Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 1995;92:457-464

This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Russell, M. E.
Right arrow Articles by Karnovsky, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Russell, M. E.
Right arrow Articles by Karnovsky, M. J.

(Circulation. 1995;92:457-464.)
© 1995 American Heart Association, Inc.


Articles

Upregulation and Modulation of Inducible Nitric Oxide Synthase in Rat Cardiac Allografts With Chronic Rejection and Transplant Arteriosclerosis

Mary E. Russell, MD; Africa F. Wallace, AB; Lauri R. Wyner, BA; John B. Newell, AB; Morris J. Karnovsky, MB, BCh

From Harvard Medical School (M.E.R., L.R.W., M.J.K.); Harvard School of Public Health (A.F.W., M.E.R.); Cardiac Unit (J.B.N.), Massachusetts General Hospital; and the Cardiovascular Division (M.E.R.), Brigham and Women's Hospital, Boston, Mass.

Correspondence to Mary E. Russell, MD, Harvard School of Public Health, Cardiovascular Biology Laboratory, 677 Huntington Ave, Boston, MA 02115.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowNote Added in Proof
down arrowReferences
 
Background The Lewis-F344 rat cardiac transplantation model produces cardiac allografts with chronic rejection characterized by arteriosclerotic lesions composed of macrophages and smooth muscle cells. Modulation of the inflammatory response with a diet deficient in essential fatty acids protects against the development of intimal thickening. Little is known about the components of the inflammatory response mediating this process. The cytokine-inducible isoform of nitric oxide synthase (iNOS) regulates the high-output nitric oxide pathway that confers activation properties to macrophages and regulates vasomotion, monocyte adherence, and smooth muscle cell proliferation in the vasculature. The purpose of the present study was to determine whether the iNOS pathway was upregulated during the course of chronic cardiac rejection.

Methods and Results We studied iNOS mRNA and protein expression patterns in a series of Lewis-F344 cardiac allografts with early and late chronic rejection and after modulation of the inflammatory response (in an effort to attenuate arteriosclerosis). Relative gene transcript levels were measured with a 32P-dCTP reverse-transcriptase polymerase chain reaction assay designed to amplify iNOS mRNA. The distribution of the iNOS gene product was examined by immunocytochemistry with a polyclonal antibody against iNOS. NOS transcript levels increased significantly in cardiac allografts (days 7, 14, 28, and 75) compared with paired host hearts (exposed to the same circulation) and syngrafts (P<.003). Immunostaining localized the iNOS antigen within subpopulations of mononuclear inflammatory cells in cardiac allografts—presumably, activated macrophages. The number of iNOS-positive mononuclear cells was 25-fold higher in cardiac allografts compared with paired host hearts and syngrafts (P<.009). In cardiac allografts of 75 days or older, there also was striking iNOS staining within some medial and intimal smooth muscle cells in various vessels. Modulation of the inflammatory response (with a diet deficient in essential fatty acids) produced significant decreases in the intimal thickening score and in the percentage of diseased vessels in 28-day cardiac allografts compared with allografts from rats fed a control diet. There was a correlate decrease in iNOS transcript levels and in the number of iNOS-positive mononuclear cells in the 28-day cardiac allografts from rats fed the essential fatty acid-deficient diet.

Conclusions The early and persistent upregulation of iNOS in chronic cardiac rejection and the coincident reduction in arteriosclerosis and downregulation of iNOS suggest that this inducible regulator may contribute to the inflammatory response mediating transplant arteriosclerosis.


Key Words: arteriosclerosis • macrophages • rejection • transplantation


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowNote Added in Proof
down arrowReferences
 
In response to inflammatory stimuli, an inducible isoform of nitric oxide synthase (iNOS) is believed to produce large amounts of nitric oxide.1 2 3 4 Among its immunological functions, nitric oxide is believed to modulate cytotoxic and cytostatic actions and therefore often is considered a hallmark of macrophage activation.5 In addition, nitric oxide suppresses T-cell proliferation and inhibits migration of neutrophils and monocytes.4 Nitric oxide has been implicated in the pathogenesis of several chronic inflammatory diseases, including autoimmunity and arthritis.6 7 In the vasculature, endothelial and smooth muscle cell forms of NOS have been cloned,8 and their regulation by cytokines is under investigation.9 10 Recent evidence suggests that increased levels of nitric oxide impair leukocyte-endothelium interaction, inhibit arterioscle-rotic intimal thickening,11 12 13 14 15 and play an important role in vasomotor reactivity.3 16

An accelerated form of arteriosclerosis composed of intimal smooth muscle cells, macrophages, and some lymphocytes develops in the majority of cardiac transplant recipients and limits long-term graft survival.17 Considerable insight into this cellular evolution has been provided by the Lewis-F344 heterotopic rat cardiac transplantation model of chronic rejection, which produces arteriosclerotic lesions in stages.18 19 20 Early vascular changes involve thickening of the neointima with macrophages and occasional lymphocytes. Later (75 to 120 days), there is accumulation of smooth muscle cells in the neointima with fewer inflammatory cells.18 20 It has been our working hypothesis that a cell-mediated inflammatory response involving activated macrophages mediates intimal thickening. This mediation might occur by local induction of a number of known and unknown effector pathways that culminate in growth factor-initiated smooth muscle cell proliferation and migration. However, the precise mechanisms have yet to be clarified. Recent reports documenting increased expression of the platelet-derived growth factor (PDGF) receptor in the vasculature of Lewis-F344 cardiac allografts, as well as our findings that expression of monocyte chemoattractant protein-1 and interferon-{gamma} (IFN-{gamma}) had increased, provide support for the hypothesis.21 22 23

The cytokine-rich environment of the Lewis-F344 model of chronic cardiac allograft rejection provides an opportunity to study the iNOS activation pathway during various stages of chronic rejection and transplant arteriosclerosis. We describe the tissue expression and cellular distribution of iNOS in this model. We also studied time-dependent iNOS mRNA and protein expression patterns and how they are affected by modulation of the inflammatory response.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowNote Added in Proof
down arrowReferences
 
Lewis-F344 Rat Model of Chronic Rejection
Heterotopic abdominal cardiac transplantation was performed, and hearts were harvested as described using Lewis rats as donors.18 22 F344 rats were used as recipients in the allogeneic combination to produce chronic rejection. Lewis rats were used in the syngeneic combination to produce control hearts exposed to the same surgical procedure but free of vascular abnormalities. Native (or host) hearts were used as reference hearts exposed to the same circulation but free of abnormalities. A minimum of three transplantations was performed and transplants were harvested at 3, 7, 14, 28, and 75 days, at which points serial midventricular sections were collected for immunohistochemical studies or snap-frozen in liquid nitrogen for subsequent RNA extraction. Only hearts that yielded optimal samples for reverse-transcriptase polymerase chain reaction (RT-PCR) (discussed later) and immunostaining were analyzed.

Measurement of Gene Transcript Levels
Relative gene transcript levels were measured with RT-PCR assays as described.22 23 24 These assays are sensitive, require only 2.5 µg of total RNA, and permit replicates to be performed from a single cDNA strand. In brief, total cellular RNA was extracted from ventricular samples with RNAzol B and checked for quality on denaturing agarose gels. Samples were deemed to be of high quality when the amount of RNA in the 28S ribosomal band was twice that in the 18S ribosomal band. Only samples that yielded high-quality total RNA were used for cDNA synthesis (2.5 µg of total RNA per reaction). Primers for iNOS were designed using the MAC VECTOR sequence analysis program (International Biotechnologies) from the 5' portion of the cDNA (bp, 30 to 477). Glyceraldehyde-3-phosphate dehydrogenase (G3PDH) primers were used as controls. Sequence analysis confirmed amplification of the predicted iNOS and G3PDH fragments. Primer sequences, annealing temperatures, and number of cycles were as follows: for iNOS, 5' TGCCAGGGTCACAACTTTACAGG and 3' GGTCGATGTCACATGCAGCTTGTC (References 2 and 25) (60°C, 30 cycles); and for G3PDH, 5' TGA AGG TCG GTG TCA ACG GAT TTG GC and 3' CAT GTA GGC CAT GAG GTC CAC CAC (Reference 23) (58°C, 22 cycles).

The RT-PCR assay was performed with the Gene Amp 9600 system by using the hot-start technique. The logarithmic ranges of PCR amplification were established as a function of cycle number and cDNA dilution for each primer pair. 32P-dCTP was added to allow measurement of incorporated radioactivity in amplified PCR product bands from dried agarose gels on a PhosphorImager (Molecular Dynamics). Corrected levels were derived by determining the ratio of 32P incorporated in the amplified iNOS product band to the mean of that incorporated in the amplified G3PDH band (derived from quadruplicate measurements) for the corresponding cDNA as described.24 To identify relative differences. we derived corrected transcript levels from sets of cDNA (studied simultaneously) that included negative controls (for which RT had been omitted during cDNA synthesis or water used instead of cDNA). Each PCR analysis was completed in quadruplicate. In the temporal study, the experimental set of cDNAs was derived from 12 transplant pairs (allograft and host hearts) harvested at various time points (days 3 [n=1], 7 [n=3], 14 [n=2], 28 [n=3], and 75 [n=3]), as well as hearts from a Lewis syngeneic pair (n=1) and a day-0 heart (harvested but not transplanted) (n=1). The mean value for the corrected levels was obtained by pooling measurements from all animals in a subgroup.

Statistical Analysis
Results from experimental sets were subjected to MANOVA without replication. If they were significant, individual comparisons were made, and the level of significance was corrected with the Bonferroni method. With MANOVA, all data are pooled to estimate standard errors. This approach was selected because it is considered statistically sound in the setting of small samples.26

Immunocytochemical Studies
To identify the iNOS gene product and study its distribution, we performed immunohistochemical staining with 4-µm sections. Paraffin blocks from cardiac allografts and host hearts completed in the present study (days 7, 28, and 75) as well as those from previous studies (day 120) were analyzed. Syngrafts were analyzed at days 28 and 120.20 For the diet study, allograft and host hearts harvested at days 7 and 28 from rats fed each diet were analyzed, and 120-day samples from a previous study were included.27 Duplicate sections were stained from two animals in each of the subgroups studied. The polyclonal rabbit anti-iNOS sera was prepared by Jeffrey R. Weidner and Richard A. Mumford (Merck Sharp & Dhome Laboratories) and kindly provided to us by Dr Carl Nathan. It was produced through immunization with a synthetic peptide sequence corresponding to the C-terminus (residues 1 through 20) of the long isoform of murine macrophage iNOS.2 Previous characterization of the sera has shown that staining can be blocked by synthetic peptides corresponding to the peptide that was used as immunogen (C. Nathan, personal communication).

We performed immunostaining as described with antisera against iNOS (in dilutions of 1:1000 or 1:2000) and a secondary, biotinylated, goat anti-rabbit antibody.20 22 IFN-{gamma}-stimulated rat macrophages with documented elevations in nitrate production (measured by the Greiss reaction) were used as positive control cells. Negative controls included (1) omission of the primary antibody, (2) use of an alternative primary antibody, and (3) staining of phosphate-buffered saline-stimulated rat macrophages. To localize the cell types expressing iNOS, we also performed double-immunostaining experiments with antibodies directed against von Willebrand factor, to identify endothelial cells; smooth muscle cell actin, to identify smooth muscle cells; and ED-1, to identify monocytes/macrophages, as described.20 22 Avidin-biotin was used to identify the first antibody (anti-iNOS), followed by alkaline phosphatase to identify the second antibody.

Dietary Modulation of the Inflammatory Response
We studied iNOS expression patterns in early cardiac allografts (days 7 and 28) from rats fed an essential fatty acid-deficient (EFAD) diet, which modulates the inflammatory response in the Lewis-F344 chronic rejection model. We had shown previously that the EFAD diet protected against the development of arteriosclerosis in 120-day cardiac allografts, but we had not studied earlier time points.27 In brief, F344 weanlings were maintained on an EFAD or a control diet for 8 weeks before transplantation. (Although the rats appeared healthy, there was some retardation of growth in those fed the EFAD diet.) Four transplantations were performed at each time point in each of the diet subgroups. We harvested the allografted and host hearts at 7 days (when infiltration just begins and the vascular abnormality is confined to adhesion of mononuclear cells to the vessel lumen) and at 28 days (when intimal thickening and interstitial infiltration typically are first evident). Functional evaluation of the hearts was completed by palpation as previously described.18 Vessel morphometry was assessed by scoring Verhoeff's elastin-stained sections as described.18 The degree of arterial intimal thickening was graded on a scale of 0 (normal) to 5 (circumferential thickening affecting more than 80% of the lumen), and the percentage of diseased arteries was tabulated. For studies involving transcript measurements, the experimental set included cDNA only from the subgroup of transplants (at each time point) that yielded high-quality total RNA. Thus, although four transplantations were performed and graded at each time point, only two transplant-paired samples (allograft and host heart) from each subgroup were analyzed with RT-PCR, with the exception of the 28-day EFAD diet subgroup, which included three transplant-paired samples.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowNote Added in Proof
down arrowReferences
 
iNOS Transcript Levels Increase in Cardiac Allografts
iNOS gene transcripts increased dramatically in the 12 allografted hearts compared with paired host hearts and syngrafts (Fig 1Down). The representative radioactive images of amplified PCR product bands in dried agarose gels for iNOS (top) and for G3PDH (middle) show the raw data used to derive corrected transcript levels. For simplicity, these images present the results of a PCR analysis performed with a single representative cDNA sample for each of the various harvest time points. The intensity of the iNOS bands from cardiac allografts on days 7 through 75 is marked in comparison with those of the bands from host hearts and syngrafts (which are barely visible). In contrast, relatively uniform bands are seen for G3PDH in all lanes from the same set of cDNAs, with the exception of day 3 (Fig 1Down, middle).



View larger version (47K):
[in this window]
[in a new window]
 
Figure 1. Early and sustained elevation in inducible nitric oxide synthase (iNOS) gene transcript levels in Lewis-F344 cardiac allografts. Radioactive images of dried agarose gels containing polymerase chain reaction amplification products for iNOS (top) and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) (middle) are from a representative analysis that included one cDNA from each time point. Cardiac allografts are seen in lanes 1 through 6, paired host hearts in lanes 7 through 11, and a syngraft in lane 12. Intense iNOS bands are seen for the cDNAs from cardiac allografts harvested at days 7 through 28 (lanes 3 through 5) compared with paired host hosts (lanes 7 through 11) and the syngrafts (lane 12). In contrast, relatively clear bands are seen for all sample cDNAs for the same cDNA set after amplification with G3PDH. Corrected transcript levels were obtained by determining the ratio of 32P incorporated into the iNOS amplified product band to that for the reference gene, G3PDH (using the mean value of quadruplicate analyses). Bar graph represents the composite analysis of a series of transplantations per time subgroup (each analyzed in quadruplicate) (bottom). There was a significant increase in iNOS levels in cardiac transplant (or allograft) cDNA at days 3 (n=1), 7 (n=3), 14 (n=2), 28 (n=3), and 75 (n=3) (striped bars) after transplantation compared with paired host hearts (black bars) and a 14-day syngraft (P<.003). Data are plotted as mean±SEM for each subgroup and represent four separate polymerase chain reaction analyses.

To normalize for variations in RNA loading among cDNAs, we derived corrected transcript levels by taking the ratio of iNOS to G3PDH of the 32P incorporated into the bands for each cDNA. The bar graph in Fig 1Up (bottom) shows the corrected iNOS transcript levels for the entire series of transplants studied. In cardiac allografts, corrected iNOS transcript levels increased significantly by day 7 (but not at day 3) and were sustained through day 75 in comparison with paired host hearts, day-0 hearts, and day-14 Lewis-Lewis syngrafts (P<.003). The early and sustained increase in iNOS transcripts in this subgroup of 11 transplants is consistent with chronic alloimmune stimulation.

iNOS Gene Product in Cardiac Allografts
Having identified an increase in gene transcript levels for iNOS, we then immunostained samples from early and late cardiac allografts, paired host hearts, and syngrafts to identify the gene product and localize the cell expressing it. At all time points studied (7, 28, 75, and 120 days), iNOS staining localized predominantly to mononuclear inflammatory cells within the interstitial and perivascular spaces of cardiac allografts. There were few positive cells in host hearts and syngrafts. In scoring the number of iNOS-positive mononuclear cells per section, we found significant increases in 28-day allografts (mean, 681±59) compared with paired host hearts (26±9) or 14-day syngrafts (9±2) (P<.009). At the later time points, similar trends were identified with a large increase in iNOS-positive mononuclear cells in 120-day cardiac allografts (340±25) compared with 120-day syngrafts (10±5) (P=.006). The decrease in iNOS-positive cells between day 28 and day 120 followed the decline in mononuclear cell infiltration typical of older grafts.20

Double-staining studies confirmed that some of the mononuclear cells expressing iNOS were macrophages (Fig 2ADown), in that they also stained positive for the rat monocyte/macrophage marker ED-1. However, there were many large ED-1-negative but iNOS-positive mononuclear cells (Fig 2BDown), raising the possibility that they represent another inflammatory cell type (lymphocyte subset) or a distinct macrophage population in which ED-1 expression is downregulated or lost in concert with induction of iNOS expression. We have also found in propagated bone marrow macrophages immunostained after stimulation with IFN-{gamma} (for 24 hours) that a subset of cells were ED-1-negative but iNOS-positive (data not shown). At the same time, most of the control (unstimulated) bone marrow macrophages were ED-1-positive and iNOS-negative. Apparently, ED-1 expression can be downregulated by factors that induce iNOS expression.



View larger version (0K):
[in this window]
[in a new window]
 
Figure 2. Photomicrographs of expression of inducible nitric oxide synthase (iNOS) gene product in Lewis-F344 cardiac allografts. Immunostaining of paraffin sections of cardiac allografts was performed with a polyclonal rabbit antisera directed against the macrophage isoform of NOS. Immunostaining of a 28-day cardiac allograft localizes iNOS antigen (brown) predominantly to a subset of mononuclear cells in the perivascular spaces (A) (1040x) and interstitium (B) (950x). A, Double staining with ED-1 identifies monocytes/ macrophages (pink) and confirms that some iNOS-expressing cells are of macrophage origin (pink/brown) (arrowhead) as seen in the lumen of this small vessel, whereas others are not (arrow). B, There also is a subset of iNOS-positive mononuclear cells that do not stain with ED-1 (arrowheads) as well as monocytes/macrophages that do not express iNOS (arrow), demonstrating that only some subsets of mononuclear cells have upregulated iNOS expression. In older cardiac allografts (C and D), striking iNOS immunostaining was also seen in the media and deep neointima of some of the allograft vessels. C, Double staining for iNOS and von Willebrand factor in a small artery distinguishes the endothelium (pink) from the prominent iNOS staining (brown) in the medial and some of the neointimal cells (650x). D, In this larger vessel double stained for smooth muscle cell actin and iNOS, the media is identified by the pink-staining smooth muscle cells with many iNOS double-stained smooth muscle cells (arrowheads) (260x).

In 75- and 120-day cardiac allografts, there was prominent staining in a spectrum of vessels in addition to the mononuclear staining. Interestingly, only a subset of the vessels stained positive and did so in only a portion of media or in a subset of the neointimal cells. The vascular cell type expressing iNOS antigen was shown to be smooth muscle by a series of double-staining studies. Double staining for von Willebrand factor identified endothelial cells and showed that most of the iNOS-positive cells were located deep in the vessel within the medial and, occasionally, neointimal layers (Fig 2CUp). Double staining for smooth muscle cell actin and iNOS (Fig 2DUp) showed that most of the iNOS-positive cells in the vessels were also smooth muscle cell actin-positive. These cells were located primarily in the media and occasionally in the expanding neointima. In very small vessels, such as the arterioles, it was harder to distinguish whether the iNOS-positive cells were of smooth muscle or endothelial origin. Staining of occasional arterioles was present in all hearts (allografts, host, and syngrafts).

Effects of EFAD Diet on Cardiac Allografts
To determine whether the protective effects of the EFAD diet might be mediated through the iNOS pathway, we compared iNOS expression patterns, heart function (palpable beat), and arteriosclerotic characteristics (intimal thickening and number of diseased vessels) in cardiac allografts harvested early from rats fed the EFAD diet with those in allografts from rats fed a control diet. As seen in Fig 3Down, at day 7 there was no significant difference between the EFAD and control diet groups with respect to heart beat, intimal thickening grade, and percentage of diseased vessels. In contrast, at day 28 there was preservation of allograft function (Fig 3ADown), as evidenced by a heartbeat score of 4 in allografts from rats fed the EFAD diet versus a score of 2 in those from rats fed the control diet (P<.001, four per subgroup). A significant difference was also seen in the mean intimal thickening score (Fig 3BDown) in allografts from rats fed the EFAD diet (0.30±0) versus those from rats fed the control diet (0.79±0.1, P=.001, four per diet subgroup). The grades for intimal thickening ranged from 0 (normal) to 5 (compromise of more than 80%). A score of 1 was assigned when intimal thickening was visible in as much as 50% of the vessel perimeter and there was less than 20% luminal compromise.18 At the day-28 time point, there also was a significant difference in the percentage of diseased vessels in allografts from rats fed the EFAD diet (28% versus 53% for control diet, P=.008) (Fig 3CDown). These findings demonstrate that the EFAD diet had a significant antiarteriosclerotic effect even in the early stage (day 28) of chronic rejection, when the degree of arteriosclerotic development is small.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. Bar graphs of effects of essential fatty acid-deficient (EFAD) diet on cardiac allografts. Palpable heartbeat (A), intimal thickening (B), and percentage of diseased vessels (C) were graded in cardiac allografts harvested at days 7 and 28 from rats fed the control (black bars) and anti-inflammatory EFAD (striped bars) diet. At day 7, no significant differences were noted between the two diets for all three parameters. At day 28, for the EFAD diet, there was a significant increase in final heartbeat score (A) (P<.001) associated with a significant decrease in intimal thickening grade score (B) (P=.001) and the percentage of diseased vessels (C) (P=.008) compared with the control diet. Data are plotted as mean±SEM of four allografts analyzed in each group.

Fig 4Down shows an analysis of iNOS transcript levels in a subset of allograft cDNAs from rats fed one of the two diets. In Fig 4ADown, iNOS transcript levels were similar for the two groups at day 7 (two per diet subgroup). However, at day 28 there was a significant difference in iNOS cardiac allograft transcript levels between rats fed the EFAD diet (n=2) and those fed the control diet (n=3; P<.0001). iNOS transcript levels were higher in cardiac allografts compared with host hearts at both time points and on both diets (P<.0001).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 4. Bar graphs of effects of essential fatty acid-deficient (EFAD) diet on inducible nitric oxide synthase (INOS) expression. Cardiac allografts (left) and host hearts (right) from recipients fed either the antiinflammatory EFAD diet (striped bars) or the control diet (black bars) were harvested at 7 or 28 days. A, iNOS transcript levels were elevated in allografted hearts compared with host hearts on either diet. Although iNOS transcript levels did not differ between the two diets at 7 days (two per diet subgroup), there were significant decreases in iNOS levels for rats fed the EFAD diet (n=2) compared with the control diet (n=3) at 28 days (P<.0001). B. Cell counts of iNOS-positive mononuclear cells in sections from day-7 allografts were similar for the two diets. However, at day 28, iNOS-positive cells decreased significantly in the EFAD diet subgroup (n=2) compared with the control diet (n=3) (P=.0001). Positive cells in the host hearts were low in all subgroups. Data are plotted as mean±SEM.

Fig 4BUp shows the number of iNOS-positive mononuclear cells in heart sections from the 7- and 28-day time points. Again, no significant differences were detected at day 7 between the two diet groups (EFAD, 82±60; control, 88±10; two per diet subgroup). The lack of a significant difference in cell count between the two diet groups at this point may reflect the low level of cell infiltration and absence of intimal thickening typical of this stage. In contrast, at day 28 there was a significant difference in iNOS-positive mononuclear cell counts in sections from allografts from rats fed the EFAD diet (339±10) versus rats fed the control diet (689±92; P=.0001, two per diet subgroup). Immunostaining in these older allografts (from the EFAD and control diet groups) was also prominent within the media of some vessels (data not shown), although there was no significant difference in staining between the two diets. Thus, it appears that although the EFAD diet decreased the number of iNOS-positive macrophages infiltrating the heart, it did not have a significant effect on vascular iNOS expression.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowNote Added in Proof
down arrowReferences
 
In characterizing expression patterns for iNOS in our chronic rejection model of transplant arteriosclerosis, we have demonstrated that activated macrophages expressing iNOS are present as early as day 7 and persist through day 120, as might be expected with an ongoing inflammatory stimulus. In contrast, upregulation of the smooth muscle cell isoform in allograft vessels was not seen until the later stages of chronic rejection, suggesting that different inflammatory forces regulate this isoform.

Yang et al28 demonstrated that iNOS mRNA and protein increase at day 5 in acutely rejecting cardiac allografts. In their immunohistochemical analysis, iNOS staining was identified in the inflammatory infiltrate, in some microvascular endothelial cells, and at the periphery of myocytes. Our findings in chronically rejecting cardiac allografts disagree with those of the group of Yang et al in that we observed limited staining in microvascular endothelial cells and myocytes but striking staining in vascular smooth muscle cells. Possible explanations for the discordant observations include differences inherent in the acute and chronic rejection models, which would affect the cell types activated or the time course of activation. Alternatively, the antisera used in the two studies (which were generated from different peptide sequences) may selectively identify different isoforms. Between the two studies, there was concordance in the localization of iNOS staining to inflammatory cell types. The presence of iNOS-positive inflammatory cells in both acutely and chronically rejecting rat hearts implies that a subset of the infiltrating mononuclear cells has acquired an activation phenotype that parallels the phenotype in other inflammatory conditions.6 7 29 30 31 This correlation is important because data are limited regarding the characterization or phenotypes of macrophages involved in chronic rejection, a process in which an inflammatory response has been proposed to contribute to or even mediate the intimal changes.22 23 32 Clarification of the effector pathways present in chronically rejecting tissues could provide insight into the pathogenesis of transplant arteriosclerosis and how it might be ameliorated.

Given that the high-output nitric oxide pathway regulated by iNOS bestows many acquired functions to macrophages (killing of bacteria, viruses, parasites, and tumor cells), we have used iNOS expression as a measure of activation.4 5 With rats fed an EFAD diet, we have shown decreases in iNOS mRNA levels and iNOS-positive mononuclear cells in 28-day cardiac allografts coincident with preservation of heartbeat and reduction in arteriosclerotic changes. The basic mechanism underlying the anti-inflammatory effect of the EFAD diet involves defects in arachidonate metabolism that in turn alter leukotriene production, particularly that of the chemoattractant leukotriene B4, and affect various macrophage functions (trafficking, spreading, and adherence).33 34 35 The decrease in iNOS expression in cardiac allografts from rats fed the EFAD diet could be explained by a reduction in trafficking of inflammatory cells to the graft, or the diet may interfere with the actual activation of macrophages by cytokines. Regardless of the mechanism, the corresponding reduction in activated macrophages and intimal thickening in cardiac allografts from rats fed the EFAD diet provides support for the hypothesis that arteriosclerotic changes following transplantation are mediated by an inflammatory response involving cellular activation. The precise role of iNOS as an inflammatory mediator in noninfectious inflammation conditions, including chronic rejection, has yet to be elucidated. From recent in vitro studies, one can conceive of direct effects through nitric oxide produced by the inflamed tissue or indirect effects in which nitric oxide acts as an intermediary (in association with nitrosylation, ADP ribosylation, or free radical formation) in the production of other mediators that regulate cytotoxicity, chemotaxis, and proliferation.1

In the later stages of chronic cardiac rejection (75 and 120 days), we found a striking increase in iNOS staining within a spectrum of allograft vessels (ranging from the epicardial to the arteriole) not seen at earlier time points. Although endothelial staining for NOS has been reported in some vessels, there are few reports documenting vascular smooth muscle cell iNOS immunopositivity.8 36 37 The present study provides direct evidence that smooth muscle cell NOS can be induced in vivo under conditions of inflammatory stimulation. Unexplained is the focal nature of the smooth muscle cell staining, which does not appear to correlate with specific locations within the heart, regional inflammation, degree of intimal thickening, or type of diet. One potential explanation is that the smooth muscle cell population may react in a heterogeneous or focal manner similar to that seen in transplanted hearts with inflammatory infiltrates, which are patchy.20 The inductive stimuli may be transient or cyclic and may reflect local variations in the vessel wall related to hemodynamic or inflammatory influences that vary cytokine production.

The upregulation of smooth muscle cell iNOS in a subset of arteries in our model of transplant arteriosclerosis is intriguing and raises the question of whether it suppresses or promotes intimal thickening. In the context of the vessel, nitric oxide is considered an antiatherogenic molecule on the basis of rat and rabbit studies with L-arginine (used to enhance nitric oxide production) that show reduced arteriosclerotic or neointimal thickening in injured vessels.38 39 This view is corroborated by recent studies with NOS antagonists (used to decrease nitric oxide production) that have shown increases in neointimal formation.14 15 However, in these reports, the regulatory role of specific NOS isoforms was not studied. It may be that the endothelial, macrophage, and smooth muscle cell isoforms are regulated independently and have distinct end effects. One can speculate also that in the transplanted heart (where the allogeneic stimulus is chronic), the antiarteriosclerotic effects of nitric oxide in the vessel may be outweighed by proarteriosclerotic forces in the allografted organ, such as PDGF-ß-driven smooth muscle cell migration. The late appearance of iNOS in allograft vessels may be a compensatory measure to inhibit further vascular remodeling when the vessel reaches a quiescent state. Of course, regulation of nitric oxide and the various NOS isoforms may be quite different in these animal models of arteriosclerosis given the specific vessel types, modes of injury or underlying stimuli (allogeneic versus hypercholesterolemic), and strains under investigation.

The identification of subpopulations of mononuclear and smooth muscle cells expressing an inducible factor implies that they have acquired an "activated" phenotype in response to allogeneic stimulation after transplantation. Further studies in which the iNOS pathway is disrupted at specific points will be required to determine the roles of the various iNOS isoforms in mediating the inflammatory response of the vessel wall and the neointimal thickening associated with chronic cardiac rejection.


*    Note Added in Proof
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*Note Added in Proof
down arrowReferences
 
Since the acceptance of this article, we have used a rabbit polyclonal anti-mouse macrophage NOS antibody (1:100; kindly provided by Dr Charles J. Lowenstein36 ) to confirm the immunohistochemical staining of mononuclear cells and vascular smooth muscle cells only in late grafts.


*    Acknowledgments
 
This work was supported in part by a grant from Bristol-Myers Squibb and by National Institutes of Health grants HL-43318 and HL-17747. We are grateful to Qiao-wen Xie and Carl Nathan for their ongoing interest, helpful discussions, and provision of the antisera and to Jeffrey R. Weidner and Richard A. Mumford (Merck Sharp & Dhome Laboratories), who developed the sera. We thank Arthur Lee and Mark Perrella for their early suggestions in the project and Ulrike Utans for help and support.

Received December 19, 1994; accepted January 17, 1995.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
up arrowNote Added in Proof
*References
 
1. Nathan C. Nitric oxide as a secretory product of mammalian cells. FASEB J. 1992;6:3051-3064. [Abstract]

2. Xie QW, Cho HJ, Calaycay J, Mumford RA, Swiderek KM, Lee TD, Ding A, Troso T, Nathan C. Cloning and characterization of inducible nitric oxide synthase from mouse macrophages. Science. 1992;256:225-228. [Abstract/Free Full Text]

3. Moncada S, Higgs A. The L-arginine-nitric oxide pathway. N Engl J Med. 1993;329:2002-2012. [Free Full Text]

4. Nussler AK, Billiar TR. Inflammation, immunoregulation, and inducible nitric oxide synthase. J Leukoc Biol. 1993;54:171-178. [Abstract]

5. Lorsbach RB, Murphy WJ, Lowenstein CJ, Snyder SH, Russell SW. Expression of the nitric oxide synthase gene in mouse macrophages activated for tumor cell killing: molecular basis for the synergy between interferon-gamma and lipopolysaccharide. J Biol Chem. 1993;268:1908-1913. [Abstract/Free Full Text]

6. McCartney FN, Allen JB, Mizel DE, Albina JE, Xie QW, Nathan CF, Wahl SM. Suppression of arthritis by an inhibitor of nitric oxide synthase. J Exp Med. 1993;178:749-754. [Abstract/Free Full Text]

7. Weinberg JB, Granger DL, Pisetsky DS, Seldin MF, Misukonis MA, Mason SN, Pippen AM, Ruiz P, Wood ER, Gilkeson GS. The role of nitric oxide in the pathogenesis of spontaneous murine autoimmune disease: increased nitric oxide production and nitric oxide synthase expression in MRL-lpr/lpr mice, and reduction of spontaneous glomerulonephritis and arthritis by orally administered NG-monomethyl-L-arginine. J Exp Med. 1994;179:651-660. [Abstract/Free Full Text]

8. Forstermann U, Closs EI, Pollock JS, Nakane M, Schwarz P, Gath I, Kleinert H. Nitric oxide synthase isozymes: characterization, purification, molecular cloning, and functions. Hypertension. 1994;1121-1131.

9. Lamas S, Michel T, Collins T, Brenner BM, Marsden PA. Effects of interferon-gamma on nitric oxide synthase activity and endothelin-1 production by vascular endothelial cells. J Clin Invest. 1992;90:879-887.

10. Sirsjo A, Soderkvist P, Sundqvist T, Carlsson M, Ost M, Gidlof A. Different induction mechanisms of mRNA for inducible nitric oxide synthase in rat smooth muscle cells in culture and in aortic strips. FEBS Lett. 1994;338:191-196. [Medline] [Order article via Infotrieve]

11. Lefer AM, Ma X-L. Decreased basal nitric oxide release in hypercholesterolemia increases neutrophil adherence to rabbit coronary artery endothelium. Arterioscler Thromb. 1993;13:771-776. [Abstract/Free Full Text]

12. Wang B-Y, Singer AH, Tsao PS, Drexler H, Kosek J, Cooke JP. Dietary arginine prevents atherogenesis in the coronary artery of the hypercholesterolemic rabbit. J Am Coll Cardiol. 1994;23:452-458. [Abstract]

13. Tsao PS, McEvoy LM, Drexler H, Butcher EC, Cooke JP. Enhanced endothelial adhesiveness in hypercholesterolemia is attenuated by L-arginine. Circulation. 1994;89:2176-2182. [Abstract/Free Full Text]

14. Naruse K, Shimizu K, Muramatsu M, Toki Y, Miyazaki Y, Okumura K, Hashimoto H, Ito T. Long-term inhibition of nitric oxide synthesis promotes atherosclerosis in the hypercholesterolemic rabbit thoracic aorta. Arterioscler Thromb. 1994;14:746-752. [Abstract/Free Full Text]

15. Cayette AJ, Palacino JJ, Horton K, Cohen RA. Chronic inhibition of nitric oxide production accelerates neointima formation and impairs endothelial function in hypercholesterolemic rabbits. Arterioscler Thromb. 1994;14:753-759. [Abstract/Free Full Text]

16. Drexler H, Fischell TA, Pinto FJ, Chenzbraun A, Botas J, Cooke JP, Alderman EL. Effect of L-arginine on coronary endothelial function in cardiac transplant recipients: relation to vessel wall morphology. Circulation. 1994;89:1615-1623. [Abstract/Free Full Text]

17. Schoen FJ, Libby P. Cardiac transplant graft arteriosclerosis. Trends Cardiovasc Med. 1991;1:216-223.

18. Adams DH, Tilney NL, Collins JJ, Karnovsky MJ. Experimental graft arteriosclerosis, I: the Lewis-to-F-344 allograft model. Transplantation. 1992;53:1115-1119. [Medline] [Order article via Infotrieve]

19. Cramer DV, Wu GD, Chapman FA, Cajulis E, Wang HK, Makowka L. Lymphocytic subsets and histopathologic changes associated with the development of heart transplant arteriosclerosis. J Heart Lung Transplant. 1992;458-466.

20. Adams DH, Wyner LR, Karnovsky MJ. Experimental graft arteriosclerosis, II: immunocytochemical analysis of lesion development. Transplantation. 1993;56:794-799. [Medline] [Order article via Infotrieve]

21. Higgy NA, Davidoff AW, Grothman GT, Hollenberg MD, Benediktsson H, Paul LC. Expression of platelet-derived growth factor receptor in rat heart allografts. J Heart Lung Transplant. 1991;10:1012-1022. [Medline] [Order article via Infotrieve]

22. Russell ME, Adams DH, Wyner LR, Yamashita Y, Halnon NJ, Karnovsky MJ. Early and persistent induction of monocyte chemoattractant protein 1 in rat cardiac allografts. Proc Natl Acad Sci U S A. 1993;90:6086-6090. [Abstract/Free Full Text]

23. Russell ME, Wallace AF, Hancock WW, Sayegh MH, Adams DH, Sibinga NES, Wyner LR, Karnovsky MJ. Upregulation of cytokines associated with macrophage activation in the Lewis to F344 rat chronic cardiac rejection model. Transplantation. 1995;59:572-578. [Medline] [Order article via Infotrieve]

24. Russell ME, Utans U, Wallace AF, Liang P, Arceci RJ, Karnovsky MJ, Wyner LR, Yamashita Y, Tarn C. Identification and upregulation of galactose/N-acetylgalactosamine macrophage lectin in rat cardiac allografts with arteriosclerosis. J Clin Invest. 1994;94:722-730.

25. Nunokawa Y, Ishida N, Tanaka S. Cloning of inducible nitric oxide synthase in rat vascular smooth muscle cells. Biochem Biophys Res Commun. 1993;191:89-94. [Medline] [Order article via Infotrieve]

26. Snedecor GW, Cochran WG. Statistical Methods, 6th ed. Ames, Iowa: Iowa State University Press; 1967:339-380.

27. Adams DH, Wyner LR, Steinbeck MJ, Karnovsky MJ. Inhibition of graft arteriosclerosis by modulation of the inflammatory response. Transplant Proc. 1993;25:2092-2094. [Medline] [Order article via Infotrieve]

28. Yang X, Chowdhury N, Cai B, Brett J, Marboe C, Sciacca RR, Michler RE, Cannon PJ. Induction of myocardial nitric oxide synthase by cardiac allograft rejection. J Clin Invest. 1994;94:714-721.

29. Langrehr JM, Murase N, Markus PM, Cai X, Neuhaus P, Schraut W, Simmons RL, Hoffman RA. Nitric oxide production in host-versus-graft and graft-versus-host reactions in the rat. J Clin Invest. 1992;90:679-683.

30. Lancaster JJ, Langrehr JM, Bergonia HA, Murase N, Simmons RL, Hoffman RA. EPR detection of heme and nonheme iron-containing protein nitrosylation by nitric oxide during rejection of rat heart allograft. J Biol Chem. 1992;267:10994-10998. [Abstract/Free Full Text]

31. Koprowski H, Zheng YM, Heber KE, Fraser N, Rorke L, Fu ZF, Hanlon C, Dietzschold B. In vivo expression of inducible nitric oxide synthase in experimentally induced neurologic diseases. Proc Natl Acad Sci U S A. 1993;90:3024-3027. [Abstract/Free Full Text]

32. Paul LC, Grothman GT, Benediktsson H, Davidoff A, Rozing J. Macrophage subpopulations in normal and transplanted heart and kidney tissues in the rat. Transplantation. 1992;53:157-162. [Medline] [Order article via Infotrieve]

33. Lefkowith JB, Jakschik BA, Stahl P, Needleman P. Metabolic and functional alterations in macrophages induced by essential fatty acid deficiency. J Biol Chem. 1987;262:6668-6675. [Abstract/Free Full Text]

34. Rovin BH, Lefkowith JB, Schreiner GF. Mechanisms underlying the anti-inflammatory effects of essential fatty acid deficiency in experimental glomerulonephritis: inhibited release of a monocyte chemoattractant by glomeruli. J Immunol. 1990;145:1238-1245. [Abstract]

35. Lefkowith JB, Rogers M, Lennartz MR, Brown EJ. Essential fatty acid deficiency impairs macrophage spreading and adherence: role of arachidonate in cell adhesion. J Biol Chem. 1991;266:1071-1076. [Abstract/Free Full Text]

36. Kobzik L, Bredt DS, Lowenstein CJ, Drazen J, Gaston B, Sugarbaker D, Stamler JS. Nitric oxide synthase in human and rat lung: immunocytochemical and histochemical localization. Am J Respir Cell Mol Biol. 1993;9:371-377.

37. Ursell PC, Mayes M. The majority of nitric oxide synthase in pig heart is vascular and not neural. Cardiovasc Res. 1993;27:1920-1924. [Abstract/Free Full Text]

38. Cooke JP, Singer AH, Tsao P, Zera P, Rowan RA, Billingham ME. Antiatherogenic effects of L-arginine in the hypercholesterolemic rabbit. J Clin Invest. 1992;90:1168-1172.

39. McNamara DB, Bedi B, Aurora H, Tena L, Ignarro LJ, Kadowitz PJ, Akers DL. L-Arginine inhibits balloon catheter-induced intimal hyperplasia. Biochem Biophys Res Commun. 1993;193:291-296.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T. Hasegawa, K. Iwanaga, D. E. Hultquist, H. Liao, S. H. Visovatti, and D. J. Pinsky
Suppression of nitrosative and oxidative stress to reduce cardiac allograft vasculopathy
Am J Physiol Heart Circ Physiol, April 1, 2009; 296(4): H1007 - H1016.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
K. Minamoto and D. J. Pinsky
Recipient iNOS but Not eNOS Deficiency Reduces Luminal Narrowing in Tracheal Allografts
J. Exp. Med., November 18, 2002; 196(10): 1321 - 1333.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. J. Szabolcs, J. Sun, N. Ma, A. Albala, R. R. Sciacca, G. B. Philips, J. Parkinson, N. Edwards, and P. J. Cannon
Effects of Selective Inhibitors of Nitric Oxide Synthase-2 Dimerization on Acute Cardiac Allograft Rejection
Circulation, October 29, 2002; 106(18): 2392 - 2396.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
S Chowdhary, D Harrington, R S Bonser, J H Coote, and J N Townend
Chronotropic effects of nitric oxide in the denervated human heart
J. Physiol., June 1, 2002; 541(2): 645 - 651.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
H. Takano, R. Yanagisawa, T. Ichinose, K. Sadakane, S. Yoshino, T. Yoshikawa, and M. Morita
Diesel Exhaust Particles Enhance Lung Injury Related to Bacterial Endotoxin through Expression of Proinflammatory Cytokines, Chemokines, and Intercellular Adhesion Molecule-1
Am. J. Respir. Crit. Care Med., May 1, 2002; 165(9): 1329 - 1335.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Z. Qian, R. Gelzer-Bell, S.-x. Yang, W. Cao, T. Ohnishi, B. A. Wasowska, R. H. Hruban, E. R. Rodriguez, W. M. Baldwin III, and C. J. Lowenstein
Inducible Nitric Oxide Synthase Inhibition of Weibel-Palade Body Release in Cardiac Transplant Rejection
Circulation, November 6, 2001; 104(19): 2369 - 2375.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. M. Wildhirt, M. Weis, C. Schulze, N. Conrad, S. Pehlivanli, G. Rieder, G. Enders, W. von Scheidt, and B. Reichart
Expression of Endomyocardial Nitric Oxide Synthase and Coronary Endothelial Function in Human Cardiac Allografts
Circulation, September 18, 2001; 104 (2009): I-336 - I-343.
[Abstract] [Full Text] [PDF]


Home page
Eur. J. Cardiothorac. Surg.Home page
S. M. Wildhirt, M. Weis, C. Schulze, N. Conrad, S. Pehlivanli, G. Rieder, G. Enders, W. von Scheidt, and B. Reichart
Coronary flow reserve and nitric oxide synthases after cardiac transplantation in humans
Eur. J. Cardiothorac. Surg., June 1, 2001; 19(6): 840 - 847.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. J. Szabolcs, N. Ma, E. Athan, J. Zhong, M. Ming, R. R. Sciacca, J. Husemann, A. Albala, and P. J. Cannon
Acute Cardiac Allograft Rejection in Nitric Oxide Synthase-2-/- and Nitric Oxide Synthase-2+/+ Mice : Effects of Cellular Chimeras on Myocardial Inflammation and Cardiomyocyte Damage and Apoptosis
Circulation, May 22, 2001; 103(20): 2514 - 2520.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. Fukada, S. Schena, I. Tack, P. Ruiz, Y. Kurimoto, M. Pang, A. Aitouche, T. Abe, L. J. Striker, and S. M. Pham
FK409, a Spontaneous Nitric Oxide Releaser, Attenuates Allograft Vasculopathy in a Rat Aortic Transplant Model
Circ. Res., July 7, 2000; 87(1): 66 - 72.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. L. Skarsgard, X. Wang, P. McDonald, A. H. Lui, E. K. Lam, B. M. McManus, C. van Breemen, and I. Laher
Profound Inhibition of Myogenic Tone in Rat Cardiac Allografts Is Due to eNOS- and iNOS-Based Nitric Oxide and an Intrinsic Defect in Vascular Smooth Muscle Contraction
Circulation, March 21, 2000; 101(11): 1303 - 1310.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
X. Yang, N. Ma, M. J. Szabolcs, J. Zhong, E. Athan, R. R. Sciacca, R. E. Michler, G. D. Anderson, J. F. Wiese, K. M. Leahy, et al.
Upregulation of COX-2 During Cardiac Allograft Rejection
Circulation, February 1, 2000; 101(4): 430 - 438.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. M Shah
Inducible nitric oxide synthase and cardiovascular disease
Cardiovasc Res, January 1, 2000; 45(1): 148 - 155.
[Full Text] [PDF]


Home page
Circ. Res.Home page
K.-Y. Chyu, P. Dimayuga, J. Zhu, J. Nilsson, S. Kaul, P. K. Shah, and B. Cercek
Decreased Neointimal Thickening After Arterial Wall Injury in Inducible Nitric Oxide Synthase Knockout Mice
Circ. Res., December 3, 1999; 85(12): 1192 - 1198.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Kibbe, T. Billiar, and E. Tzeng
Inducible nitric oxide synthase and vascular injury
Cardiovasc Res, August 15, 1999; 43(3): 650 - 657.
[Abstract] [Full Text] [PDF]


Home page
Eur. J. Cardiothorac. Surg.Home page
K. M. Vural, M. C. Oz, H. Liao, H. F. Batirel, and D. J. Pinsky
Membrane stabilization in harvested vein graft storage: effects on adhesion molecule expression and nitric oxide synthesis
Eur. J. Cardiothorac. Surg., August 1, 1999; 16(2): 150 - 155.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
C. A. E. MASON, P. CHANG, C. FALLERY, and M. RABINOVITCH
Nitric oxide mediates LC-3-dependent regulation of fibronectin in ductus arteriosus intimal cushion formation
FASEB J, August 1, 1999; 13(11): 1423 - 1434.
[Abstract] [Full Text]


Home page
CirculationHome page
J. Koglin, D. J. Granville, T. Glysing-Jensen, J. S. Mudgett, C. M. Carthy, B. M. McManus, and M. E. Russell
Attenuated Acute Cardiac Rejection in NOS2 -/- Recipients Correlates With Reduced Apoptosis
Circulation, February 16, 1999; 99(6): 836 - 842.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. M. Stamm, A. Raisanen-Sokolowski, M. Okano, M. E. Russell, J. R. David, and A. R. Satoskar
Mice with STAT6-Targeted Gene Disruption Develop a Th1 Response and Control Cutaneous Leishmaniasis
J. Immunol., December 1, 1998; 161(11): 6180 - 6188.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. L. Hale and R. A. Kloner
Myocardial temperature reduction attenuates necrosis after prolonged ischemia in rabbits
Cardiovasc Res, December 1, 1998; 40(3): 502 - 507.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. Koglin, T. Glysing-Jensen, J. S. Mudgett, and M. E. Russell
NOS2 Mediates Opposing Effects in Models of Acute and Chronic Cardiac Rejection : Insights from NOS2-Knockout Mice
Am. J. Pathol., November 1, 1998; 153(5): 1371 - 1376.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. Raisanen-Sokolowski, T. Glysing-Jensen, and M. E. Russell
Leukocyte-Suppressing Influences of Interleukin (IL)-10 in Cardiac Allografts : Insights from IL-10 Knockout Mice
Am. J. Pathol., November 1, 1998; 153(5): 1491 - 1500.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H.-B. Peng, M. Spiecker, and J. K. Liao
Inducible Nitric Oxide: An Autoregulatory Feedback Inhibitor of Vascular Inflammation
J. Immunol., August 15, 1998; 161(4): 1970 - 1976.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. Ravalli, A. Albala, M. Ming, M. Szabolcs, A. Barbone, R. E. Michler, and P. J. Cannon
Inducible Nitric Oxide Synthase Expression in Smooth Muscle Cells and Macrophages of Human Transplant Coronary Artery Disease
Circulation, June 16, 1998; 97(23): 2338 - 2345.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J o. Koglin, T. Glysing-Jensen, J. S. Mudgett, and M. E. Russell
Exacerbated Transplant Arteriosclerosis in Inducible Nitric Oxide–Deficient Mice
Circulation, May 26, 1998; 97(20): 2059 - 2065.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
P. J. Cannon, X. Yang, M. J. Szabolcs, S. Ravalli, R. R. Sciacca, and R. E. Michler
The role of inducible nitric oxide synthase in cardiac allograft rejection
Cardiovasc Res, April 1, 1998; 38(1): 6 - 15.
[Full Text] [PDF]


Home page
CirculationHome page
W. J. Paulus, S. Kastner, P. Pujadas, A. M. Shah, H. Drexler, and M. Vanderheyden
Left Ventricular Contractile Effects of Inducible Nitric Oxide Synthase in the Human Allograft
Circulation, November 18, 1997; 96(10): 3436 - 3442.
[Abstract] [Full Text]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Raisanen-Sokolowski, T. Glysing-Jensen, P. L. Mottram, and M. E Russell
Sustained Anti-CD4/CD8 Treatment Blocks Inflammatory Activation and Intimal Thickening in Mouse Heart Allografts
Arterioscler Thromb Vasc Biol, October 1, 1997; 17(10): 2115 - 2122.
[Abstract] [Full Text]


Home page
CirculationHome page
M. Weis and W. von Scheidt
Cardiac Allograft Vasculopathy : A Review
Circulation, September 16, 1997; 96(6): 2069 - 2077.
[Abstract] [Full Text]


Home page
CirculationHome page
S. M. Wildhirt, H. Suzuki, D. Horstman, S. Weismuller, R. R. Dudek, K. Akiyama, and B. Reichart
Selective Modulation of Inducible Nitric Oxide Synthase Isozyme in Myocardial Infarction
Circulation, September 2, 1997; 96(5): 1616 - 1623.
[Abstract] [Full Text]


Home page
Circ. Res.Home page
R. A. Kelly, J.-L. Balligand, and T. W. Smith
Nitric Oxide and Cardiac Function
Circ. Res., September 1, 1996; 79(3): 363 - 380.
[Full Text]


Home page
Circ. Res.Home page
N. K. Worrall, K. Chang, G. M. Suau, W. S. Allison, T. P. Misko, P. M. Sullivan, R. G. Tilton, J. R. Williamson, and T. B. Ferguson Jr
Inhibition of Inducible Nitric Oxide Synthase Prevents Myocardial and Systemic Vascular Barrier Dysfunction During Early Cardiac Allograft Rejection
Circ. Res., May 1, 1996; 78(5): 769 - 779.
[Abstract] [Full Text]


Home page
Circ. Res.Home page
C. A. E. O'Blenes, C. Kinnear, and M. Rabinovitch
Tumor Necrosis Factor-{alpha} Induces Fibronectin Synthesis in Coronary Artery Smooth Muscle Cells by a Nitric Oxide-Dependent Posttranscriptional Mechanism
Circ. Res., July 6, 2001; 89(1): 26 - 32.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Russell, M. E.
Right arrow Articles by Karnovsky, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Russell, M. E.
Right arrow Articles by Karnovsky, M. J.