Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2008;118:2174-2182
Published online before print November 3, 2008, doi: 10.1161/CIRCULATIONAHA.108.789537
CLINICAL PERSPECTIVE
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
118/21/2174    most recent
CIRCULATIONAHA.108.789537v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Osto, E.
Right arrow Articles by Cosentino, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Osto, E.
Right arrow Articles by Cosentino, F.
Related Collections
Right arrow Pathophysiology
Right arrow Cell signalling/signal transduction
Right arrow Lipid and lipoprotein metabolism
Right arrow Other Vascular biology
Right arrowRelated Article

(Circulation. 2008;118:2174-2182.)
© 2008 American Heart Association, Inc.


Molecular Cardiology

Inhibition of Protein Kinase Cβ Prevents Foam Cell Formation by Reducing Scavenger Receptor A Expression in Human Macrophages

Elena Osto, MD*; Alexei Kouroedov, MD, PhD*; Pavani Mocharla, MS; Alexander Akhmedov, PhD; Christian Besler, MD; Lucia Rohrer, PhD; Arnold von Eckardstein, MD; Sabino Iliceto, MD; Massimo Volpe, MD; Thomas F. Lüscher, MD; Francesco Cosentino, MD, PhD

From the Department of Cardiology, University Hospital and Cardiovascular Research, Institute of Physiology, and Zurich Center for Integrative Human Physiology, University of Zurich, Zurich, Switzerland (E.O., A.K., P.M., A.A., C.B., T.F.L., F.C.); Institute of Clinical Chemistry, University Hospital, Zürich, Switzerland (L.R., A.v.E.); Department of Cardiology, University of Padova (S.I.); Department of Cardiology, Second Faculty of Medicine, University "Sapienza," Rome, Italy (M.V., F.C.); and IRCCS Neuromed, Pozzilli, Italy (M.V.).

Correspondence to Francesco Cosentino, MD, PhD, Cardiovascular Research, Institute of Physiology, University of Zürich-Irchel, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland. E-mail f_cosentino{at}hotmail.com

Received June 20, 2007; accepted September 2, 2008.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowConclusions
down arrowReferences
 
Background— Low-density lipoprotein (LDL) uptake by monocyte-derived macrophages is a crucial step in foam cell formation and early atherosclerotic lesion. Increasing evidence supports the theory that activation of protein kinase Cβ (PKCβ) is involved in many mechanisms promoting atherosclerosis. Thus, we investigated whether inhibition of PKCβ prevents foam cell formation.

Methods and Results— The differentiation of human primary monocytes or the monocytic THP-1 cell line into monocyte-derived macrophages was induced by phorbol 12-myristate 13-acetate (PMA; 0.1 mmol/L), a potent activator of PKC. Incubation of monocyte-derived macrophages with DiI-modified LDL (acetylated LDL and oxidized LDL, 10 µg/mL) led to lipoprotein uptake. Interestingly enough, the nonselective inhibitor of PKCβ1 and PKCβ2, LY379196 (5x10–7 to 10–5 mol/L), blunted LDL uptake in monocyte-derived macrophages as shown by flow cytometry. Specific siRNA-mediated knockdown of PKCβ exerted a similar effect. Furthermore, PMA alone and in the presence of modified LDL induced scavenger receptor A mRNA and protein expression, which was abolished by LY379196. CGP53353, a selective inhibitor of PKCβ2, did not affect LDL uptake, nor did it prevent scavenger receptor A upregulation. Incubation of monocyte-derived macrophages with PMA/LDL increased PKCβ1 phosphorylation at the Thr-642 residue, which was blunted by LY379196. However, the expression of CD68, a marker of activated macrophages, was not affected by LY379196. Moreover, LY379196 did not affect lipopolysaccharide-induced CD14 degradation, tumor necrosis factor-{alpha} release, or superoxide anion production, ruling out any effect of PKCβ inhibition on innate immunity.

Conclusions— Nonspecific inhibition of PKCβ prevents LDL uptake in macrophages. These findings suggest that PKCβ inhibitors may represent a novel class of antiatherosclerotic drugs.


Key Words: atherosclerosis • foam cells • protein kinase C • lipoproteins, LDL • macrophages • receptors, scavenger


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowConclusions
down arrowReferences
 
Protein kinase C (PKC) comprises several structurally related serine/threonine kinases classified into 3 groups. The conventional or classic PKCs include PKC{alpha}, PKCβ1, PKCβ2, and PKC{gamma}. These isoforms can be activated by Ca2+ and/or diacylglycerol, as well as by phorbol esters. The novel PKC{delta}, PKC{epsilon}, and PKC{theta} also are activated by diacylglycerol and phorbol esters but are Ca2+ independent. The atypical PKCs, which include PKC{zeta} and PKC{iota}, are unresponsive to Ca2+/diacylglycerol and phorbol esters.1 Particularly interesting is the modulation of PKC activity by phosphorylation of serine and threonine amino acid residues within its catalytic and regulatory domains.2 Both conventional and novel PKC isoforms can translocate to the membranous compartment of the cell to elicit biological actions in the presence of diacylglycerol, the de novo synthesis of which is increased by hyperglycemia.3 Indeed, the activation of PKC pathway, especially the PKCβ isoform, has been shown extensively to cause diabetic vascular dysfunction.4–7 Because nonselective PKC inhibition is associated with lethal side effects, isoform-specific inhibitors have been developed. The macrocyclic bis (indolyl) maleimides like ruboxistaurin (LY333531), LY379196, LY317615, and LY290181 are competitive inhibitors of ATP binding sites within the PKC molecule.8,9 The advantage of macrocyclic bis (indolyl) maleimides is their high selectivity for PKCβ compared with other isoforms of PKC.10 Treatment of diabetic patients for 3 months with PKC412, a multitarget kinase inhibitor that also acts as a nonselective PKC inhibitor, resulted in significant gastrointestinal side effects such as nausea, vomiting, and diarrhea, as well as liver toxicity.11 On the contrary, a multicenter, randomized clinical trial with the selective PKCβ inhibitor ruboxistaurin in patients with diabetic retinopathy revealed that its oral administration was well tolerated and did not cause any adverse events in patients with diabetes at doses up to 16 mg twice daily for 28 days.12 Furthermore, in patients with type 1 and 2 diabetes and minimal retinopathy, retinal blood flow was increased by the PKCβ inhibitor in a dose-dependent fashion.13 Treatment for >1 year with ruboxistaurin has shown beneficial effects in delaying the progression of diabetic nephropathy.14 These studies provided the first demonstration that a PKCβ isoform–selective inhibitor can be used for long-term clinical treatment of diabetic microangiopathy with minimal side effects.15 However, increasing evidence suggests that activation of PKCβ is involved in many mechanisms promoting atherosclerosis.16 Interestingly, phorbol 12-myristate 13-acetate (PMA), a structural analogue of diacylglycerol, which is a natural activator of PKC, can trigger transformation of monocytes to macrophages.17 The accelerated atherosclerosis18 and chronic activation of PKCβ in vascular tissues of diabetic patients, including the retina, heart, aorta, and circulating monocytes,4,19,20 prompted us to hypothesize that, among all PKC isoforms, PKCβ could be involved in foam cell formation.

Clinical Perspective p 2182

The present study was designed to investigate whether selective pharmacological inhibition of PKCβ prevents modified LDL uptake and hence foam cell formation. Our findings unmask an antiatherosclerotic effect of PKCβ inhibitors, extending their application far beyond diabetic vascular complications.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowConclusions
down arrowReferences
 
Cell Culture
Peripheral blood mononuclear cells were isolated from healthy control subjects by density centrifugation in BD Vacutainer cell preparation tubes with sodium heparin (Becton Dickinson, Franklin Lakes, NJ) and further purified by magnetic-activated cell separation sorting with anti–human CD14 antibody (Miltenyi Biotec, Cologne, Germany) conjugated with magnetic beads. After density centrifugation, highly purified monocytes were recovered. Human monocyte purity was assessed by flow cytometry (FACSCanto, BD, Heidelberg, Germany) using FITC-conjugated anti–human CD14 antibody (Miltenyi Biotec). The human monocytic THP-1 cell line was obtained from the American Type Culture Collection (Rockville, Md). Monocytes were cultured in RPMI 1640 medium containing 25 mmol/L HEPES buffer (supplemented with 10% FCS, 1% L-glutamine 200 mmol/L, penicillin 100 U/mL, and streptomycin 100 µg/mL) in humidified air, 5% CO2 at 37°C. Freshly isolated human monocytes and THP-1 monocytes were differentiated into monocyte-derived macrophages (MDMs) in vitro by treatment with 0.1 µmol/L PMA (Calbiochem, Darmstadt, Germany) overnight in starvation medium, 0.5% FCS RPMI 1640. During starvation, the cells were exposed to LY379196 (10–6 mol/L), a nonselective inhibitor of both PKCβ isoforms, and CGP53353 (10–6 mol/L), a PKCβ2-selective inhibitor, and then incubated for another 24 hours in the presence of 10 µg/mL DiI-labeled acetylated low-density lipoprotein (DiI-acLDL) and DiI-labeled oxidized LDL (DiI-oxLDL) (Intracel, Frederick, Md). Human MDMs also were pretreated with myristoylated cell-permeable myr-{psi}PKC peptide (10–4 mol/L) based on the pseudosubstrate motif of PKCβ, which keeps the enzyme in an inactive state by interacting with the substrate binding site of PKCβ catalytic domain.21 In another set of experiments, MDMs were pretreated with the 2 PKCβ inhibitors or myr-{psi}PKC and stimulated for 24 hours with 100 ng/mL lipopolysaccharide (Sigma, Buchs, Switzerland). Afterward, tumor necrosis factor-{alpha} (TNF{alpha}) levels were measured in cell supernatant by ELISA (R&D Systems, Minneapolis, Minn). To exclude cytotoxicity, a colorimetric assay for detection of lactate dehydrogenase in cell supernatant was performed according to the manufacturer’s recommendations (Roche, Basel, Switzerland).

siRNA Transfection
Transfections were performed with INTERFERin (Polyplus Transfection, Basel, Switzerland) according to the manufacturer’s instructions in human MDMs (THP-1 cell line). Commercially available human PKCβ- and GAPDH- (Santa Cruz, Heidelberg, Germany) specific siRNAs were used for transfecting. The MDMs were transfected after 24 hours of seeding. INTERFERin transfection reagent (8 µL) was added to 100 µL OptiMEM serum-free medium containing 80 nmol/L of each siRNA oligo, incubated for 10 minutes, and added to the 3-cm plate containing 2 mL medium. GAPDH siRNA was used as a negative control. The FITC-labeled (Santa Cruz) control siRNA A was used as a marker for transfection efficiency. Gene silencing was measured after 48 hours by Western blotting. The transfected cells were incubated for an additional 24 hours in the presence of 10 µg/mL DiI-acLDL (Intracel), and acLDL uptake was measured by flow cytometry. Another set of transfected MDMs were used for Western blotting.

Real-Time Polymerase Chain Reaction
Total RNA was extracted from MDMs (THP-1 cell line) with Trizol reagent (Invitrogen, Basel, Switzerland) according to the manufacturer’s recommendations. The total cellular RNA was converted to cDNA with Moloney murine leukemia virus reverse transcriptase and random hexamers (Amersham Bioscience, Otelfingen, Switzerland) in a final volume of 35 µL, using 4 µg cDNA according to the manufacturer’s recommendations. Real-time polymerase chain reaction (PCR) was performed in a MX3000P PCR cycler (Stratagene, La Jolla, Calif). All PCR experiments were performed in triplicate using the SYBR Green JumpStart kit provided by Sigma. Each reaction (25 µL) contained 2 µL cDNA, 1 pmol of each primer, 0.25 µL internal reference dye, and 12.5 µL JumpStart Taq ReadyMix (containing buffer, dNTPs, stabilizers, SYBR Green, Taq polymerase, and JumpStart Taq antibody). The following primers were used: for scavenger receptor A (SR-A): sense primer, 5'-CCAGGGACATGGGAATGCAA–3'; antisense primer, 5'–CCAGTGGGACCTCGATCTCC–3'; and for human L28: sense primer, 5'–GCATCTGCAATGGATGGT-3'; antisense primer, 5'–TGTTCTTGCGGATCATGTGT-3'. The amplification program consisted of 1 cycle at 95°C for 10 minutes, followed by 40 cycles with a denaturing phase at 95°C for 30 seconds, an annealing phase of 1 minute at 60°C, and an elongation phase at 72°C for 1 minute. A melting curve analysis was performed after amplification to verify the accuracy of the amplicon. For verification of the correct amplification, PCR products were analyzed on an ethidium bromide–stained 1% agarose gel. In each real-time PCR run for F3 and L28, a calibration curve was included that was generated from serial dilutions (2x107, 2x106, 2x105, 2x104, 2x103, and 2x103 copies per reaction for SR-A; 2x107, 2x106, 2x105, 2x104, 2x103, and 2x103 copies per reaction for L28) of purified amplicons for SR-A and L28.

Western Blotting
Human MDMs, THP-1 cell line, and freshly isolated blood monocytes (when indicated) were washed twice with PBS and harvested in the extraction buffer (120 mmol/L sodium chloride, 50 mmol/L Tris, 20 mmol/L sodium fluoride, 1 mmol/L benzamidine, 1 mmol/L DTT, 1 mmol/L EDTA, 6 mmol/L EGTA, 15 mmol/L sodium pyrophosphate, 0.8 µg/mL leupeptin, 30 mmol/L p-nitrophenyl phosphate, 0.1 mmol/L phenyl-methane-sulfonyl fluoride, and 1% NP-40) for immunoblotting. All cell debris was removed by centrifugation (12 000g) for 10 minutes at 4°C. The protein extracts (20 µg) were treated with 5x Laemmli’s SDS-PAGE sample buffer (0.35 mol/L Tris-Cl, pH 6.8, 15% SDS, 56.5% glycerol, 0.0075% bromophenol blue), followed by heating at 99°C for 5 minutes, and then applied to 10% SDS–polyacrylamide gel for electrophoresis. The proteins were then transferred onto Immobilon-P filter papers (Millipore AG, Bedford, Mass) with a semidry transfer unit (Hoefer Scientific, San Francisco, Calif). The membranes were then blocked by use of 5% skim milk in TBS-Tween buffer (0.1% Tween 20, pH 7.5) for 1 hour and incubated overnight with anti–human SR-A (1:500, TransGenic, Kobe, Japan), anti–human lectin-like oxLDL receptor 1 (LOX-1; 1:4000, R&D Systems, Bad Nauheim, Germany), anti–phospho-Thr-642 PKCβ1 (1:1000, Biosource, Nivelles, Belgium), anti-PKCβ1 (1:1000, Santa Cruz), and anti-CD14 (1:1000, Dako Cytomation, Baar, Switzerland) antibodies in 0.5% BSA PBS. Antigen detection was performed with an enhanced chemiluminescence detection system (Amersham Biosciences, Otelfingen, Switzerland).

LDL Uptake Measurement by Flow Cytometry
After incubation with DiI-acLDL (10 µg/mL) and DiI-oxLDL (10 µg/mL), human MDMs both freshly isolated and from the THP-1 cell line were subjected to flow cytometry to measure the amount of internalized LDL. Adherent and nonadherent cells were harvested by gentle scraping. Cells were then washed twice with PBS and resuspended in 0.2% BSA in PBS. Samples were analyzed with the FACScanto II flow cytometer and Flowjo software.

Measurements of Superoxide Anion Production
Superoxide production in MDMs, both freshly isolated and from the THP-1 cell line, treated with LY379196 (10–6 mol/L) and silencing of PKCβ was determined by electron spin resonance spectroscopy analysis using the spin trap CM-H (1-hydroxy-3-methoxycarbonyl-2,2,5,5-tetramethylpyrrolidine, Noxygen, Elzach, Germany) as described previously.22 In brief, MDMs were centrifuged (380g for 5 minutes) and resuspended in Krebs-HEPES buffer (pH 7.35) containing diethyldithiocarbamate (5 µmol/L) and deferoxamine (25 µmol/L). Electron spin resonance spectra were recorded using a Bruker e-scan electron spin resonance spectrometer (Bruker Corp, Fällenden, Switzerland) after the addition of the spin trap CM-H (200 µmol/L) under stable temperature conditions (37°C; temperature-controlled system). The electron spin resonance instrumental settings were as follows: center field, 3495 G; field sweep width, 10.000 G; microwave frequency, 9.75 GHz; microwave power, 19.91 mW; magnetic field modulation frequency, 86.00 kHz; modulation amplitude, 2.60 G; conversion time, 10.24 ms; detector time constant, 328 ms; and number of x scans, 10.

Confocal Fluorescent Microscopy
Human MDMs were washed once with PBS, fixed in 4% paraformaldehyde for 10 minutes, washed again with PBS, blocked with 0.1 mol/L glycine for 5 minutes, permeabilized with 0.2% Triton 100 for 7 minutes, and incubated overnight with anti–human SR-A (TransGenic), anti-PKCβ1 (Biosource), anti-PKCβ2 (Biosource), or anti-CD68 (Dako Cytomation) antibody in 0.2% BSA. Afterward, the cells were washed 3 times with PBS and incubated with secondary Alexa Fluor 488–labeled antibody (Molecular Probes, Eugene, Ore) in 0.2% BSA for 1 hour. Cells were counterstained with 4', 6 diamidino-2-phenylindol (DAPI; Vector Laboratories, Burlingame, Calif) and analyzed with a Leica confocal laser microscope.

Drugs
LY379196 was provided by Eli Lilly (Indianapolis, Ind). CGP53353 was kindly provided by Dr Doriano Fabbro (Novartis Pharma AG, Basel, Switzerland). Calphostin C, PMA, and myr-{psi}PKC were purchased from Calbiochem. Lipopolysaccharide was obtained from Sigma.

Statistical Analysis
Results are expressed as mean±SEM, and n indicates the number of experiments. Statistical evaluation of the data was performed with Student’s t test for simple comparisons between 2 values when appropriate. For multiple comparisons, results were analyzed by ANOVA followed by Fisher’s exact test. A value of P<0.05 was considered statistically significant.

The authors had full access to and take full responsibility for the integrity of the data. All authors have read and agree to the manuscript as written.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowConclusions
down arrowReferences
 
Role of PKCβ in Mediating Human MDM Foam Cell Formation
The differentiation of human primary monocytes and monocytic THP-1 cell line into macrophages (MDMs) was induced by PMA (0.1 µmol/L). Incubation of human MDMs with DiI-acLDL (10 µg/mL) led to binding of acLDL to the plasma membrane and accumulation of lipoproteins into the cytoplasm as assessed by fluorescence microscopy (Figure 1A). The nonselective inhibitor of both PKCβ isoforms, LY379196 (10–6 mol/L), abolished acLDL uptake in MDMs as shown in Figure 1B. To identify the isoform of PKCβ involved, human MDMs were exposed to selective antibodies against PKCβ1 and PKCβ2. PKCβ isoforms were localized in the nucleus and in the cytoplasm of MDMs, showing an activated state of the enzyme. The PKCβ1 isoform was distributed homogeneously within the cytoplasm and plasma membrane (Figure 1C), whereas PKCβ2 was present in the perinuclear patch and plasma membrane (Figure 1D).


Figure 1191248
View larger version (72K):
[in this window]
[in a new window]

 
Figure 1. A, Fluorescent confocal microscopy of human MDMs after incubation with DiI-acLDL. Red particles in the cytoplasm represent internalized DiI-acLDL. B, LY379196 (5x10–6 mol/L) abolished modified LDL uptake. In human MDMs, green staining shows intracellular distribution of PKCβ1 (C) and PKCβ2 (D). Nuclei stained blue with DAPI.

Accordingly, LY379196 showed a dose-dependent decrease in both acLDL and oxLDL uptake in MDMs by flow cytometry (Figure 2A and 2B). In contrast, the selective inhibitor of PKCβ2, CGP53353, did not exert any significant effect (data not shown).


Figure 2191248
View larger version (29K):
[in this window]
[in a new window]

 
Figure 2. Fluorescent-activated cell sorter analysis of human MDMs in the presence or absence of LY379196 after 24 hours of incubation with DiI-acLDL (A) and DiI-oxLDL (B). LY379196 (5x10–6 mol/L) blunted modified LDL uptake (blue). CGP53353 did not show any significant effect (data not shown). LY379196 exerted a dose-dependent inhibition of acLDL (A) and oxLDL (B) uptake. Results are presented as mean±SEM; n=4 in each group. *P<0.05 vs PMA plus acLDL or oxLDL.

Effect of PKCβ Inhibition on SR-A Expression
To delineate the molecular mechanism by which LY379196 blunted modified LDL uptake, MDM gene and protein expression of SR-A was determined. Quiescent cells did not express SR-A mRNA; stimulation with PMA (0.1 µmol/L) increased SR-A expression (Figure 3). A more pronounced upregulation of SR-A expression was achieved by the addition of acLDL (10 µg/mL) to the medium. SR-A mRNA expression was abolished by treatment with LY379196 (10–6 mol/L), whereas CGP53353 (10–6 mol/L) did not exert any inhibitory effect on PMA/acLDL-induced SR-A expression in human MDMs (Figure 3). In agreement with these results, SR-A protein expression was increased after exposure to acLDL as and oxLDL (Figure 4A and 4B). Treatment with LY379196, but not with CGP53353, totally abrogated PMA/acLDL-induced macrophage SR-A expression (Figure 4A). MDMs exposed to oxLDL in the presence of LY379196 (10–6 mol/L) showed similar results (Figure 4B). A myristoylated cell-permeable myr-{psi}PKC inhibitory peptide was used to confirm the modulatory role of PKCβ on SR-A expression. Like LY379196, the inhibitory peptide myr-{psi}PKC (10–4 mol/L) significantly blunted SR-A protein expression in human MDMs (Figure 4C).


Figure 3191248
View larger version (10K):
[in this window]
[in a new window]

 
Figure 3. Expression of SR-A in PMA-induced human MDMs and after incubation with acLDL in the presence and absence of LY379196 (10–6 mol/L) or CGP53353 (10–6 mol/L). SR-A mRNA expression assessed by real-time PCR is normalized to L28 mRNA. Results are presented as mean±SEM; n=3 in each group. *P<0.05 vs control; **P<0.05 vs PMA alone; {dagger}P<0.05 vs PMA plus acLDL.


Figure 4191248
View larger version (36K):
[in this window]
[in a new window]

 
Figure 4. Representative Western blot and densitometric quantification of SR-A protein expression in PMA-induced human MDMs and after incubation with acLDL (A) and oxLDL (B) in the presence and absence of LY379196 (10–6 mol/L) or CGP53353 (10–6 mol/L). C, The inhibitory effect of myristoylated cell-permeable peptide, myr-{psi}PKC, on SR-A protein expression in PMA-induced human MDMs after incubation with acLDL. D, LOX-1 protein expression in PMA-induced human MDMs and after incubation with acLDL and oxLDL in the presence and absence of LY379196. Results are presented as mean±SEM; n=4 in each group. *P<0.05 vs control; **P<0.05 vs PMA alone; {dagger}P<0.05 vs PMA plus acLDL or oxLDL.

In contrast to SR-A, LOX-1 protein expression did not change after exposure of MDMs to modified LDL. Furthermore, LY379196 (10–6 mol/L) did not exert any significant effect on LOX-1 expression (Figure 4D).

Effect of Silencing PKCβ on LDL Uptake and SR-A Expression
The transfection of PKCβ siRNA into MDMs resulted in reduced expression of the protein, whereas the GAPDH and mock controls did not exert any significant effect (Figure 5A). Using flow cytometry, we examined the DI-acLDL uptake by the transfected cells. PKCβ silencing reduced the uptake and blunted SR-A protein expression, reproducing the same effect as the pharmacological inhibitor LY379196 (Figure 5B and 5C).


Figure 5191248
View larger version (23K):
[in this window]
[in a new window]

 
Figure 5. Representative Western blot and densitometric quantification of PKCβ (A) and SR-A (C) protein expression after transfection of selective PKCβ siRNA into MDMs. B, Fluorescent-activated cell sorter analysis of transfected human MDMs after 24 hours of incubation with DiI-acLDL. On silencing of PKCβ, the uptake of modified LDL and SR-A expression is reduced. GAPDH and mock served as controls. Results are presented as mean±SEM; n=4 in each group. *P<0.05 vs mock and GAPDH.

Role of Thr-642 Phosphorylation in PKCβ1-Mediated SR-A Expression
Western blotting with an antibody against phosphorylated PKCβ1 at a specific amino residue revealed that incubation of the cells with PMA/acLDL increased Thr-642 phosphorylation within the catalytic domain of this molecule (Figure 6). The inhibitor of both PKCβ isoforms, LY379196 (10–6 mol/L), and the inhibitory peptide myr-{psi}PKC (10–4 mol/L) blunted PMA/acLDL-induced Thr-642 phosphorylation (Figure 6), suggesting that phosphorylation of PKCβ1 at Thr-642 may thus represent a selective regulatory mechanism for SR-A upregulation. Accordingly, the selective PKCβ2 inhibitor, CGP53353 (10–6 mol/L), did not affect Thr-642 phosphorylation (Figure 6).


Figure 6191248
View larger version (21K):
[in this window]
[in a new window]

 
Figure 6. Representative Western blot and densitometric quantification of PKCβ1 phosphorylation at the Thr-642 residue in PMA-induced human MDMs after incubation with acLDL in the presence and absence of LY379196 (10–6 mol/L), CGP53353 (10–6 mol/L), or myr-{psi}PKC (10–4 mol/L). Results are presented as mean±SEM; n=4 in each group. *P<0.05 vs control; **P<0.05 vs PMA alone; {dagger}P<0.05 vs PMA plus acLDL.

Effect of PKCβ Inhibition on Macrophage Activation and Functioning
As shown by confocal microscopy, high levels of SR-A expression in MDMs stimulated with acLDL were blunted in the presence of LY379196 (Figure 7A and 7B). However, LY379196 did not exert any effect on the expression of CD68, a marker of macrophage activation (Figure 7C and 7D). In addition, human MDMs were exposed to lipopolysaccharide (100 ng/mL) to rule out an effect of PKCβ inhibition on macrophage functioning in innate immunity. Lipopolysaccharide elicited degradation of CD14 and secretion of TNF{alpha}, crucial steps in the activation of innate immunity (Figure 8A and 8B). Interestingly enough, increasing concentrations of LY379196 did not inhibit either lipopolysaccharide-induced CD14 degradation (Figure 8A) or TNF{alpha} release (Figure 8B). Treatment with LY379196 did not elicit any release of lactate dehydrogenase (data not shown), ruling out that its effects on human MDMs were due to cellular toxicity. In agreement with this finding, no apoptotic nuclei by DAPI staining were observed (Figure 7). Furthermore, the effect of LY379196 (10–6 mol/L) on the ability of macrophages to produce superoxide anion (O2) was measured. No significant changes in O2 production were observed (Figure 8C). In addition, silencing of PKCβ did not affect O2 production (data not shown).


Figure 7191248
View larger version (68K):
[in this window]
[in a new window]

 
Figure 7. Treatment with LY379196 (10–6 mol/L) affects SR-A expression but not activation of human MDMs stimulated with acLDL. SR-A (A, B) and CD68, a marker of macrophage activation (C, D), are shown by fluorescent confocal microscopy. The nuclei stained with DAPI are blue; SR-A and CD68 stainings are both green.


Figure 8191248
View larger version (20K):
[in this window]
[in a new window]

 
Figure 8. LY379196 did not inhibit lipopolysaccharide-induced CD14 degradation, TNF{alpha} release, or O2) production in human MDMs. Representative Western blot and densitometric quantification of CD14 expression (A) and TNF{alpha} levels in supernatant (B) after 24 hours of stimulation with lipopolysaccharide (100 ng/mL). O2 production after incubation with acLDL and oxLDL (10 µg/mL; C). Results are presented as mean±SEM; n=3 to 5 in each group.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowConclusions
down arrowReferences
 
Accumulation of cholesterol-loaded foam cells in the arterial intima is a hallmark and key event of early atherogenesis.23 Circulating monocytes adhere to activated endothelial cells and transmigrate into the subintima to become tissue macrophages. On exposure to modified lipoproteins such as the oxLDL and acLDL, these macrophages become foam cells.24 Two receptors appear to be essential in foam cell formation and receptor-mediated binding/uptake of modified lipoproteins: CD36 and SR-A.25 Despite increasing evidence supporting that PKC is involved in many mechanisms promoting atherosclerosis,16 only a few studies have examined the role of PKC signaling in foam cell formation.20,26

In this study, we demonstrated that inhibition of PKCβ prevents uptake of modified LDL by reducing human MDM SR-A expression. Several lines of evidence support this conclusion. First, fluorescent-activated cell sorter analysis revealed that the nonselective inhibitor of PKCβ isoforms blunted modified LDL uptake of human MDMs. Second, silencing of PKCβ by siRNA transfection also reduced LDL uptake. Third, we observed a selective Thr-642 phosphorylation within the catalytic domain of PKCβ1 and an increase in SR-A mRNA and protein expression in human MDMs exposed to modified LDL. Fourth, both LY379196 and the inhibitory peptide myr-{psi}PKC blunted phosphorylation of Thr-642 and upregulation of SR-A. In contrast, CGP53353, the selective inhibitor of PKCβ2,7 did not exert any significant effect.

Expression and function of macrophage SR-A play a crucial role in the pathogenesis of atherosclerosis.27,28 Accordingly, SR-A gene–deficient mice bred with atherosclerosis-prone ApoE–/– or LDLrec–/– mice have been found to develop less atherosclerosis.29 We recently showed that ApoE–/– mice simultaneously lacking c-Jun N-terminal kinase 2 (ApoE–/–/JNK2–/– mice) developed less atherosclerosis than ApoE–/– mice.30 Macrophages lacking c-Jun N-terminal kinase 2 displayed markedly decreased phosphorylation of SR-A and hence suppressed foam cell formation.30 Thus, upstream signaling molecules that regulate the expression and function of SR-A may represent potential targets for therapeutic interventions.24 The present findings clearly indicate that SR-A expression in human MDMs is regulated by PKCβ. In contrast to SR-A, LOX-1 expression did not change after stimulation of MDMs with modified LDL. Furthermore, LY379196 did not exert any significant effect on LOX-1. Because SR-A expression was enhanced on modified LDL stimulation and not LOX-1, we conclude that SR-A might be the primary receptor for modified LDL uptake.

Several studies have strongly implicated activation of PKCβ in the pathogenesis of the vascular complications of diabetes.31 The synthesis of isoform-specific inhibitors for PKCβ has provided not only important insights into diabetic cardiovascular disease but also effective drugs against diabetic microvascular complications.15,32,33 Glucose-induced activation of PKCβ may lead to endothelial dysfunction by causing activation of vascular NADPH oxidase, endothelial nitric oxide synthase uncoupling, and reactive oxygen species production.6,34 Furthermore, high glucose enhances human macrophage LOX-1 expression via PKCβ activation.20 Treatment with a PKCβ inhibitor prevents impaired endothelium-dependent vasodilation caused by hyperglycemia.5 We demonstrated that selective inhibition of PKCβ2 inhibits glucose-induced vascular cellular adhesion molecule-1 expression in human endothelial cells.7 Interestingly enough, our data unmask an antiatherosclerotic effect of PKCβ inhibitors even in the nondiabetic condition of hypercholesterolemia. Specific siRNA-mediated knockdown of PKCβ further supports our conclusion. Indeed, on silencing of PKCβ, LDL uptake was blunted, SR-A expression was reduced, and hence foam cell formation was prevented.

The molecular link between the PKCβ signaling pathway, SR-A upregulation, and uptake of modified LDL might involve Thr-642 phosphorylation within the catalytic domain of PKCβ1. Indeed, inhibition of PKCβ by either LY379196 or the inhibitory peptide myr-{psi}PKC blunting PMA/acLDL-induced Thr-642 phosphorylation abolished upregulation of SR-A and LDL uptake of human MDMs. In contrast, the selective inhibitor of PKCβ2, CGP53353, did not affect any of these events. According to our results, phosphorylation of PKCβ1 at Thr-642 represents a selective regulatory mechanism for SR-A upregulation and foam cell formation.

Of particular interest is the fact that in our study LY379196, as a drug targeting macrophages, prevented only foam cell formation without affecting macrophage host defense activity. Indeed, LY379196 blunted modified LDL uptake but did not affect the expression of CD68, a marker of macrophage activation.35 We also demonstrated that LY379196 did not inhibit lipopolysaccharide-induced CD14 degradation or TNF{alpha} release in human MDMs. Moreover, PKCβ knockdown or inhibition did not affect superoxide anion production. These findings rule out any effect of PKCβ inhibition on macrophage functioning in innate immunity. In agreement with our results, PKCβ-deficient mice have not been reported to present any impairment in macrophage activity.36 Although these mice show a reduced peritoneal population of B-1 lymphocytes, the absolute number of splenic B cells is similar to wild-type animals. Furthermore, the thymuses of PKCβ-deficient mice were of normal size and cellularity and contained CD4+CD8+ double-positive cells and CD4+ or CD8+ single-positive cells at normal ratios.36

Earlier studies of the role of vascular PKCβ activation in diabetes were focused primarily on microvascular dysfunction.37,38 Indeed, PKCβ inhibitors are currently being tested in clinical trials with microvascular end points.12–14


*    Conclusions
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*Conclusions
down arrowReferences
 
The results of our study suggest a role for PKCβ in atherogenesis even in the nondiabetic condition and anticipate the application of PKCβ inhibitors as putative antiatherosclerotic drugs. However, before deciding whether PKCβ inhibitors deserve to be tested in clinical trials of atherosclerosis, animal models will help evolve our current suggestive in vitro evidence concerning a proatherosclerotic role of PKCβ signaling.


*    Acknowledgments
 
We would like to thank Dr Anna Bogdanova for helping with superoxide anion measurements.

Sources of Funding

This work was supported in part by Swiss National Research Foundation grants 310000108463 (to Dr Cosentino) and 3100068118.02 (to Dr Lüscher) and a grant from the Swiss Heart Foundation (to Dr Kouroedov).

Disclosures

None.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
up arrowConclusions
*References
 
1. Ron D, Kazanietz MG. New insights into the regulation of protein kinase C and novel phorbol ester receptors. FASEB J. 1999; 13: 1658–1676.[Abstract/Free Full Text]

2. Edwards AS, Faux MC, Scott JD, Newton AC. Carboxyl-terminal phosphorylation regulates the function and subcellular localization of protein kinase C betaII. J Biol Chem. 1999; 274: 6461–6468.[Abstract/Free Full Text]

3. Sheetz MJ, King GL. Molecular understanding of hyperglycemia’s adverse effects for diabetic complications. JAMA. 2002; 288: 2579–2588.[Abstract/Free Full Text]

4. Inoguchi T, Battan R, Handler E, Sportsman JR, Heath W, King GL. Preferential elevation of protein kinase C isoform beta II and diacylglycerol levels in the aorta and heart of diabetic rats: differential reversibility to glycemic control by islet cell transplantation. Proc Natl Acad Sci U S A. 1992; 89: 11059–11063.[Abstract/Free Full Text]

5. Beckman JA, Goldfine AB, Gordon MB, Garrett LA, Creager MA. Inhibition of protein kinase Cbeta prevents impaired endothelium-dependent vasodilation caused by hyperglycemia in humans. Circ Res. 2002; 90: 107–111.[Abstract/Free Full Text]

6. Cosentino F, Eto M, De Paolis P, van der Loo B, Bachschmid M, Ullrich V, Kouroedov A, Delli Gatti C, Joch H, Volpe M, Luscher TF. High glucose causes upregulation of cyclooxygenase-2 and alters prostanoid profile in human endothelial cells: role of protein kinase C and reactive oxygen species. Circulation. 2003; 107: 1017–1023.[Abstract/Free Full Text]

7. Kouroedov A, Eto M, Joch H, Volpe M, Luscher TF, Cosentino F. Selective inhibition of protein kinase Cbeta2 prevents acute effects of high glucose on vascular cell adhesion molecule-1 expression in human endothelial cells. Circulation. 2004; 110: 91–96.[Abstract/Free Full Text]

8. Birch KA, Heath WF, Hermeling RN, Johnston CM, Stramm L, Dell C, Smith C, Williamson JR, Reifel-Miller A. LY290181, an inhibitor of diabetes-induced vascular dysfunction, blocks protein kinase C-stimulated transcriptional activation through inhibition of transcription factor binding to a phorbol response element. Diabetes. 1996; 45: 642–650.[Abstract]

9. Faul MM, Gillig JR, Jirousek MR, Ballas LM, Schotten T, Kahl A, Mohr M. Acyclic N-(azacycloalkyl)bisindolylmaleimides: isozyme selective inhibitors of PKCbeta. Bioorg Med Chem Lett. 2003; 13: 1857–1859.[CrossRef][Medline] [Order article via Infotrieve]

10. Jirousek MR, Gillig JR, Gonzalez CM, Heath WF, McDonald JH 3rd, Neel DA, Rito CJ, Singh U, Stramm LE, Melikian-Badalian A, Baevsky M, Ballas LM, Hall SE, Winneroski LL, Faul MM. (S)-13-[(dimethylamino)methyl]-10,11,14,15-tetrahydro-4,9:16, 21-dimetheno-1H,13H-dibenzo[e,k]pyrrolo[3,4-h][1,4,13]oxadiazacyclohexadecene-1,3(2H)-dione (LY333531) and related analogues: isozyme selective inhibitors of protein kinase C beta. J Med Chem. 1996; 39: 2664–2671.[CrossRef][Medline] [Order article via Infotrieve]

11. Campochiaro PA, for the C99-PKC412–003 Study Group. Reduction of diabetic macular edema by oral administration of the kinase inhibitor PKC412. Invest Ophthalmol Vis Sci. 2004; 45: 922–931.[Abstract/Free Full Text]

12. PKC-DRS Study Group. The effect of ruboxistaurin on visual loss in patients with moderately severe to very severe nonproliferative diabetic retinopathy: initial results of the Protein Kinase C Beta Inhibitor Diabetic Retinopathy Study (PKC-DRS) multicenter randomized clinical trial. Diabetes. 2005; 54: 2188–2197.[Abstract/Free Full Text]

13. Aiello LP, Clermont A, Arora V, Davis MD, Sheetz MJ, Bursell SE. Inhibition of PKC beta by oral administration of ruboxistaurin is well tolerated and ameliorates diabetes-induced retinal hemodynamic abnormalities in patients. Invest Ophthalmol Vis Sci. 2006; 47: 86–92.[Abstract/Free Full Text]

14. Tuttle KR, Bakris GL, Toto RD, McGill JB, Hu K, Anderson PW. The effect of ruboxistaurin on nephropathy in type 2 diabetes. Diabetes Care. 2005; 28: 2686–2690.[Abstract/Free Full Text]

15. Vinik A. The protein kinase C-beta inhibitor, ruboxistaurin, for the treatment of diabetic microvascular complications. Expert Opin Investig Drugs. 2005; 14: 1547–1559.[CrossRef][Medline] [Order article via Infotrieve]

16. Rask-Madsen C, King GL. Proatherosclerotic mechanisms involving protein kinase C in diabetes and insulin resistance. Arterioscler Thromb Vasc Biol. 2005; 25: 487–496.[Abstract/Free Full Text]

17. Llaverias G, Noe V, Penuelas S, Vazquez-Carrera M, Sanchez RM, Laguna JC, Ciudad CJ, Alegret M. Atorvastatin reduces CD68, FABP4, and HBP expression in oxLDL-treated human macrophages. Biochem Biophys Res Commun. 2004; 318: 265–274.[CrossRef][Medline] [Order article via Infotrieve]

18. Beckman JA, Creager MA, Libby P. Diabetes and atherosclerosis: epidemiology, pathophysiology, and management. JAMA. 2002; 287: 2570–2581.[Abstract/Free Full Text]

19. Idris I, Gray S, Donnelly R. Protein kinase C activation: isozyme-specific effects on metabolism and cardiovascular complications in diabetes. Diabetologia. 2001; 44: 659–673.[CrossRef][Medline] [Order article via Infotrieve]

20. Li L, Sawamura T, Renier G. Glucose enhances human macrophage LOX-1 expression: role for LOX-1 in glucose-induced macrophage foam cell formation. Circ Res. 2004; 94: 892–901.[Abstract/Free Full Text]

21. Ward NE, O'Brian CA. Inhibition of protein kinase C by N-myristoylated peptide substrate analogs. Biochemistry. 1993; 32: 11903–11909.[CrossRef][Medline] [Order article via Infotrieve]

22. Spiekermann S, Landmesser U, Dikalov S, Gamez G, Tatge H, Hornig B, Drexler H, Harrison DG. Electron spin resonance characterization of vascular NAD(P)H- and xanthine-oxidase-activity in patients with coronary artery disease: relation to endothelium-dependent vasodilation. Circulation. 2003; 107: 1383–1389.[Abstract/Free Full Text]

23. Osterud B, Bjorklid E. Role of monocytes in atherogenesis. Physiol Rev. 2003; 83: 1069–1112.[Abstract/Free Full Text]

24. Li AC, Glass CK. The macrophage foam cell as a target for therapeutic intervention. Nat Med. 2002; 8: 1235–1242.[CrossRef][Medline] [Order article via Infotrieve]

25. Kunjathoor VV, Febbraio M, Podrez EA, Moore KJ, Andersson L, Koehn S, Rhee JS, Silverstein R, Hoff HF, Freeman MW. Scavenger receptors class A-I/II and CD36 are the principal receptors responsible for the uptake of modified low density lipoprotein leading to lipid loading in macrophages. J Biol Chem. 2002; 277: 49982–49988.[Abstract/Free Full Text]

26. Feng J, Han J, Pearce SF, Silverstein RL, Gotto AM Jr, Hajjar DP, Nicholson AC. Induction of CD36 expression by oxidized LDL and IL-4 by a common signaling pathway dependent on protein kinase C and PPAR-gamma. J Lipid Res. 2000; 41: 688–696.[Abstract/Free Full Text]

27. Steinberg D, Parthasarathy S, Carew TE, Khoo JC, Witztum JL. Beyond cholesterol: modifications of low-density lipoprotein that increase its atherogenicity. N Engl J Med. 1989; 320: 915–924.[Medline] [Order article via Infotrieve]

28. Kosswig N, Rice S, Daugherty A, Post SR. Class A scavenger receptor-mediated adhesion and internalization require distinct cytoplasmic domains. J Biol Chem. 2003; 278: 34219–34225.[Abstract/Free Full Text]

29. Lessner SM, Prado HL, Waller EK, Galis ZS. Atherosclerotic lesions grow through recruitment and proliferation of circulating monocytes in a murine model. Am J Pathol. 2002; 160: 2145–2155.[Abstract/Free Full Text]

30. Ricci R, Sumara G, Sumara I, Rozenberg I, Kurrer M, Akhmedov A, Hersberger M, Eriksson U, Eberli FR, Becher B, Boren J, Chen M, Cybulsky MI, Moore KJ, Freeman MW, Wagner EF, Matter CM, Luscher TF. Requirement of JNK2 for scavenger receptor A-mediated foam cell formation in atherogenesis. Science. 2004; 306: 1558–1561.[Abstract/Free Full Text]

31. Creager MA, Luscher TF, Cosentino F, Beckman JA. Diabetes and vascular disease: pathophysiology, clinical consequences, and medical therapy, part I. Circulation. 2003; 108: 1527–1532.[Free Full Text]

32. Koya D, Haneda M, Nakagawa H, Isshiki K, Sato H, Maeda S, Sugimoto T, Yasuda H, Kashiwagi A, Ways DK, King GL, Kikkawa R. Amelioration of accelerated diabetic mesangial expansion by treatment with a PKC beta inhibitor in diabetic db/db mice, a rodent model for type 2 diabetes. FASEB J. 2000; 14: 439–447.[Abstract/Free Full Text]

33. Avignon A, Sultan A. PKC-B inhibition: a new therapeutic approach for diabetic complications? Diabetes Metab. 2006; 32: 205–213.[CrossRef][Medline] [Order article via Infotrieve]

34. Inoguchi T, Li P, Umeda F, Yu HY, Kakimoto M, Imamura M, Aoki T, Etoh T, Hashimoto T, Naruse M, Sano H, Utsumi H, Nawata H. High glucose level and free fatty acid stimulate reactive oxygen species production through protein kinase C–dependent activation of NAD(P)H oxidase in cultured vascular cells. Diabetes. 2000; 49: 1939–1945.[Abstract]

35. Gordon S. Macrophage-restricted molecules: role in differentiation and activation. Immunol Lett. 1999; 65: 5–8.[CrossRef][Medline] [Order article via Infotrieve]

36. Leitges M, Schmedt C, Guinamard R, Davoust J, Schaal S, Stabel S, Tarakhovsky A. Immunodeficiency in protein kinase Cbeta-deficient mice. Science. 1996; 273: 788–791.[Abstract]

37. Ishii H, Jirousek MR, Koya D, Takagi C, Xia P, Clermont A, Bursell SE, Kern TS, Ballas LM, Heath WF, Stramm LE, Feener EP, King GL. Amelioration of vascular dysfunctions in diabetic rats by an oral PKC beta inhibitor. Science. 1996; 272: 728–731.[Abstract]

38. Idris I, Gray S, Donnelly R. Protein kinase C-beta inhibition and diabetic microangiopathy: effects on endothelial permeability responses in vitro. Eur J Pharmacol. 2004; 485: 141–144.[CrossRef][Medline] [Order article via Infotrieve]


 

CLINICAL PERSPECTIVE

Low-density lipoprotein (LDL) uptake by monocyte-derived macrophages is a hallmark and key event of early atherogenesis. On exposure to modified lipoproteins such as oxidized LDL and acetylated LDL, these macrophages become foam cells. Increasing evidence supports that activation of PKCβ is involved in many mechanisms promoting atherosclerosis. In this study, we demonstrate that inhibition of protein kinase Cβ (PKCβ) prevents uptake of modified LDL by reducing human monocyte-derived macrophage scavenger receptor A expression. Several studies have strongly implicated activation of PKCβ in the pathogenesis of the vascular complications of diabetes. The synthesis of isoform-specific inhibitors for PKCβ has provided not only important insights into diabetic cardiovascular disease but also effective drugs against its microvascular complications. Interestingly enough, our data unmask an antiatherosclerotic effect of PKCβ inhibitors even in the nondiabetic condition of hypercholesterolemia. Specific siRNA-mediated knockdown of PKCβ further supports our conclusion. Indeed, on silencing of PKCβ, LDL uptake was blunted, scavenger receptor A expression was reduced, and hence foam cell formation was prevented. Of particular interest is the fact that in our study the PKCβ inhibitor LY379196, as a drug targeting macrophages, prevents only foam cell formation without affecting macrophage host defense activity. Although PKCβ inhibitors are currently being tested in clinical trials with microvascular end points, the present findings suggest a role for PKCβ in atherogenesis even in the nondiabetic condition and anticipate the application of PKCβ inhibitors as putative antiatherosclerotic drugs.


*    Footnotes
 
*The first 2 authors contributed equally to this work. Back


Related Article:

Clinical Summaries
Circulation 2008 118: 2115-2116. [Extract] [Full Text]



This article has been cited by other articles:


Home page
Circ. Res.Home page
Y. Etzion, A. Hackett, B. M. Proctor, J. Ren, B. Nolan, T. Ellenberger, and A. J. Muslin
An Unbiased Chemical Biology Screen Identifies Agents That Modulate Uptake of Oxidized LDL by Macrophages
Circ. Res., July 17, 2009; 105(2): 148 - 157.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
118/21/2174    most recent
CIRCULATIONAHA.108.789537v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Osto, E.
Right arrow Articles by Cosentino, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Osto, E.
Right arrow Articles by Cosentino, F.
Related Collections
Right arrow Pathophysiology
Right arrow Cell signalling/signal transduction
Right arrow Lipid and lipoprotein metabolism
Right arrow Other Vascular biology
Right arrowRelated Article