Published online before print March 9, 2009, doi: 10.1161/CIRCULATIONAHA.108.823997
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2009;119:1524-1532.)
© 2009 American Heart Association, Inc.
Vascular Medicine |
G-Protein–Coupled Receptor Kinase Interacting Protein-1 Is Required for Pulmonary Vascular Development
From the Aab Cardiovascular Research Institute and the Department of Medicine (J.P., R.H., J.W., G.Y., R.J.W., M.R.O., A.M., H.M., M.P.M., C.Y., B.C.B.); Department of Pediatrics (G.S.P.); and Department of Microbiology and Immunology (X.X.), University of Rochester School of Medicine and Dentistry, Rochester, NY.
Correspondence to Bradford C. Berk, MD, PhD, University of Rochester Medical Center, Box 706, 601 Elmwood Ave, Rochester, NY 14642. E-mail Bradford_Berk{at}URMC.rochester.edu
Received September 27, 2008; accepted January 15, 2009.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Background— The G-protein–coupled receptor kinase interacting protein-1 (GIT1) is a multidomain scaffold protein that participates in many cellular functions including receptor internalization, focal adhesion remodeling, and signaling by both G-protein–coupled receptors and tyrosine kinase receptors. However, there have been no in vivo studies of GIT1 function to date.
Methods and Results— To determine essential functions of GIT1 in vivo, we generated a traditional GIT1 knockout mouse. GIT1 knockout mice exhibited 
60% perinatal mortality. Pathological examination showed that the major abnormality in GIT1 knockout mice was impaired lung development characterized by markedly reduced numbers of pulmonary blood vessels and increased alveolar spaces. Given that vascular endothelial growth factor (VEGF) is essential for pulmonary vascular development, we investigated the role of GIT1 in VEGF signaling in the lung and cultured endothelial cells. Because activation of phospholipase-C
(PLC) and extracellular signal-regulated kinases 1/2 (ERK1/2) by angiotensin II requires GIT1, we hypothesized that GIT1 mediates VEGF-dependent pulmonary angiogenesis by modulating PLC and ERK1/2 activity in endothelial cells. In cultured endothelial cells, knockdown of GIT1 decreased VEGF-mediated phosphorylation of PLC and ERK1/2. PLC and ERK1/2 activity in lungs from GIT1 knockout mice was reduced postnatally.
Conclusions— Our data support a critical role for GIT1 in pulmonary vascular development by regulating VEGF-induced PLC and ERK1/2 activation.
Key Words: angiogenesis • endothelial cell • G protein-coupled receptor kinase-interactor 1, mouse • PLC-gamma
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The G-protein–coupled receptor (GPCR)-kinase interacting protein-1 (GIT1) is a multidomain scaffold protein that was first found because of its binding to GPCR kinase-2.1 All mammals and birds studied to date express 2 GIT proteins: GIT1 and GIT2. Whereas GIT1 exists almost entirely in its full-length form, GIT2 is extensively alternatively spliced in a tissue-specific manner.2 Tissue distribution of GIT1 is much more restricted than GIT2, which is ubiquitous.3 Northern blotting of RNA pooled from various rat tissues with a GIT1 probe demonstrated highest levels in testis, lung, and brain.1 Recently, Premont et al3 used mice with β-galactosidase reporters inserted into the 2 GIT genes to visualize GIT1 and GIT2 gene expression in mouse tissues. Their study showed that GIT2 was expressed in most cells of the body, whereas GIT1 was highly restricted to brain, vessels (both endothelial cells [EC] and vascular smooth muscle cells), lung bronchi, and liver bile ducts. No expression of GIT1 was found in parenchyma of lung or liver, nor in myocytes (heart, skeletal, or smooth muscle [except vascular]).
Clinical Perspective p 1532
The full-length GIT proteins have an N-terminal ARF GTPase activating protein domain, 3 ankyrin repeats, a Spa2-homology domain, a coiled-coil domain, and a paxillin-binding site.4 GIT1 binds to PIX, phospholipase-C (PLC), and mitogen-activated protein kinase kinase 1 (MEK1) through the Spa2-homology domain, and paxillin binds through the paxillin-binding site domain. GIT1 plays a role in many cellular functions including receptor internalization, focal adhesion remodeling, and signaling pathways of both GPCRs and tyrosine kinase receptors.5,6 Recently, GIT2 was shown to be essential for neutrophil function in vivo because loss of GIT2 in neutrophils resulted in impaired GPCR-induced chemotactic direction sensing and excess superoxide production.7 However, there have been no in vivo studies of GIT1 function to date. To determine the physiological importance of GIT1, we used gene targeting strategies to knock out GIT1 expression in mice (GIT1 KO). Here we report a dramatic pulmonary phenotype in GIT1 KO mice.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Generation of GIT1 KO Mice
GIT1 KO alleles were generated by homologous recombination in embryonic stem cells. Targeted embryonic stem cells carrying disrupted allele were injected to 129 embryonic stem cells to produce chimeric mice. Chimeras were mated with C57BL/6 females to obtain F1 mice carrying the targeted allele. For detailed procedures, please see the online-only Data Supplement.
Morphometry and Immunohistochemistry
Lung tissues of GIT1 wild-type (WT) and KO mice (embryos; embryonic day 14.5 [E14.5]) were fixed with 4% paraformaldehyde, sectioned, and processed for hematoxylin and eosin staining or fixed for electron microscopy as described.8 Vessel density was evaluated by von Willebrand factor (vWF) staining (see details in the online-only Data Supplement).
Pulmonary Vascular Imaging With X-Ray and Micro–Computed Tomography
Lungs from GIT1 WT and KO mice (postnatal day 25 [P25]) and right ventricle (RV) were cannulated. A heated solution of 1% low-melting agarose and 30% barium was infused. The lungs were inflation fixed with 4% paraformaldehyde. The pulmonary vasculature was visualized with x-ray and Scanco vivaCT 40 (Basserdorf, Switzerland). Details of the micro–computed tomography (CT) were published previously.9 CT data were reconstructed as 3-dimensional images. Scanco’s program was used to plot vessel counts versus vessel thickness in each segment (5 segments per right lung). The total vessel numbers from all 5 segments were added.
Fluorescence Microangiography
The fetal pulmonary arterial system was perfused with a solution of 1% low-melting agarose containing a suspension of 0.2 µm fluorescent microspheres (1:10 [vol/vol]) (Molecular Probes, Carlsbad, Calif). The lungs were then fixed in 4% paraformaldehyde for 48 hours at 4°C, and sections (150 µm) were cut on a vibratome (Leica VT1000S, GMI Inc, Ramsey, Minn). Images were captured by optical sectioning with the use of confocal microscope (Radiance, Bio-Rad, Irvine, Calif).
Measurement of Pulmonary Artery Pressure and RV Pressure
GIT1 WT and KO mice (aged 2 to 3 months; n=6 per group) were anesthetized with an intraperitoneal injection of ketamine (130 mg/kg) and xylazine (8.8 mg/kg) in saline (10 mL/kg). A thoracotomy was rapidly performed, and the mice were ventilated with oxygen-enriched air. After median sternotomy, the RV was punctured with a 27.5-gauge needle, and a 1.0F measuring catheter (Millar Instruments, Inc, Houston Tex) was inserted into the RV as determined by a typical RV pressure curve. The catheter was then advanced across the pulmonary valve into the pulmonary artery, and pressure was recorded for 30 to 40 minutes.
Cell Culture
Human umbilical vein endothelial cells (HUVEC) were isolated and grown as described previously.10 Rat pulmonary microvascular EC were a generous gift from Dr R. James White and were grown in 10% fetal bovine serum/Dulbecco’s modified Eagle’s medium. GIT1 small interfering RNA (siRNA) (AAGCTGCCAAGAAGAAGCTAC) and control nonsilencing siRNA (AATTCTCCGACACGTGTCACT) were transfected as previously described by our laboratory.6 Matrigel was purchased from Chemicon, and the tube formation assays were performed as instructed by the manufacturer.
3H-Thymidine Incorporation
To assess the effect of GIT1 on rat pulmonary microvascular EC proliferation, the rate of DNA synthesis was measured as described.11
Immunoblotting
Western blotting was performed as described.6 Results were normalized by arbitrarily setting the densitometry of control samples to 1.0.
Statistical Analysis
All values are expressed as mean±SE and represent data from 3 to 6 independent experiments. Survival was assessed by the Kaplan-Meier method and compared between the 2 genotypes with a log-rank test. Comparisons of parameters between 2 groups were analyzed with unpaired t test. Comparisons of different parameters between the 2 genotypes were analyzed with 2-way ANOVA, and comparisons of different parameters between the 2 genotypes or groups at different time points were analyzed with a 2-way repeated-measures ANOVA. Statistical significance was evaluated with StatView (StatView 5.0, SAS Institute Inc, Cary, NC). A value of P<0.05 was considered statistically significant.
The authors had full access to and take full responsibility for the integrity of the data. All authors have read and agree to the manuscript as written.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Generation of GIT1 KO Mice
To study the physiological relevance of GIT1, targeting vectors were created to knock out the gene by homologous recombination replacing exons 2 to 7 with a neomycin resistance cassette (Figure 1A). The deleted region encodes the ARF-GAP domain and ankyrin repeats. Targeting of GIT1 was confirmed by reverse transcription polymerase chain reaction and Western blot. Reverse transcription polymerase chain reaction analysis of RNA from lung tissue of GIT1 WT and KO mice at P4 revealed that GIT1 transcripts were absent in homozygous mice. Transcripts encoding GIT2 were expressed at normal levels in KO mice (Figure 1B). No GIT1 protein expression was found in any tissue from GIT1 KO mice (Figure 1C).
|
High Mortality of GIT1 KO Mice
GIT1 KO mice were born at the expected mendelian ratio and were fertile. However, many GIT1 KO mice died soon after birth. To characterize the time course for death, pregnant GIT1 KO mice and WT mice were observed daily at term (8 litters for each group) and during the 10 days after birth. Litter sizes of GIT1 KO animals varied from 6 to 8 pups at birth. Kaplan-Meier curves showed that 60% (Figure 2A; P=0.011, log-rank test) of GIT1 KO offspring succumbed within 10 days of birth, whereas minimal neonatal mortality (4%) was evident in pups of WT litters.
|
Abnormal Lung Morphology in GIT1 KO Mice
Some newborn GIT1 KO pups exhibited severe respiratory distress and were obviously cyanotic (Figure 2C, Nos. 2 and 3) compared with WT pups (Figure 2B). The lung tissues of these pups showed gross pleural hemorrhages (Figure 2E) compared with WT lungs (Figure 2D). No obvious hemorrhages were observed in the lungs of adult GIT1 KO mice that survived past 1 month, although lung morphology was abnormal, as shown by increased air spaces (age 3 months; Figure I in the online-only Data Supplement). Gross morphology of all other organs was completely normal. Histopathological analyses of tissues that express GIT1, including brain and liver, were also normal (not shown). Histopathological examination of the lungs of WT mice showed normal saccular expansion at days 4 to 7 (Figure 2F and 2H), whereas evidence was found of marked hemorrhage in parenchyma of GIT1 KO mice (Figure 2G and 2I). In the perfused lungs from P7 mice, WT mice showed a well-developed alveolar structure (Figure 2J and 2L), whereas abnormally large air spaces were present in KO mice (Figure 2K and 2M). In contrast, no differences in the histological appearance were found in WT and KO lungs at earlier periods of gestation (E14.5; Figure 2N and 2O). To gain insight into mechanisms responsible for impaired pulmonary development and hemorrhage, we studied ultrastructural details of alveoli and vessels. Transmission electron microscopy revealed that the tight junctions of arteries, capillaries, and venules were intact in KO mice (Figure II in the online-only Data Supplement). No significant differences in hematologic parameters, including bleeding times, were found between GIT1 WT and KO mice (Table I in the online-only Data Supplement; 2-way ANOVA).
GIT1 Protein Expression in Neonate Lung Tissue of GIT1 WT mice
Premont et al3 showed that GIT1 expression was restricted to cells lining blood vessels and bronchi in adult mouse lung tissue. However, GIT1 protein expression in neonatal lung was not investigated. Immunostaining of GIT1 in neonatal lung (P5) revealed that GIT1 was predominantly colocalized with platelet endothelial cell adhesion molecule-1 (an EC marker) in vessels (Figure IIIA to IIIC in the online-only Data Supplement), especially capillaries (Figure IIID to IIIF in the online-only Data Supplement), suggesting an important role for GIT1 in EC function. GIT1 was also expressed in smooth muscle and epithelial cells of bronchi (Figure IIIA to IIIC in the online-only Data Supplement). No significant difference was found in smooth muscle cell 
-actin protein expression in lungs of GIT1 WT and KO mice (P7; P=0.36, unpaired t test; n=3; Figure IV in the online-only Data Supplement), suggesting that differences in smooth muscle cell function did not explain the GIT1 KO phenotype.
Defective Pulmonary Development in GIT1 KO Mice
To better define the abnormalities in pulmonary vasculature, we performed x-ray and 3-dimensional analysis of the pulmonary arterial tree using micro-CT and fluorescence microangiography. WT lungs demonstrated uniform filling of the distal pulmonary arterial tree, with homogeneous perfusion of the microvasculature (Figure 3A, 3C, and 3E). In contrast, lungs from GIT1 KO mice showed dramatic pruning of arteriolar branches and regions of marked capillary hypoperfusion (Figure 3B, 3D, and 3F). The numbers of vessels in the right lung were counted on the basis of the vessel size. This analysis showed that the greatest difference in KO lungs was a significant decrease in vessels of the smallest size (0 to 50 µm), although a trend was noted in vessels of 50 to 200 µm (Figure 3G). To characterize further the alterations in pulmonary microvessels, we assayed the presence of EC. Cells expressing the EC marker vWF could be demonstrated by immunostaining in lung sections from both P7 WT (Figure 4A) and KO mice (Figure 4B). However, the number of vWF-positive cells was reduced significantly in lungs of GIT1 KO mice (Figure 4C; unpaired t test). Moreover, expression of the vascular endothelial growth factor (VEGF) receptor 2 (VEGFR2), a key receptor for EC migration and proliferation, time dependently increased in lungs of GIT WT mice (maximum at P5), to a much greater extent than in the KO mice (Figure 4D and 4E; 2-way repeated-measures ANOVA).
|
|
To determine the role of GIT1 in formation of alveoli, we studied both VEGFR2 expression and surfactant protein C (SP-C, a pneumocyte marker) expression. When GIT1 expression was decreased with siRNA, no change was found in the expression of VEGFR2 in HUVEC (Figure 5A), demonstrating that decreased expression of VEGFR2 in lung was likely due to decreased numbers of EC. Because alveoli development may be regulated by pulmonary vasculature formation,12 SP-C–positive cells were also measured by immunostaining. As anticipated, SP-C–positive cells in GIT1 KO mice decreased 30% compared with WT (Figure V in the online-only Data Supplement; unpaired t test), whereas the ratio of SP-C–positive cells and total cell number was similar in the 2 groups. These data suggest that deficiency of GIT1 did not affect differentiation of pneumocytes.
|
GIT1 KO Mice Have Normal Pulmonary Artery Pressures
Because some newborn GIT1 KO pups exhibited severe respiratory distress and were obviously cyanotic (Figure 2C, Nos. 2 and 3), it is possible that adult GIT1 KO mice will develop pulmonary hypertension. Interestingly, we found that GIT1 KO and WT mice had similar pulmonary artery pressures (9.49±0.76 versus 11.25±1.17 mm Hg; P=0.16, 2-way ANOVA; n=6 per group), as well as RV pressures (19.34±1.78 versus 20.29±0.10 mm Hg; P=0.41; n=6 per group; Table II in the online-only Data Supplement). Also, no significant differences were found in heart rate (note that heart rate was recorded under anesthesia) or RV dP/dt values (P=0.22; n=6). Thus, pulmonary vascular tone appears to be similar in GIT1 KO and WT mice that survive to adulthood.
GIT1 Knockdown Inhibited VEGF-Induced Activation of PLC in EC
Because the GIT1 KO mouse phenocopies the VEGF120 mouse,13 we hypothesized that VEGF signaling would be significantly inhibited by loss of GIT1. We and others have shown important roles for GIT1 in signaling mediated by tyrosine kinase receptors, especially activation of MEK1–extracellular signal-regulated kinases 1/2 (ERK1/2), PLC, and FAK.5 Because the PLC KO mice also have a vascular phenotype,14 we further hypothesized that GIT1 is required for activation of PLC induced by VEGF. Importantly, VEGF-dependent activation of the PLC pathway in EC contributes to ERK1/2 activation (via Raf-MEK1) and to DNA synthesis.15,16 To gain insight into the functional significance of GIT1 in VEGF-mediated signaling events in EC, we measured the effect of GIT1 knockdown on VEGF-mediated PLC, MEK1, and ERK1/2 activation. HUVEC were transfected with GIT1 siRNA for 48 hours and then stimulated with VEGF (Figure 5A). Treatment of HUVEC with GIT1 siRNA significantly reduced endogenous GIT1 expression, whereas control siRNA had no effect (Figure 5A). Decreasing GIT1 expression significantly inhibited VEGF activation of PLC (Figure 5A and 5B), MEK1 (Figure 5A and 5C), and ERK1/2 (Figure 5A and 5D). No significant effect of GIT1 knockdown was found on VEGFR2 activation as measured by phosphorylation of tyrosine 1175, which is important for activation of PLC (Figure 5A and 5E; 2-way repeated-measures ANOVA). These data show that GIT1 is essential for activation of PLC, MEK1, and ERK1/2 by VEGF.
Phosphorylation of PLC and ERK1/2 Was Decreased in Lungs of GIT1 KO Mice
To confirm the role of GIT1 in VEGF signaling in vivo, activation of PLC and ERK1/2 was investigated in the lungs of GIT1 WT and KO mice. Both PLC and ERK1/2 phosphorylation increased in lungs isolated from GIT1 WT mice, with peak at P5 (Figure 5F through 5I). In contrast, in GIT1 KO mice, phosphorylation of PLC and ERK1/2 was markedly decreased compared with WT mice (Figure 5F to 5I; 2-way repeated-measures ANOVA). GIT1 expression also increased from P0 to P5 (Figure 5G and 5I). These data suggest that GIT1-dependent activation of PLC and ERK1/2 may play an important role during the postnatal period of lung development.
GIT1 Is Required for Serum-Induced DNA Synthesis in EC In Vitro and Proliferation In Vivo
VEGF-dependent activation of the MEK1-ERK1/2 pathway contributes to DNA synthesis and cell proliferation in EC.16 To determine whether GIT1 is required for EC proliferation, we examined the effect of GIT1 knockdown on serum-induced DNA synthesis in microvascular EC. As shown in Figure 6A, GIT1 siRNA significantly inhibited DNA synthesis (2-way ANOVA). To confirm the role of GIT1 in EC proliferation in vivo, we assayed expression of proliferating cell nuclear antigen (PCNA) in lung. PCNA was highly expressed in lungs of GIT1 WT mice during P3 to P5 and decreased at P25 (Figure 6B), whereas PCNA expression was dramatically decreased in GIT1 KO (0.4-fold ±0.2; P<0.05 compared with WT group, unpaired t test; n=4). These data suggest that GIT1 is essential for postnatal EC proliferation.
|
GIT1 Is Required for EC Tube Formation Induced by VEGF
VEGF-stimulated EC tube formation in vitro is a well-established assay for angiogenesis. To evaluate the role of GIT1 in angiogenesis, the effect of GIT1 knockdown on tube formation was studied. VEGF increased tube formation by 4-fold, which was significantly reduced by GIT1 knockdown (Figure 7; 2-way ANOVA).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The major finding of this report is the presence in GIT1 KO mice of profound abnormalities in lung morphogenesis, including decreased pulmonary vascular density, parenchymal hemorrhage, and increased alveolar spaces. Organ development and function in the GIT1 KO mouse were otherwise normal, suggesting that a unique requirement exists for GIT1 in the lung. Interestingly, the laboratory of Premont et al3 showed that GIT1 expression in the lung was confined to EC and bronchi, whereas GIT2 was ubiquitous. Although we observed no compensation by GIT2 in the lung, the ubiquitous expression of this protein may be sufficient to compensate for GIT1 deficiency in most tissues. The pulmonary findings in the GIT1 KO mice phenocopy the VEGF120 mice,13 suggesting that GIT1 is a critical mediator of VEGF signaling in the lung. Support for this concept is provided by impaired signaling downstream of VEGF, including reduced activation of PLC
and ERK1/2 in the lungs of GIT1 KO. We show further that this pathway is critical for EC tube formation and proliferation. These data support a novel mechanism for VEGF signaling in the lung mediated by a VEGF-GIT1-PLC-MEK1-ERK1/2 pathway. Importantly, this phenotype resembles the human diseases bronchopulmonary dysplasia (BPD) and alveolar capillary dysplasia (ACD), in which impaired vascular development retards pulmonary development chronically. The abnormalities in pulmonary vascular development in GIT1 KO mice were most striking in the decreased numbers of distal arteriolar branches and capillaries with diameters of 0 to 50 µm as shown by x-ray, micro-CT, and fluorescein angiography. Correspondingly, total EC number was obviously reduced, as demonstrated by decreased expression of the EC markers vWF and VEGFR2, in lungs of GIT1 KO mice. However, embryonic lung morphogenesis (E14.5) of GIT1 KO was normal, suggesting that the primary problem in the GIT1 KO is a failure of pulmonary angiogenesis rather than epithelial morphogenesis. In addition, we found that tight junctions in arteries and veins were normal in GIT1 KO as demonstrated by electron microscopy. Bleeding time and platelet number were also normal in GIT1 KO mice. Thus, the impressive pulmonary hemorrhage we observed was likely not due to abnormalities in vascular permeability or hemostasis. Therefore, the essential requirement for GIT1 in pulmonary vascular development likely reflects unique developmental and perinatal events in the pulmonary vasculature (and possibly alveoli, as discussed below). Future studies with the use of EC-specific knockout of GIT1 will be necessary to define the roles of GIT1 more precisely.
Because of reduced pulmonary vascularity with chronic hypoxemia, we hypothesized that adult GIT1 KO mice may develop pulmonary hypertension. Surprisingly, adult GIT1 KO mice showed pulmonary artery and RV pressures similar to those in WT mice. Furthermore, components of the pulmonary vasoconstrictor pathway, endothelin-117,18 and the endothelin-1 receptor A, were unchanged in GIT1 KO mice (Figure VI in the online-only Data Supplement). These results suggest that compensatory mechanisms exist in the GIT1 KO mice that survive to adulthood. It will be interesting in future studies to characterize these compensatory pathways.
The finding that the GIT1 KO has many morphological similarities to the VEGF120 mouse suggests that GIT1 is a novel mediator for VEGF signaling in the lung.13 The close coordination of airway and vessel growth is essential for normal lung development, especially during the saccular and alveolar stages of development. Angiogenesis has been shown to be necessary for alveolarization during lung development, and inhibiting pulmonary vascular growth impedes alveolar growth.12,19 Thus, we propose that inhibiting pulmonary vascular growth during a critical period of postnatal lung growth impairs alveolarization, suggesting that endothelial-epithelial cross talk, especially via VEGF signaling, is critical for normal lung growth after birth. This concept is supported by decreased SP-C–positive cell numbers and decreased expression of VEGF mRNA in GIT1 KO mice (Figure VII in the online-only Data Supplement). We believe that a requirement for GIT1 in pneumocyte development is unlikely because these cells express primarily GIT2.3 In addition to VEGF, fibroblast growth factor-10 has been shown to be essential for lung morphogenesis. We believe it is unlikely that fibroblast growth factor-10 is involved in the GIT1 KO pulmonary phenotype because mRNA expression of fibroblast growth factor-10 was normal in GIT1 KO mice (Figure VI in the online-only Data Supplement).
Both VEGF164 and VEGF18820 have been shown to be essential to development of the lung vasculature. The disruption of even a single copy of the VEGF gene results in embryonic lethality because of the failure of endothelial differentiation and blood vessel formation.20 To overcome this limitation, Galambos et al13 engineered knock-in transgenic mice expressing only VEGF120, which led to a selective impairment in the development of the distal pulmonary arteriolar branches, strongly resembling the vascular defects of GIT1-deficient animals.13 VEGF contributes to blood vessel formation in the developing lung,21,22 including the arteriolar branches and capillary formation. Postnatal lung development (alveolar stage) is primarily dependent on angiogenesis, which correlates with increased expression of GIT1 (Figure 5F and 5I) and VEGF13,22–24 in the lung. On the basis of these findings, we suggest that GIT1 function is required for VEGF signaling. VEGF signaling involves activation of c-Src, PLC, and ERK1/2, which are important in angiogenesis.6,25 Our previous data showed that GIT1 is a substrate of c-Src and functions as a scaffold protein for PLC and MEK1.6,26,27 Thus, we believe that GIT1 is required for PLC-MEK1-ERK1/2 activation by VEGF and for lung microvasculature development. In cultured EC, knockdown of GIT1 by siRNA obviously decreased the activation of PLC, MEK1, and ERK1/2 (Figure 5), which play important roles in EC proliferation and migration.6,25 This role of GIT1 was confirmed by the findings of significantly decreased EC proliferation and tube formation after GIT1 knockdown (Figures 6 and 7
).
Among the components of the VEGF-GIT1-PLC-MEK1-ERK1/2 signaling pathway, we believe that activation of PLC is most critical to the pulmonary vasculature. Neither the MEK1 or ERK1/2 KO mice have a significant vascular phenotype, whereas PLC KO mice die at embryonic day 8 to 9 because of deficiencies in EC function.14 PLC phosphorylation, a measure of activity, exhibited a time course in GIT1 WT lungs that matched GIT1 and VEGF expression, suggesting a role in postnatal lung maturation (Figure 5). Importantly, phosphorylation of VEGFR2 at tyrosine 1175, which is required for activation of PLC, was not decreased by deletion of GIT1 (Figure 5).16 Thus the difference between GIT1 and PLC KO in terms of time of fetal death likely reflects a requirement for PLC protein expression (rather than activity) and/or some compensation by GIT2 during development.
Clinical Significance
The diminished numbers of EC and lack of capillary in-growth into the alveolar septae found in the GIT1 KO lungs represent characteristic features of BPD and ACD. BPD is a chronic lung disease that develops in premature infants treated with ventilation and supplemental oxygen.28 As a consequence of impaired alveolar capillary in-growth, normal air-blood barriers fail to form.29,30 BPD has been associated with decreased expression of VEGF and VEGFR2,28 suggesting mechanisms similar to GIT1 KO. ACD occurs in infants with persistent pulmonary hypertension refractory to vasodilator treatment. ACD also is characterized by deficiency of alveolar capillary in-growth and failure to form normal air-blood barriers between EC and type I epithelial cells. Although the gene defect is unknown, a vascular cause appears likely because children with ACD often display misalignment of pulmonary veins, with both venous and arterial vessels sharing a common adventitial sheath.31 It is possible that abnormal GIT1 expression and function might contribute to impaired alveolar vascularization in BPD and ACD patients. In conclusion, the present report provides novel evidence of a previously unrecognized contribution of GIT1 to pulmonary vascular development and maturation. Thus, pharmacological or genetic manipulation of the GIT1 signaling pathway (especially PLC) in the perinatal period may represent a therapeutic strategy to improve respiratory function in premature infants and in clinical conditions associated with abnormalities in lung morphogenesis.
|
Acknowledgments |
|---|
We acknowledge technical assistance by Dr Michael Zuscik and Laura Yanoso for the micro-CT assay and advice on histopathology by Dr Haodong Xu.
Sources of Funding
This work was supported by grants from the National Institutes of Health to Dr Berk (HL63462) and to Dr Yan (HL77789). This work was also supported by a Scientist Development grant from the American Heart Association to Dr Pang (0835626D).
Disclosures
None.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Premont RT, Claing A, Vitale N, Freeman JL, Pitcher JA, Patton WA, Moss J, Vaughan M, Lefkowitz RJ. beta2-Adrenergic receptor regulation by GIT1, a G protein-coupled receptor kinase-associated ADP ribosylation factor GTPase-activating protein. Proc Natl Acad Sci U S A. 1998; 95: 14082–14087.
2. Premont RT, Claing A, Vitale N, Perry SJ, Lefkowitz RJ. The GIT family of ADP-ribosylation factor GTPase-activating proteins: functional diversity of GIT2 through alternative splicing. J Biol Chem. 2000; 275: 22373–22380.
3. Schmalzigaug R, Phee H, Davidson CE, Weiss A, Premont RT. Differential expression of the ARF GAP genes GIT1 and GIT2 in mouse tissues. J Histochem Cytochem. 2007; 55: 1039–1048.
4. Brown MC, West KA, Turner CE. Paxillin-dependent paxillin kinase linker and p21-activated kinase localization to focal adhesions involves a multistep activation pathway. Mol Biol Cell. 2002; 13: 1550–1565.
5. Hoefen RJ, Berk BC. The multifunctional GIT family of proteins. J Cell Sci. 2006; 119: 1469–1475.
6. Yin G, Haendeler J, Yan C, Berk BC. GIT1 functions as a scaffold for MEK1-extracellular signal-regulated kinase 1 and 2 activation by angiotensin II and epidermal growth factor. Mol Cell Biol. 2004; 24: 875–885.
7. Mazaki Y, Hashimoto S, Tsujimura T, Morishige M, Hashimoto A, Aritake K, Yamada A, Nam JM, Kiyonari H, Nakao K, Sabe H. Neutrophil direction sensing and superoxide production linked by the GTPase-activating protein GIT2. Nat Immunol. 2006; 7: 724–731.[CrossRef][Medline] [Order article via Infotrieve]
8. Carmeliet P, Moons L, Dewerchin M, Mackman N, Luther T, Breier G, Ploplis V, Muller M, Nagy A, Plow E, Gerard R, Edgington T, Risau W, Collen D. Insights in vessel development and vascular disorders using targeted inactivation and transfer of vascular endothelial growth factor, the tissue factor receptor, and the plasminogen system. Ann N Y Acad Sci. 1997; 811: 191–206.[Medline] [Order article via Infotrieve]
9. Jorgensen SM, Demirkaya O, Ritman EL. Three-dimensional imaging of vasculature and parenchyma in intact rodent organs with x-ray micro-CT. Am J Physiol. 1998; 275: H1103–H1114.[Medline] [Order article via Infotrieve]
10. Jin ZG, Wong C, Wu J, Berk BC. Flow shear stress stimulates Gab1 tyrosine phosphorylation to mediate protein kinase B and endothelial nitric-oxide synthase activation in endothelial cells. J Biol Chem. 2005; 280: 12305–12309.
11. Arkin IT, Xu H, Jensen MO, Arbely E, Bennett ER, Bowers KJ, Chow E, Dror RO, Eastwood MP, Flitman-Tene R, Gregersen BA, Klepeis JL, Kolossvary I, Shan Y, Shaw DE. Mechanism of Na+/H+ antiporting. Science. 2007; 317: 799–803.
12. Le Cras TD, Markham NE, Tuder RM, Voelkel NF, Abman SH. Treatment of newborn rats with a VEGF receptor inhibitor causes pulmonary hypertension and abnormal lung structure. Am J Physiol. 2002; 283: L555–L562.
13. Galambos C, Ng YS, Ali A, Noguchi A, Lovejoy S, D'Amore PA, DeMello DE. Defective pulmonary development in the absence of heparin-binding vascular endothelial growth factor isoforms. Am J Respir Cell Mol Biol. 2002; 27: 194–203.
14. Liao HJ, Kume T, McKay C, Xu MJ, Ihle JN, Carpenter G. Absence of erythrogenesis and vasculogenesis in Plcg1-deficient mice. J Biol Chem. 2002; 277: 9335–9341.
15. Takahashi T, Yamaguchi S, Chida K, Shibuya M. A single autophosphorylation site on KDR/Flk-1 is essential for VEGF-A-dependent activation of PLC-gamma and DNA synthesis in vascular endothelial cells. EMBO J. 2001; 20: 2768–2778.[CrossRef][Medline] [Order article via Infotrieve]
16. Sakurai Y, Ohgimoto K, Kataoka Y, Yoshida N, Shibuya M. Essential role of Flk-1 (VEGF receptor 2) tyrosine residue 1173 in vasculogenesis in mice. Proc Natl Acad Sci U S A. 2005; 102: 1076–1081.
17. Durmowicz AG, Stenmark KR. Mechanisms of structural remodeling in chronic pulmonary hypertension. Pediatr Rev. 1999; 20: e91–e102.
18. Stenmark KR, Mecham RP. Cellular and molecular mechanisms of pulmonary vascular remodeling. Annu Rev Physiol. 1997; 59: 89–144.[CrossRef][Medline] [Order article via Infotrieve]
19. Stenmark KR, Balasubramaniam V. Angiogenic therapy for bronchopulmonary dysplasia: rationale and promise. Circulation. 2005; 112: 2383–2385.
20. Ferrara N, Carver-Moore K, Chen H, Dowd M, Lu L, O'Shea KS, Powell-Braxton L, Hillan KJ, Moore MW. Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature. 1996; 380: 439–442.[CrossRef][Medline] [Order article via Infotrieve]
21. deMello DE, Sawyer D, Galvin N, Reid LM. Early fetal development of lung vasculature. Am J Respir Cell Mol Biol. 1997; 16: 568–581.[Abstract]
22. Hislop AA. Airway and blood vessel interaction during lung development. J Anat. 2002; 201: 325–334.[CrossRef][Medline] [Order article via Infotrieve]
23. Hislop A. Developmental biology of the pulmonary circulation. Paediatr Respir Rev. 2005; 6: 35–43.[CrossRef][Medline] [Order article via Infotrieve]
24. Frey U, Hislop A, Silverman M. Branching properties of the pulmonary arterial tree during pre- and postnatal development. Respir Physiol Neurobiol. 2004; 139: 179–189.[CrossRef][Medline] [Order article via Infotrieve]
25. Asahara T, Takahashi T, Masuda H, Kalka C, Chen D, Iwaguro H, Inai Y, Silver M, Isner JM. VEGF contributes to postnatal neovascularization by mobilizing bone marrow-derived endothelial progenitor cells. EMBO J. 1999; 18: 3964–3972.[CrossRef][Medline] [Order article via Infotrieve]
26. Haendeler J, Yin G, Hojo Y, Saito Y, Melaragno M, Yan C, Sharma VK, Heller M, Aebersold R, Berk BC. GIT1 mediates Src-dependent activation of phospholipase Cgamma by angiotensin II and epidermal growth factor. J Biol Chem. 2003; 278: 49936–49944.
27. Yin G, Zheng Q, Yan C, Berk BC. GIT1 is a scaffold for ERK1/2 activation in focal adhesions. J Biol Chem. 2005; 280: 27705–27712.
28. Maniscalco WM, Watkins RH, Pryhuber GS, Bhatt A, Shea C, Huyck H. Angiogenic factors and alveolar vasculature: development and alterations by injury in very premature baboons. Am J Physiol. 2002; 282: L811–L823.
29. Chess PR, D'Angio CT, Pryhuber GS, Maniscalco WM. Pathogenesis of bronchopulmonary dysplasia. Semin Perinatol. 2006; 30: 171–178.[CrossRef][Medline] [Order article via Infotrieve]
30. D'Angio CT, Maniscalco WM. Bronchopulmonary dysplasia in preterm infants: pathophysiology and management strategies. Paediatr Drugs. 2004; 6: 303–330.[CrossRef][Medline] [Order article via Infotrieve]
31. Rabah R, Poulik JM. Congenital alveolar capillary dysplasia with misalignment of pulmonary veins associated with hypoplastic left heart syndrome. Pediatr Dev Pathol. 2001; 4: 167–174.[CrossRef][Medline] [Order article via Infotrieve]
|
Footnotes |
|---|
The online-only Data Supplement is available with this article at http://circ.ahajournals.org/cgi/content/full/CIRCULATIONAHA.108.823997/DC1.
Related Article:
Circulation 2009 119: 1457-1458.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||