolipoprotein B cause hypobetalipoproteinaemia.
Nucleic Acids Res. 1988;16:8361-8375.
[Abstract/Free Full Text]
-
Huang L-S, Ripps ME, Korman SH, Deckelbaum RJ, Breslow
JL. Hypobetalipoproteinemia due
to an apolipoprotein B gene exon 21 deletion derived by Alu-Alu
recombination. J Biol Chem. 1989;264:11394-11400.
[Abstract/Free Full Text]
-
Linton MF, Farese RV Jr, Young SG. Familial
hypobetalipoproteinemia.
J Lipid Res. 1993;34:521-541. [Medline]
[Order article via Infotrieve]
-
Pullinger CR, Hillas E, Hardman DA, Chen GC,
Naya-Vigne J-M, Iwasa JA, Hamilton RL, Lalouel J-M, Williams RR, Kane
JP. Two apolipoprotein B gene defects in a kindred with
hypobetalipoproteinemia, one of which
results in a truncated variant, apoB-61, in VLDL and LDL.
J Lipid Res. 1992;33:699-710. [Abstract]
-
Talmud PJ, Converse C, Krul E, Huq L, McIlwaine GG,
Series JJ, Boyd P, Schonfeld G, Dunning A, Humphries S. A novel
truncated apolipoprotein B (apo B55) in a patient with familial
hypobetalipoproteinemia and atypical
retinitis pigmentosa. Clin Genet. 1992;42:62-70. [Medline]
[Order article via Infotrieve]
-
Welty FK, Hubl ST, Pierotti VR, Young SG. A
truncated species of apolipoprotein B (B67) in a kindred with familial
hypobetalipoproteinemia.
J Clin Invest. 1991;87:1748-1754.
-
McNamara JR, Schaefer EJ. Automated enzymatic
standardized lipid analyses for plasma and lipoprotein
fractions. Clin Chim Acta. 1987;166:1-8.[Medline]
[Order article via Infotrieve]
-
Sanger F, Nicklen S, Coulson AR. DNA sequencing
with chain-terminating inhibitors. Proc
Natl Acad Sci U S A. 1977;74:5463-5467.
[Abstract/Free Full Text]
-
Farese RV Jr, Garg A, Pierotti VR, Vega GL, Young SG.
A truncated species of apolipoprotein B, B-83, associated with
hypobetalipoproteinemia.
J Lipid Res. 1992;33:569-577. [Abstract]
-
Young SG, Bertics SJ, Curtiss LK, Dubois BW, Witztum
JL. Genetic analysis of a kindred with familial
hypobetalipoproteinemia: evidence for
two separate gene defects: one associated with an abnormal
apolipoprotein B species, apolipoprotein B-37; and a second associated
with low plasma concentrations of apolipoprotein B-100.
J Clin Invest. 1987;79:1842-1851.
-
Young SG, Bertics SJ, Curtiss LK, Witztum JL.
Characterization of an abnormal species of apolipoprotein B,
apolipoprotein B-37, associated with familial
hypobetalipoproteinemia.
J Clin Invest. 1987;79:1831-1841.
-
Young SG, Hubl ST, Chappell DA, Smith RS, Claiborne F,
Snyder SM, Terdiman JF. Familial
hypobetalipoproteinemia associated with
a mutant species of apolipoprotein B (B46). N
Engl J Med. 1989;320:1604-1610. [Medline]
[Order article via Infotrieve]
-
Young SG, Pullinger CR, Zysow BR, Hofmann-Radvani H,
Linton MF, Farese RV Jr, Terdiman JF, Snyder SM, Grundy SM, Vega GL,
Malloy MJ, Kane JP. Four new mutations in the apolipoprotein B
gene causing hypobetalipoproteinemia,
including two different frameshift mutations that yield truncated
apolipoprotein B proteins of identical length. J
Lipid Res. 1993;34:501-507. [Abstract]
-
Hobbs HH, Leitersdorf E, Leffert CC, Cryer DR, Brown
MS, Goldstein JL. Evidence for a dominant gene that suppresses
hypercholesterolemia in a family with defective
low density lipoprotein receptors. J Clin
Invest. 1989;84:656-664.
-
Groenewegen WA, Krul ES, Averna MR, Pulai J, Schonfeld
G. Dysbetalipoproteinemia in a kindred with
hypobetalipoproteinemia due to
mutations in the genes for apoB (apoB-70.5) and apoE (apoE2).
Arterioscler Thromb. 1994;14:1695-1704.
[Abstract/Free Full Text]
-
Pearson P, Francomano C, Foster P, Bocchini C, Li P,
McKusick V. The status of online mendelian inheritance in man
(OMIM) medio 1994. Nucleic Acids Res. 1994;22:3470-3473.
[Abstract/Free Full Text]
-
Hobbs HH, Brown MS, Goldstein JL. Molecular
genetics of the LDL receptor gene in familial
hypercholesterolemia. Hum
Mutat. 1992;1:445-466. [Medline]
[Order article via Infotrieve]
-
Cooper DN, Krawczak M. The mutational spectrum
of single base-pair substitutions causing human genetic disease:
patterns and predictions. Hum Genet. 1990;85:55-74. [Medline]
[Order article via Infotrieve]
-
Youssoufian H, Antonarakis SE, Bell W, Griffin AM,
Kazazian HH Jr. Nonsense and missense mutations in hemophilia A:
estimate of the relative mutation rate at CG
dinucleotides. Am J Hum Genet. 1988;42:718-725.[Medline]
[Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  J. C. Cohen, E. Boerwinkle, T. H. Mosley Jr., and H. H. Hobbs Sequence variations in PCSK9, low LDL, and protection against coronary heart disease. N. Engl. J. Med., March 23, 2006; 354(12): 1264 - 1272. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Xu, W. J. Brecht, K. H. Weisgraber, R. W. Mahley, and Y. Huang Apolipoprotein E4 Domain Interaction Occurs in Living Neuronal Cells as Determined by Fluorescence Resonance Energy Transfer J. Biol. Chem., June 11, 2004; 279(24): 25511 - 25516. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Schonfeld Familial hypobetalipoproteinemia: a review J. Lipid Res., May 1, 2003; 44(5): 878 - 883. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Schonfeld, B. W. Patterson, D. A. Yablonskiy, T. S. K. Tanoli, M. Averna, N. Elias, P. Yue, and J. Ackerman Fatty liver in familial hypobetalipoproteinemia: triglyceride assembly into VLDL particles is affected by the extent of hepatic steatosis J. Lipid Res., March 1, 2003; 44(3): 470 - 478. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. K. Welty, K. A. Guida, and J. J. Andersen Donor Splice-Site Mutation (210+1G_C) in the ApoB Gene Causes a Very Low Level of ApoB-100 and LDL Cholesterol Arterioscler. Thromb. Vasc. Biol., November 1, 2001; 21(11): 1864 - 1865. [Full Text] [PDF]
|
|
|
|
|
|
P. Tarugi, A. Lonardo, C. Gabelli, F. Sala, G. Ballarini, I. Cortella, L. Previato, S. Bertolini, R. Cordera, and S. Calandra Phenotypic expression of familial hypobetalipoproteinemia in three kindreds with mutations of apolipoprotein B gene J. Lipid Res., October 1, 2001; 42(10): 1552 - 1561. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Couture, J. D. Otvos, L. A. Cupples, P. W. F. Wilson, E. J. Schaefer, and J. M. Ordovas Association of the A-204C polymorphism in the cholesterol 7{alpha}-hydroxylase gene with variations in plasma low density lipoprotein cholesterol levels in the Framingham Offspring Study J. Lipid Res., October 1, 1999; 40(10): 1883 - 1889. [Abstract] [Full Text]
|
|
|
|
|
|
J. Wu, J. Kim, Q. Li, P.-Y. Kwok, T. G. Cole, B. Cefalu, M. Averna, and G. Schonfeld Known mutations of apoB account for only a small minority of hypobetalipoproteinemia J. Lipid Res., May 1, 1999; 40(5): 955 - 959. [Abstract] [Full Text]
|
|
|
|
|
|
F. K. Welty, C. Lahoz, K. L. Tucker, J. M. Ordovas, P. W. F. Wilson, and E. J. Schaefer Frequency of ApoB and ApoE Gene Mutations as Causes of Hypobetalipoproteinemia in the Framingham Offspring Population Arterioscler. Thromb. Vasc. Biol., November 1, 1998; 18(11): 1745 - 1751. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-F. Zhu, D. Noto, R. Seip, A. Shaish, and G. Schonfeld Organ Loci of Catabolism of Short Truncations of ApoB Arterioscler. Thromb. Vasc. Biol., June 1, 1997; 17(6): 1032 - 1038. [Abstract] [Full Text]
|
|
|
|
 |
|
 F. K. Welty, M. A. Mittleman, P. W.F. Wilson, P. A. Sutherland, T. H. Matheney, I. Lipinska, J. E. Muller, D. Levy, and G. H. Tofler Hypobetalipoproteinemia Is Associated With Low Levels of Hemostatic Risk Factors in the Framingham Offspring Population Circulation, February 18, 1997; 95(4): 825 - 830. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||