(Circulation. 1995;91:962-967.)
© 1995 American Heart Association, Inc.
Articles |
Lys, Associated With Autosomal Dominant Cardiac Amyloidosis in an Italian Family
From the Immunological Medicine Unit (D.R.B., S.Y.T., P.N.H., M.B.P), Department of Medicine, Royal Postgraduate Medical School, Hammersmith Hospital, London, UK; and the Istituto di Cardiologia (A.F.), Universita Cattolica del S Cuore, Rome, Italy.
| Abstract |
|---|
|
|
|---|
Methods and Results Seven members in two generations of an Italian family presented with cardiac disease inherited as an autosomal dominant and were found to have systemic amyloidosis. Angina pectorislike pain, an unusual feature in cardiac amyloidosis, was a prominent symptom, possibly related to partial obliteration of the distal coronary arteries by amyloid infiltration. There were also cases of sudden cardiac death. Peripheral and autonomic neuropathy, which are the usual features of hereditary amyloidosis, were present in only two cases, and a diagnosis of acquired, immunoglobulin light chain (AL type) amyloidosis was suspected in the index case before the family history emerged. In fact, the amyloid fibrils were composed of transthyretin, and the two affected individuals from whom DNA was available were both heterozygotes for a single base change in exon 3 of the transthyretin gene, encoding substitution of Lys for the wild-type Thr residue at position 59 in the mature protein. This mutation has not previously been reported.
Conclusions We have identified a novel mutation in the
transthyretin gene encoding 59Thr
Lys associated with
autosomal dominant hereditary systemic amyloidosis in an Italian
kindred in whom cardiac involvement was the major feature. This family
illustrates the difficulty in diagnosis of cardiac amyloid, the
variable clinical phenotype in hereditary amyloidosis even within a
family, and the importance of precise fibril typing for correct
management in this condition.
Key Words: amyloid cardiomyopathy genes proteins
| Introduction |
|---|
|
|
|---|
Clinically significant acquired cardiac amyloidosis is usually of AL (formerly known as primary) type, in which the amyloid fibril protein is derived from monoclonal immunoglobulin light chains.1 2 Although so-called senile cardiac amyloid, in which normal wild-type transthyretin (TTR) is the fibril protein, is very common in the elderly, it is rarely symptomatic.1 4 Hereditary cardiac amyloidosis presents from the third decade on and usually occurs in the context of familial amyloid polyneuropathy (FAP),1 5 associated with peripheral and autonomic neuropathy, which dominate the clinical picture, although there are families in which cardiac involvement has been the major or only clinical feature. The amyloid fibril protein in most kindreds with FAP is derived from variant TTR. In each family, the variant contains a single amino acid substitution encoded by a point mutation in the TTR gene, and more than 40 such mutations, inherited in an autosomal dominant pattern, have been identified.2 6
We report on an Italian family with a new variant of TTR associated with hereditary amyloidosis and a predominantly cardiac presentation. Interestingly, the clinical features in several of the affected individuals strongly suggested ischemic heart disease. This family illustrates the diverse phenotypic expression of amyloidogenic mutations and underscores the importance of early diagnosis in cardiac amyloidosis.
| Methods |
|---|
|
|
|---|
Histology
Tissue was available from each case, obtained
during life in
four and at autopsy in the remainder. Myocardial tissue was studied in
six cases, rectum tissue in two, and small intestine and sural nerve
tissue in one case each. Amyloid was identified by Congo red staining
with pathognomonic green birefringence when viewed under crossed
polarized light.7
Immunohistochemical Staining
For detection of TTR, sections
were first incubated with 1% w/v
sodium-m-periodate for 10 minutes, 0.1% w/v sodium
borohydride for 10 minutes, and then overnight with 6 mol/L guanidine
hydrochloride in 0.9% w/v NaCl, to enhance immunoreactivity. After
washing with saline nonspecific binding was blocked by incubation
with 10% (v/v) normal nonimmune goat serum in 10 mmol/L
Tris-buffered saline (TBS) for 60 minutes at room temperature. Sections
were then incubated overnight at 4°C with specific polyclonal rabbit
anti-human TTR antibodies (Dako Ltd) diluted 1:400 in TBS containing
1% (v/v) normal goat serum. Specificity of staining was established by
reacting adjacent serial sections with the same dilution of antiserum
previously absorbed with pure human TTR to remove all anti-TTR
activity. After these primary reagents, the slides were washed on a
rotating platform, twice with TBS containing Triton X-100 (BDH
Laboratory Supplies) 0.005% (v/v) and once with TBS alone before
incubation for 60 minutes at room temperature with polyclonal goat
anti-rabbit antiserum (ICN Biochemicals Ltd) 1:50 in 5% (v/v) normal
human serum. The washing as detailed above was repeated, and sections
were then incubated at room temperature for 60 minutes with rabbit
peroxidaseanti-peroxidase complexes (PAP) (Serotec Ltd) 1:50 with 1%
(v/v) normal goat serum in TBS. After another wash cycle to remove
unbound rabbit PAP, bound enzyme was detected using
3,3'-diaminobenzidine tetrahydrochloride (Sigma Chemical Co Ltd)
0.05% (w/v) in TBS containing 10 mmol/L imidazole (BDH Laboratory
Supplies), and 0.002% (v/v) H2O2 (Taab
Laboratory Equipment Ltd) as substrate. Separate sections were stained
using antisera against other known amyloid fibril proteins:
and
immunoglobulin light chains, amyloid A protein, apolipoprotein A-I, and
lysozyme.
Radiolabeled SAP Scintigraphy and Turnover Studies
Whole-body
scintigraphic imaging and a 24-hour plasma turnover
study were performed in one patient (III.4) using
123I-labeled serum amyloid P component (SAP), as previously
described.8 9 Briefly, anterior and posterior
whole-body
scans and regional images were obtained with an IGE Starcam gamma
camera 24 hours after intravenous injection of 123I-labeled
SAP (200 MBq of activity associated with 100 µg of pure protein). The
decline of radioactivity was measured in the plasma over 24 hours, and
activity was also estimated in the complete collection of urine
obtained for 24 hours after isotope administration.
Isolation of DNA and Amplification and Sequencing of TTR Gene
DNA was extracted from whole blood,10 and TTR exons
were amplified by the polymerase chain reaction (PCR) using
taq polymerase (Amplitaq, Perkin Elmer Cetus) with the
following cycling conditions: 1 cycle of 94°C, 5 minutes; 35 cycles
of 94°C for 1 minute, 60°C for 1 minute, and 72°C for 1 minute;
and a final step of 72°C for 10 minutes. The reaction mixture was 10
mmol/L Tris, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.1% v/v
Triton X100 (pH 8.8) containing 160 mmol/L dNTP, 200 ng of each primer,
2.5 units polymerase, and 10 µL of DNA template in a final volume of
100 µL. For exon 1, the primers were the intron sequences (5' to
3');
CAGCAGGTTTGCAGTCAGAT and GGTACCCTTGCCCTAGTAAT; for exon 2,
CAATTTTGTTAACTTCTCACG and CAGATGATGTGAGCCTCTCTC; for exon 3,
CCTCCATGCGTAACTTAATCC and TAGGACATTTCTGTGGTACAC; and for exon 4,
TGGTGGAAATGGATCTGTCTG and TGGAAGGGACAATAAGGGAAT.
PCR products (100 µL) were purified by size fractionation on a Nusieve agarose gel (FMC, Rockland, ME). The band was extracted using Magiprep columns (Promega) recovered by ethanol precipitation and dissolved in 12 µL of distilled water. Six microliters were then used in the sequencing reaction for each primer.
The sequencing reaction was modified from the method of Casanova et al.11 A reaction mix containing 2 µL of sequencing buffer, 2 µL of primer (100 ng/µL), and 6 µL of template was boiled for 2 minutes before being frozen in a dry icemethanol bath for 15 seconds, and then 5 µL of Mastermix was added. Just after the mixture thawed, 3 µL was added to 2.5 µL of each of the four dideoxynucleotides, and the termination reaction was then incubated at 37°C for 2 minutes before the addition of 4 µL of stop solution. The same primers were used for PCR and sequencing, except that for exon 4, the primer (5'-3') CTCGTCCTTCAGGTCCACTG was used because, for unknown reasons, poor sequence was obtained with the exon 4 PCR downstream primer.
| Results |
|---|
|
|
|---|
|
|
|
Evidence of clinically significant amyloid
deposition outside the heart
was apparent at presentation in only one patient (Table
,
patient
III.5), in whom there were neuropathic features typical of FAP.
Autonomic and peripheral neuropathy developed 2 years after
presentation in only one other patient (III.3). No patient had
clinical evidence of nephropathy.
Histology and Immunohistochemistry
Congo red stains confirmed
the presence of abundant amyloid
deposits in all biopsy specimens from each of the seven patients.
Cardiac histology was similar in each patient and showed regularly
arranged muscle fibers exhibiting hypertrophy or atrophy. There was
some interstitial fibrosis and very extensive amyloid deposition. The
intramyocardial arteries were also heavily infiltrated with amyloid,
causing significant luminal narrowing in some areas. The abundant
congophilic amyloid deposits in myocardial and rectal biopsy tissue
from patient III.5 reacted strongly with an antiserum to TTR (Fig
3
) but not with antisera to other known amyloid fibril
proteins. The TTR immunoreactivity was completely abolished by prior
absorption of the antiserum with pure TTR (Fig 3
).
|
Radiolabeled SAP Studies
123I-SAP scintigraphy in
patient III.4 demonstrated
the presence of unsuspected amyloid deposits in the spleen and both
kidneys. Plasma and whole-body turnover of the tracer fell within our
reference range for normal subjects,12 indicating that
less than 10% of the activity had localized to amyloid, consistent
with a relatively modest whole-body amyloid load.
Characterization of the TTR Gene
Amplification and direct
sequencing of all four exons of the TTR
gene13 in patients III.3 and III.4 showed that they were
heterozygotes with a single base change in one allele, altering the
codon for residue 59 of the native protein from ACA (Thr) to AAA (Lys)
(Fig 4
). The remainder of the sequence was normal in
both alleles.
|
| Discussion |
|---|
|
|
|---|
-helix, eight
ß-strands forming two face-to-face sheets, and their connecting
loops.14 Mutations in ß-strand C, the CD loop, and
ß-strand D region are particularly likely to be
amyloidogenic.15 59Thr is situated in this
part of the molecule and is highly conserved in mammalian and avian TTR
sequences,16 suggesting that it is important for the
molecular structure and/or function of TTR. Displacement within the CD
loop and D strand, which may be induced even by quite distant
substitutions, has been proposed as the final common pathway for TTR
fibrillogenesis via aggregation of edge ß-strands.15
Hereditary TTR amyloidosis usually presents as FAP with peripheral
and autonomic neuropathy dominating the clinical picture, although the
amyloid is always systemic and symptomatic involvement of the heart and
kidneys is common. However, six TTR variants (45Thr,
60Ala, 68Leu, 89Gln,
111Met, and 122Ile) have been reported in
association with predominantly cardiac amyloid and minimal signs
elsewhere.17 The clinical features of affected members of
the present family were very diverse (Table
), with amyloid
involvement of different organ systems and at ages between the fifth
and the seventh decade. One subject, III.5, presented with severe
neuropathic features identical to those typically seen in FAP, and
similar features developed in her brother, subject III.3, 2 years after
he had presented with cardiac disease. The factors, other than the
TTR mutation itself, which govern the penetrance, age of onset, and
tissue distribution of amyloidosis associated with variant TTR are
unknown.
A prominent feature among patients in this family was chest pain, with the characteristic quality of angina pectoris. This is an unusual symptom of cardiac amyloidosis, although it has been described before, and its basis is probably multifactorial. Increased ventricular wall tension during diastole, infiltration of the interstitial space between myocardial cells, and reduced blood flow through small distal coronary arterioles, the lumens of which were partially obliterated by amyloid in this family, may all contribute. Three family members had sudden cardiac deaths, suggesting a dysrhythmic etiology. Potentially life-threatening ventricular arrhythmias were detected in electrophysiological studies of two surviving individuals who, notably, responded to conventional therapy with amiodarone. The rhythm disturbances may have been precipitated directly by amyloid deposits and/or by ischemia.
This family study highlights some of the common difficulties faced by the clinician when a diagnosis of cardiac amyloid is suspected. The clinical features masqueraded as those of ischemic heart disease, and echocardiography suggested severe left ventricular hypertrophy raising the possibility of hypertrophic cardiomyopathy. Endomyocardial biopsy is essential to confirm the presence of cardiac amyloid, but unless immunohistochemical studies are performed in addition to Congo red histology, the type of amyloid cannot be defined. The clinical features of amyloid neuropathy and heart disease in patient III.5 were originally presumed to be those of AL amyloidosis, which frequently presents in this manner. A family history should routinely be sought, and if more than one first-degree relative has cardiac amyloidosis or if the amyloid is found to be of TTR type in a nonelderly patient, analysis of the TTR gene should be undertaken.
Restriction fragment length polymorphism and single-strand conformational polymorphism analyses have been widely used to seek TTR gene mutations, and even more sophisticated indirect approaches, such as PCRprimerintroduced restriction analysis, have been reported.18 Restriction fragment length polymorphism analysis is not applicable for the present mutation because it neither creates nor abolishes a restriction enzyme site. However, the most precise and unambiguous method for detecting mutations, with the least potential for erroneous results, is direct sequencing, as reported here.19 This can be undertaken in any routine molecular genetic laboratory.
Characterization of the molecular defect causing hereditary cardiac amyloidosis in the present family has implications for treatment. The circulating TTR is produced almost exclusively in the liver, and we have previously shown that orthotopic liver transplantation in FAP due to TTR mutations eliminates variant TTR from the circulation and is followed by clinical improvement.20 21 More than 70 cases of TTR-associated FAP have been treated by liver replacement, and the majority have benefited clinically (Proceedings of the First International Workshop on Liver Transplantation in FAP, Stockholm, September 1993, unpublished observations). SAP scintigraphy, a quantitative method for surveying the whole-body distribution and extent of amyloid, has shown that the systemic amyloid deposits regress significantly within 1 to 2 years after surgery.21 These findings are consistent with those we have obtained in systemic AA and AL amyloidosis, in which major regression of amyloid frequently also occurs when the supply of the amyloid fibril precursor protein is substantially reduced.22 23
Another life-saving option in our family is cardiac transplantation, although without simultaneous liver replacement cardiac amyloid deposition is likely to recur. Even if the time course of amyloid deposition in the donor heart was slow, and indeed it may take decades, it is probable that clinically important amyloids would develop in other organ systems. In July 1992, we performed simultaneous heart and liver transplantation in a 62-year-old man with FAP associated with the 77Tyr variant of TTR. He is alive and well with increased general well-being, having gained weight, and with subjective and objective electrophysiological evidence of improved autonomic and peripheral nerve function. This radical but potentially curative approach is currently under consideration for the present family.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received May 18, 1994; revision received September 1, 1994; accepted September 23, 1994.
| References |
|---|
|
|
|---|
2. Pepys MB. Amyloidosis. In: Frank MM, Austen KF, Claman HN, Unanue ER, eds. Samter's Immunological Diseases. 5th ed. Boston, Mass: Little, Brown & Co; 1994:637-655.
3. Husby G. Nomenclature and classification of amyloid and amyloidoses. J Intern Med. 1992;232:511-512. [Medline] [Order article via Infotrieve]
4. Pitkanen P, Westermark P, Cornwell GG. Senile systemic amyloidosis. Am J Pathol. 1984;117:391-399. [Abstract]
5. Saraiva MJM. Recent advances in the molecular pathology of familial amyloid polyneuropathy. Neuromuscul Disord. 1991;1:3-6. [Medline] [Order article via Infotrieve]
6. Saraiva MJM, Costa PP, Goodman DS. Transthyretin and familial amyloidotic polyneuropathy. In: Rosenberg RN, Prusiner SB, DiMauro S, Barchi RL, Kunkel LM, eds. The Molecular and Genetic Basis of Neurological Disease. Boston, Mass: Butterworths; 1993:889-894.
7. Puchtler H, Sweat F, Levine M. On the binding of Congo red by amyloid. J Histochem Cytochem. 1962;10:355-364. [Abstract]
8. Hawkins PN, Myers MJ, Lavender JP, Pepys MB. Diagnostic radionuclide imaging of amyloid: biological targeting by circulating human serum amyloid P component. Lancet. 1988;1:1413-1418. [Medline] [Order article via Infotrieve]
9. Hawkins PN, Lavender JP, Pepys MB. Evaluation of systemic amyloidosis by scintigraphy with 123I-labeled serum amyloid P component. N Engl J Med. 1990;323:508-513. [Abstract]
10. Talmud P, Tybjaerg-Hansen A, Bhatnagar D, Mbewu A, Miller JP, Durrington P, Humphries S. Rapid screening for specific mutations in patients with a clinical diagnosis of familial hypercholesterolaemia. Atherosclerosis. 1991;89:137-141. [Medline] [Order article via Infotrieve]
11.
Casanova J-L, Pannetier C, Jaulin C, Kourilsky P. Optimal
conditions for directly sequencing double-stranded PCR products with
Sequenase. Nucleic Acids Res. 1990;18:4028.
12. Hawkins PN, Wootton R, Pepys MB. Metabolic studies of radioiodinated serum amyloid P component in normal subjects and patients with systemic amyloidosis. J Clin Invest. 1990;86:1862-1869.
13.
Tsuzuki T, Mita S, Maeda S, Araki S, Shimada K. Structure of
the human prealbumin gene. J Biol Chem. 1985;260:12224-12227.
14. Terry CJ, Damas AM, Oliveira P, Saraiva MJM, Alves IL, Costa PP, Matias PM, Sakaki Y, Blake CCF. Structure of Met30 variant of transthyretin and its amyloidogenic implications. EMBO J. 1993;12:735-741. [Medline] [Order article via Infotrieve]
15. Serpell LC, Blake CCF. Frequency analysis and structural correlation of FAP mutations in transthyretin. In: Kisilevsky R, Benson MD, Frangione B, Gauldie J, Muckle TJ, Young ID, eds. Amyloid and Amyloidosis 1993. Pearl River, NY: Parthenon Publishing; 1994:447-449.
16. Duan W, Achen MG, Richardson SJ, Lawrence MC, Wettenhall REH, Jaworowski A, Schreiber G. Isolation, characterization, cDNA cloning and gene expression of an avian transthyretin: implications for the evolution of structure and function of transthyretin in vertebrates. Eur J Biochem. 1991;200:679-687. [Medline] [Order article via Infotrieve]
17.
Hesse A, Altland K, Linke RP, Almeida MR, Saraiva MJM,
Steinmertz A, Maisch B. Cardiac amyloidosis: a review and report of a
new transthyretin (prealbumin) variant. Br Heart J. 1993;70:111-115.
18.
Jacobson DR. A specific test for transthyretin 122
(Val
Ile), based on PCR-primer-introduced restriction analysis
(PCR-PIRA): confirmation of the gene frequency in blacks. Am J
Hum Genet. 1992;50:195-198. [Medline]
[Order article via Infotrieve]
19. Booth DR, Soutar AK, Hawkins PN, Reilly M, Harding A, Pepys MB. Three new amyloidogenic transthyretin gene mutations: advantages of direct sequencing. In: Kisilevsky R, Benson MD, Frangione B, Gauldie J, Muckle TJ, Young ID, eds. Amyloid and Amyloidosis 1993. Pearl River, NY: Parthenon Publishing; 1994:456-458.
20. Holmgren G, Steen L, Ekstedt J, Groth C-G, Ericzon B-G, Eriksson S, et al. Biochemical effect of liver transplantation in two Swedish patients with familial amyloidotic polyneuropathy (FAP-met30). Clin Genet. 1991;40:242-246. [Medline] [Order article via Infotrieve]
21. Holmgren G, Ericzon B-G, Groth C-G, Steen L, Suhr O, Andersen O, et al. Clinical benefit and regression of amyloidosis following liver transplantation in patients with familial amyloid polyneuropathy due to transthyretin variant Met-30. Lancet. 1993;341:1113-1116. [Medline] [Order article via Infotrieve]
22.
Hawkins PN, Richardson S, MacSweeney JE, King AD, Vigushin DM,
Lavender JP, Pepys MB. Scintigraphic quantification and serial
monitoring of human visceral amyloid deposits provide evidence for
turnover and regression. Q J Med. 1993;86:365-374.
23. Hawkins PN, Richardson S, Vigushin DM, David J, Kelsey CR, Gray RES, et al. Serum amyloid P component scintigraphy and turnover studies for diagnosis and quantitative monitoring of AA amyloidosis in juvenile rheumatoid arthritis. Arthritis Rheum. 1993;36:842-851.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
Answers Br J Ophthalmol, January 1, 2008; 92(1): 142 - 142. [Full Text] [PDF] |
||||
![]() |
S Bonin, F Petrera, B Niccolini, and G Stanta PCR analysis in archival postmortem tissues Mol. Pathol., June 1, 2003; 56(3): 184 - 186. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Lachmann, D. R. Booth, S. E. Booth, A. Bybee, J. A. Gilbertson, J. D. Gillmore, M. B. Pepys, and P. N. Hawkins Misdiagnosis of Hereditary Amyloidosis as AL (Primary) Amyloidosis N. Engl. J. Med., June 6, 2002; 346(23): 1786 - 1791. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hund, R. P. Linke, F. Willig, and A. Grau Transthyretin-associated neuropathic amyloidosis: Pathogenesis and treatment Neurology, February 27, 2001; 56(4): 431 - 435. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.D. Gillmore, D.R. Booth, M. Rela, N.D. Heaton, V. Rahman, A.J. Stangou, M.B. Pepys, and P.N. Hawkins Curative hepatorenal transplantation in systemic amyloidosis caused by the Glu526Val fibrinogen {alpha}-chain variant in an English family QJM, May 1, 2000; 93(5): 269 - 275. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Brett, M. R. Persey, M. M. Reilly, T. Revesz, D. R. Booth, S. E. Booth, P. N. Hawkins, M. B. Pepys, and J. A. Morgan-Hughes Transthyretin Leu12Pro is associated with systemic, neuropathic and leptomeningeal amyloidosis Brain, February 1, 1999; 122(2): 183 - 190. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Akasaka, K. Yoshida, A. Yamamuro, T. Hozumi, T. Takagi, S. Morioka, and J. Yoshikawa Phasic Coronary Flow Characteristics in Patients With Constrictive Pericarditis : Comparison With Restrictive Cardiomyopathy Circulation, September 16, 1997; 96(6): 1874 - 1881. [Abstract] [Full Text] |
||||
![]() |
S. S. Kushwaha, J. T. Fallon, and V. Fuster Restrictive Cardiomyopathy N. Engl. J. Med., January 23, 1997; 336(4): 267 - 276. [Full Text] [PDF] |
||||
![]() |
R. A. Kyle Amyloidosis Circulation, February 15, 1995; 91(4): 1269 - 1271. [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1995 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |