Published online before print September 15, 2008, doi: 10.1161/CIRCULATIONAHA.108.782300
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2008;118:1450-1459.)
© 2008 American Heart Association, Inc.
Stroke |
Activation of Liver X Receptors Promotes Neuroprotection and Reduces Brain Inflammation in Experimental Stroke
From the Department of Pharmacology, School of Medicine, Universidad Complutense de Madrid, Madrid (J.R.M., I.B., O.H., I.L., M.A.M.); School of Medicine, Universidad de Las Palmas, Las Palmas de Gran Canaria (J.M.D., A.C.); and Hospital Universitario La Princesa, Madrid (J.V., F.N.), Spain.
Correspondence to María A. Moro, Department of Pharmacology, School of Medicine, Universidad Complutense de Madrid, 28040 Madrid, Spain. E-mail neurona{at}med.ucm.es
Received June 8, 2007; accepted July 29, 2008.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionConclusionsReferences |
|---|
Background— The liver X receptors (LXRs) belong to the nuclear receptor superfamily and act as transcriptional regulators of cholesterol metabolism in several tissues. Recent work also has identified LXRs as potent antiinflammatory molecules in macrophages and other immune cells. Combined changes in lipid and inflammatory profiles are likely mediating the protective role of LXRs in models of chronic injury like atherosclerosis. These beneficial actions, however, have not been illustrated in other models of acute injury such as stroke in which inflammation is an important pathophysiological feature.
Methods and Results— We have studied LXR expression and function in the course of experimental stroke caused by permanent middle cerebral artery occlusion in rats and mice. Here, we show that administration of the synthetic LXR agonists GW3965 or TO901317 after the ischemic occlusion improves stroke outcome as shown by decreased infarct volume area and better neurological scores in rats. Neuroprotection observed with LXR agonists correlated with decreased expression of proinflammatory genes in the brain and with reduced nuclear factor-
B transcriptional activity. Loss of function studies using LXR
,β–/– mice demonstrated that the effect of LXR agonists is receptor specific. Interestingly, infarcted brain area and inflammatory signaling were significantly extended in LXR,β–/– mice compared with control animals, indicating that endogenous LXR signaling mediates neuroprotection in this setting.
Conclusion— This work highlights the transcriptional action of LXR as a protective pathway in brain injury and the potential use of LXR agonists as therapeutic agents in stroke.
Key Words: cerebral ischemia • inflammation • nervous system • nuclear receptors
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionConclusionsReferences |
|---|
Liver X receptors (LXRs)
and β (LXRβ), also known as NR1H3 and NR1H2, respectively, are ligand-activated transcription factors that belong to the nuclear receptor superfamily. Whereas LXR is expressed predominantly in liver, kidney, intestine, and tissue macrophages, LXRβ is expressed ubiquitously.1,2 LXRs are activated by certain cholesterol derivatives such as several oxidized cholesterol metabolites or oxysterols. LXRs activate gene expression through binding to promoter regions containing specific hexamer repeats (DR4 elements or LXRE) in association with the obligatory heterodimer partner, the retinoid X receptor, and thus regulate the expression of a number of genes involved in cholesterol metabolism.2,3 In addition, LXRs antagonize the expression of inflammatory genes activated by microbial components or proinflammatory cytokines in macrophages4,5 such as inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), several interleukins (IL-6, IL-1β), and matrix metalloproteinases (MMPs). The antiinflammatory actions of LXR agonists are observed in macrophages from either LXR–/– or LXRβ–/– mice but not in macrophages lacking both LXR isoforms (LXR,β–/–), suggesting that both receptors can repress inflammatory gene expression in a ligand-dependent manner. It is likely that LXR-dependent antiinflammatory properties are mediated by interaction of LXR with different factors involved in inflammatory gene expression such as the nuclear factor-B (NF-B) and small ubiquitin-related modifier (SUMO) pathways.4,6,7 These actions have been observed not only in macrophages but also in other settings, including the central nervous system; indeed, LXR agonists inhibit lipopolysaccharide-induced inflammatory responses in isolated microglia and astrocytes8–10 and play a protective role in experimental autoimmune encephalomyelitis.11 Apart from these antiinflammatory actions, LXRs control the expression of several genes important for cholesterol homeostasis in the brain,12,13 and LXR agonists reduce amyloid β-peptide formation14–16 in neural cells. All these actions may explain why LXR agonists are considered useful therapeutic tools in neurodegenerative situations associated with dysfunction of lipid metabolism such as Alzheimer’s disease17,18 and motor neuron degeneration19,20 or in metabolic disorders with brain degeneration such as Niemann-Pick disease.21
Clinical Perspective p 1459
All these pieces of evidence suggest that LXR activation could exert a protective role in other central nervous system pathologies in which inflammation is involved such as stroke. Therefore, we explored whether activation of LXR with synthetic agonists causes neuroprotective effects in experimental stroke in rats. We have used 2 structurally unrelated, synthetic nonsteroidal LXR agonists: GW3965, with EC50 from 30 to 190 nmol/L in different cell-based reporter gene assays,22 and TO901317,23 with an EC50 of 
50 nmol/L. We have explored further the role of endogenous LXR signaling during stroke with loss of function studies by using LXR,β–/– mice.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionConclusionsReferences |
|---|
Materials
GW3965 (3-[3-[N-(2-chloro-3-trifluoromethylbenzyl)-(2,2-diphenylethyl) amino]propyloxy] phenylacetic acid hydrochloride) was kindly donated by Jon Collins (GlaxoSmithKline, Research Triangle Park, NC), and TO901317 (N-(2,2,2-trifluoro-ethyl)-N-[4-(2,2,2-trifluoro-1-hydroxy-1-trifluoromethyl-ethyl)-phenyl]-benzenesulfonamide) was from Calbiochem (Merck Chemicals Ltd, Nottingham, UK). The rest of the reagents were from Sigma (Madrid, Spain) or as indicated.
Animals
Adult male Fischer rats (average weight, 225 to 250 g) were used. In addition, wild-type controls and Nr1h3–/–Nr1h2–/– double-mutant (LXR,β–/–) mice (average weight, 25 to 30 g) on a Sv129/C57BL/6 background were obtained through a collaboration with Drs David Mangelsdorf and Peter Tontonoz. All experimental protocols adhered to the guidelines of the Animal Welfare Committee of the Universidad Complutense (EU directives 86/609/CEE and 2003/65/CE).
Middle Cerebral Artery Occlusion
All experiments were performed in a randomized fashion by investigators blinded to treatment groups. Permanent focal cerebral ischemia was induced by occlusion of the ipsilateral middle cerebral artery (MCAO) by cauterization as described.24,25 Rats/mice in which the MCA was exposed but not occluded served as sham-operated controls (sham). After surgery, individual animals were returned to their cages with free access to water and food.
Experimental Groups
Several groups were used for determinations of infarct outcome in rats: MCAO followed 10 minutes later by an intraperitoneal injection of saline (n=8); dimethyl sulfoxide (vehicle; 10% in saline; n=10); 10, 20, and 50 mg/kg GW3965 (n=8 to 10); or 10, 20, and 50 mg/kg TO901317 (n=8 to 10). Sham-operated animals received an intraperitoneal injection of saline 10 minutes after the occlusion (sham; n=10). Another group of MCAO-exposed rats received either vehicle or 20 mg/kg GW3965 1 hour after the occlusion (n=8). Injection volume was 0.25 mL/250 g body weight. Other experiments were designed for infarct outcome determination in LXR,β–/– mice and their wild-type littermates (n=8). Additional groups for molecular determinations were used as indicated.
Infarct Size
Infarct size was determined 48 hours after MCAO as described.24,25 To exclude the brain edema effects, infarct area was corrected by the ratio of the entire area of the ipsilateral hemisphere to that of the contralateral. Infarct volume was calculated as an orthogonal projection. Infarct areas were represented according to their distance from the point of juncture of the coronal and sagittal skull sutures or bregma.
Neurological Characterization
Before death, sensorimotor performance was evaluated with a neurological deficit score.26 For mice, an additional evaluation was performed with the grip test.27 Weight loss from status before MCAO to that 48 hours after MCAO was assessed and represented as percent of the initial value. Two independent observers blinded to experimental procedure evaluated neurological characterization.
Protein Expression in Brain Homogenates and Nuclear Extracts
Brain tissue was collected from the peri-infarct areas at different times. For determination of inhibitor B (iB), iNOS, COX-2, and MMP-9, rats (n=6) were killed 18 hours after MCAO. For determination of ATP-binding cassette transporter (ABCA1) and LXRs, rats were killed 48 hours after MCAO (n=6). Homogenates were prepared as described.24,25
For determination of the nuclear NF-B subunit p65, rats (n=6) were killed 90 minutes after MCAO. Nuclear extracts were prepared as described.28
Western Blot Analysis
Western blot was performed as described.24,25 Incubation was performed with specific primary antibodies against LXR and LXRβ (ABCAM, Cambridge, UK; 1:1000), p65 (Santa Cruz Technology, Santa Cruz, Calif; 1:1000), IB (Santa Cruz, 1:1000), iNOS (Santa Cruz; 1:500), COX-2 (Santa Cruz, 1:1000), MMP-9 (Chemicon, Temecula, Calif; 1:2000), and ABCA1 (ABCAM, 1:1000). β-Actin and Sp1 levels were used as loading controls for total and nuclear protein expression, respectively.
Quantitative Real-Time Polymerase Chain Reaction
Total RNA was isolated from peri-infarct areas of brains of mice (n=6, killed 8 hours after MCAO) using Trizol reagent (Invitrogen, Barcelona, Spain). RNA (1 µg) was reverse transcribed with iScript cDNA Synthesis kit (Bio-Rad Laboratories, Alcobendas, Madrid, Spain). Quantitative real-time polymerase chain reaction was performed with a Bio-Rad iQ5 Thermocycler with triplicate samples and normalized to 36B4 levels. Specific primers for mouse genes were designed using Primer Express software (Applied Biosystems, Alcobendas, Madrid, Spain) and are as follows: mABCA1 (forward, GGTTTGGAGATGGTTATACAATAGTTGT; reverse, CCCGGAAACGCAAGTCC), mSREBP1c (forward, GGAGCCATGGATTGCACATT; reverse, GGCCCGGGAAGTCACTGT), mIL6 (forward, CCAGGTAGCTATGGTACTCCAGAA; reverse, GCTACCAAACTGGATATAATCAGGA), mIL12p40 (forward, TTGCTGGTGTCTCCACTCAT; reverse, GGGAGTCCAGTCCACCTCTA), mouse regulated on activation, normal T cell expressed and secreted (mRANTES) (forward, GTGCCCACGTCAAGGAGTAT; reverse, CCCACTTCTTCTCTGGGTTG), mMCP1 (forward, GATCATCTTGCTGGTGAATGAGT; reverse, CATCCACGTGTTGGCTCA), and m36B4 (forward, AGATGCAGCAGATCCGCAT; reverse, GTTCTTGCCCATCAGCACC).
Brain Concentrations of IL-1β and Tumor Necrosis Factor-
Supernatants from brain homogenates were used for determinations with a commercially available kit (Biotrak ELISA System, GEHealthcare, Barcelona, Spain).
Statistical Analysis
Results are expressed as mean±SEM of the indicated number of experiments; statistical analysis involved 1-way ANOVA (or the Mann–Whitney test when the data were not normally distributed), followed by individual comparisons of means (Student-Newman-Keuls or Dunn’s method when the data were not normally distributed). Values of P<0.05 were considered statistically significant.
The authors had full access to and take full responsibility for the integrity of the data. All authors have read and agree to the manuscript as written.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionConclusionsReferences |
|---|
LXR Agonists Are Protective in Experimental Stroke: Effects on Endogenous Gene Expression
Western blot protein analysis showed that LXRβ was robustly expressed in brain tissue of control rats, whereas LXR
levels were significantly lower (Figure 1). Exposure to MCAO resulted in a significant increase in LXR protein expression in the peri-infarct area after 48 hours, whereas LXRβ expression remained mostly unaffected. Protein levels of the LXR but not the LXRβ isoform were increased by treatment with GW3965 or TO901317 in sham but not significantly in MCAO-exposed animals (Figure 1). Results were unaffected by higher doses of LXR agonists (data not shown).
|
We also evaluated the effect of both GW3965 and TO901317 agonists on a well-known LXR target gene, the transporter ABCA1,29,30 in rat brain extracts. ABCA1 expression was not affected in MCAO-exposed animals but was potently induced by administration of GW3965 (20 mg/kg) or TO901317 (20 mg/kg) in the peri-infarct area, demonstrating that brain LXRs are being activated in a ligand-dependent manner after MCAO (Figure 2).
|
Therefore, we analyzed the infarct size after 48 hours in rats that received a systemic administration of LXR synthetic agonists after MCAO. First, no spontaneous mortality was found in the MCAO group, a result unaffected by LXR agonists. Activation of LXR by GW3965 or TO901317 (20 to 50 mg/kg; Figure 3) 10 minutes after the occlusion resulted in a significant decrease in MCAO-induced infarct size. Both ligands at 20 to 50 mg/kg, but not at 10 mg/kg, reduced MCAO-induced injury with equivalent efficacy. Importantly, similar effects were obtained when these drugs were administered as late as 1 hour after the occlusion (143.41±8.85 or 145.46±10.21 mm3 after 20 mg/kg GW3965 or 20 mg/kg TO901317, respectively, versus 180.43±7.67 mm3 in MCAO plus vehicle; n=8 to 10; P<0.05).
|
Rats treated with LXR synthetic agonists showed better scores in a neurological assessment scale after MCAO (Table 1). Furthermore, MCAO-induced weight loss was lower in those rats receiving LXR agonists (10.47±0.36% in control versus 8.01±0.76% and 7.70±0.72% after 20 mg/kg GW3965 and TO901317, respectively; n=8 to 10; P<0.05).
|
Effect of LXR Agonists on Ischemia-Induced Inflammatory Gene Expression and NF-B Transcriptional Activity
Next, we analyzed the expression of proinflammatory markers in brain homogenates from peri-infarct tissue of MCAO-injured rats. Acute expression of inflammatory mediators such as iNOS, COX-2, and MMP-9 and proinflammatory cytokines, including tumor necrosis factor- (TNF-) and IL-1β (reviewed elsewhere31), participates in brain damage after stroke. MCAO resulted in potent induction of iNOS and COX-2, as shown by the levels found 18 hours after MCAO (Figure 4). Administration of GW3965 or TO901317 inhibited MCAO-induced expression of iNOS and COX-2 levels at the time examined (Figure 4).
|
MMP-9 mediates damage in cerebral ischemia.32 MCAO caused an increase in the levels of mature MMP-9 and its precursor pro-MMP-9 (Figure 4). The LXR agonists GW3965 and TO901317 decreased the levels of both forms of this metalloproteinase after MCAO (Figure 4).
MCAO resulted in brain accumulation of IL-1β and TNF- 18 hours after the ischemic insult. Administration of the LXR agonists GW3965 and TO901317 decreased MCAO-induced expression of IL-1β but not of TNF- (Figure 5). The LXR agonists did not modify the levels of all these mediators in animals not exposed to MCAO (data not shown).
|
NF-B is a transcription factor with a key role in the expression of a variety of genes involved in inflammatory responses.33 As a sign of its activation, the nuclear levels of its subunit p65 were determined 90 minutes after MCAO. Experimental ischemia caused activation of NF-B as revealed by the nuclear translocation of p65, as well as an increase in the late levels (18 hours after MCAO) of IB, an indicator of an increase in NF-B transcriptional activity.34,35 As expected, the LXR agonists GW3965 and TO901317 (20 mg/kg) did not modify p65 nuclear levels after MCAO (Figure 6) but decreased the levels of the NF-B target gene IB.
|
Infarct Outcome and Expression of Inflammatory and LXR Target Genes in LXR,β–/– Mice After MCAO
Finally, we used genetic tools to analyze the effect of endogenous LXR signaling in response to stroke injury. To this end, we characterized the MCAO model in C57/BL6-Sv129 mixed-background wild-type and LXR,β–/– mice. No spontaneous mortality in both mice strains after MCAO was found, and this was not affected by LXR agonists. As shown in Figure 7, administration of GW3965 agonist reduced infarct lesion in wild-type animals, whereas no significant changes were observed in LXR-deficient mice under the same experimental conditions. Of note, larger infarcted areas were observed in mice lacking both LXR isoforms compared with control mice (Figure 7). When the neurological test was applied to this set of mice, worse performance in both neurological deficit score and grip test demonstrated a protective action in wild-type mice treated with GW3965, whereas LXR,β–/– mice showed poorer neurological status (Table 2). Weight loss in wild-type mice (10.62±0.68%) was reduced by treatment with 20 mg/kg GW3965 (6.10±0.81%; n=8; P<0.05). However, weight loss was unaffected by treatment with LXR agonist in LXR,β–/– mice (11.76± 0.56% versus 10.84±1.10% in vehicle versus 20 mg/kg GW3965; n=8; P>0.05).
|
|
As expected, mRNA expression of the LXR target genes ABCA129,30 and SREBP-1c36 was increased by LXR agonists in wild-type mice but not in LXR,β–/– mice and was unaffected by the MCAO procedure. In addition, the expression of MCAO-induced NF-B target genes such as the inflammatory cytokines IL-6 and the IL-12 p40 monomer and the chemoattractant chemokines regulated on activation, normal T cell expressed and secreted (RANTES) and monocyte chemoattractant protein-1 (reviewed elsewhere37) was inhibited by the LXR agonist GW3965 in wild-type but not in LXR,β–/– mice (Figure 8).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionConclusionsReferences |
|---|
Because the inflammatory cascade triggered by the ischemic injury in both occluded blood vessels and brain parenchyma is an important feature of the pathophysiological response to the ischemic injury, antiinflammatory strategies may be useful for acute stroke treatment. We have therefore studied the role of the LXR nuclear receptor, which is involved in cholesterol and lipid metabolism but also exerts antiinflammatory effects, on infarct outcome after experimental stroke. Our data show that the activation of the LXR receptor mediates potent neuroprotection in this setting.
First, we have explored the presence of LXR receptors both in healthy rat brain and after ischemia. Whereas LXRβ is ubiquitously expressed, LXR expression is restricted to few tissues (reviewed in Reference 1). Here we show that LXRβ is indeed expressed in brain at levels that are not significantly changed after exposure to ischemia, whereas the expression of LXR is very low in brain, in agreement with previous reports showing that LXRβ is the form predominantly expressed in brain tissue.12,13 More interesting, we have found that LXR expression is robustly induced in rat brain after the ischemic insult. Thus, apart from LXRβ, our data support the existence of an additional target for LXR agonists in ischemic brain. This is the first evidence in the literature that LXR is induced in brain after a deleterious stimulus such as cerebral ischemia, suggesting an endogenous role of this receptor in this pathology, as discussed below.
Because both LXR isoforms are present in brain after MCAO, we tested the effect of their activation by exogenous ligands. As LXR agonists, we have used the nonsteroidal GW3965, an LXR full agonist on both LXR and LXRβ,22 and the compound TO901317.23 To elucidate whether these molecules are capable of accessing the brain, we studied their effect on a bona fide parameter of LXR transcriptional activity, the ABCA1 transporter (reviewed elsewhere1,2). Both caused a robust expression of ABCA1 in the ischemic brain, indicating that they cross the blood-brain barrier and exert specific actions on LXR receptors. Although previously demonstrated in mice,38,39 our data show for the first time in vivo brain induction of ABCA1 after administration of LXR agonists in rats.
The LXR agonists used did not affect LXRβ expression. However, they did increase LXR expression in control rat brain, although this effect was not apparent after MCAO, a situation with an already increased upregulation of this receptor.
More interesting, we have found that the LXR agonists are neuroprotective in experimental stroke. Indeed, both compounds, administered intraperitoneally 10 minutes or 1 hour after the ischemic occlusion, remarkably ameliorated stroke outcome, as shown by a reduction in infarct volume and in the neurological deficit induced by the ischemic injury. In the search for the mechanisms involved in this neuroprotective effect, we explored whether LXR activation inhibits ischemia-induced expression of inflammatory genes as described in macrophages exposed to bacterial pathogens.4 Thus, we have found that both GW3965 and TO901317 inhibit MCAO-induced expression of iNOS, COX-2, and MMP-9. Whereas iNOS and COX-2 mediate cytotoxicity in many cell systems, including the ischemic brain,31,40–44 MMP-9 is another inflammatory mediator contributing to ischemic cerebral damage32 as a result of extracellular matrix degradation45 and participation in hemorrhagic transformation in acute ischemic stroke in humans.46,47 Therefore, their inhibition may explain at least partly the neuroprotective effect of these compounds. To the best of our knowledge, these results are the first evidence demonstrating that LXR agonists inhibit COX-2 and MMP-9 expression after inflammatory stimuli in the central nervous system, which may be a useful action for different neurological disorders with an inflammatory substrate.
It has been described that the expression of iNOS, COX-2, and MMP-9 in several systems is induced by TNF- and IL-1β. We therefore tested the effect of these agonists on the expression of these 2 cytokines induced by ischemia. Interestingly, the administration of GW3965 inhibited MCAO-induced increase in IL-1β but not in TNF-, in agreement with previous reports on macrophage gene expression.48
LXR-dependent antiinflammatory properties are thought to be mediated by transrepression of factors involved in inflammatory gene expression such as NF-B.4,6,7 Because NF-B is a key component in the inflammatory response after an ischemic insult in brain, we have explored whether LXR agonist–induced neuroprotection may involve disruption of NF-B transcriptional activity, measured as expression of a bona fide NF-B target gene, IB.34,35 Indeed, we have found that administration of LXR agonists blocks MCAO-induced late increase in IB levels without affecting NF-B nuclear translocation, strongly supporting that inhibition of NF-B nuclear transcriptional activity accounts for LXR-induced neuroprotection and inhibition of brain inflammation.
To clarify whether the effects of LXR agonists were due to specific actions on LXR receptors, we have tested GW3965 on LXR,β–genetically deficient mice. In agreement with our hypothesis, GW3965, on one hand, increased mRNA levels of 2 well-established LXR target genes, ABCA1 and SREBP-1c,29,30,36 only in wild-type animals and, on the other, did not affect infarct outcome in LXR,β–/– animals, confirming that the effects of GW3965 are due to activation of LXR receptors. More important, we have found that untreated LXR,β–/– mice had a much greater infarct volume than wild-type mice. Furthermore, MCAO-induced mRNA expression of several inflammation-related, NF-B target genes was abolished in wild-type but not in LXR,β–/– mice, thus confirming that LXR activation induces neuroprotection in experimental stroke by inhibiting NF-B–induced transcriptional activity and inflammation. These data show for the first time that an endogenous LXR activator pathway during experimental stroke mediates a potent and natural protection, which could be caused by physiological LXR agonists such as oxysterols.49 This piece of evidence suggests that levels of endogenous LXR agonists might serve as prognostic markers in stroke patients; moreover, alterations in the expression or function of LXR receptors resulting from polymorphisms or other causes may severely affect stroke outcome and conceivably other pathologies in which LXR nuclear receptors are involved such as atherosclerosis.
Previous evidence has demonstrated that the antiinflammatory action of LXR synthetic agonists can be mediated through either LXR or LXRβ.4,5 Moreover, recent work from Zelcer and colleagues50 demonstrated that loss of either LXR or LXRβ expression exacerbates Alzheimer’s disease–related pathology in APP/PS1 transgenic mice. Although unexplored in LXR–/–, data exist showing that loss of LXRβ is associated with some central nervous system pathologies.51,52 Therefore, further studies are needed to clarify the role of each LXR isoform in the cerebral ischemia scenario.
|
Conclusions |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionConclusionsReferences |
|---|
Our results demonstrate that the activation of the LXR receptor exerts potent neuroprotective actions in experimental stroke as a result of the inhibition of inflammatory mediators. Given that these compounds were administered after the onset of the ischemic damage, our findings may possess therapeutic repercussions in the management of acute ischemic stroke.
|
Acknowledgments |
|---|
Sources of Funding
This work was supported by grants from Spanish Education and Science Ministry SAF2006–01753 (Dr Moro); SAF2005–05960 (Dr Lizasoain); SAF2005–03270, Funcis 67/05, Fundación Ramón Areces, and the Ramón y Cajal program (Dr Castrillo); Fundació La Caixa (Drs Moro and Castrillo); Spanish Health Ministry RD06/0026/0005 (Dr Lizasoain); and Madrid Community Government MULTIMAG (Dr Lizasoain). J.R. Morales and I. Ballesteros are fellows of the Plan de Formación del Personal Universitario and Plan de Formación del Personal Investigador, respectively, from the Education and Science Ministry, and J.M. Deniz is a recipient of a PhD training grant from the Cabildo de Gran Canaria.
Disclosures
None.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionConclusionsReferences |
|---|
1. Repa JJ, Mangelsdorf DJ. The role of orphan nuclear receptors in the regulation of cholesterol homeostasis. Annu Rev Cell Dev Biol. 2000; 16: 459–481.[CrossRef][Medline] [Order article via Infotrieve]
2. Zelcer N, Tontonoz P. Liver X receptors as integrators of metabolic and inflammatory signaling. J Clin Invest. 2006; 116: 607–614.[CrossRef][Medline] [Order article via Infotrieve]
3. Castrillo A, Tontonoz P. Nuclear receptors in macrophage biology: at the crossroads of lipid metabolism and inflammation. Annu Rev Cell Dev Biol. 2004; 20: 455–480.[CrossRef][Medline] [Order article via Infotrieve]
4. Joseph SB, Castrillo A, Laffitte BA, Mangelsdorf DJ, Tontonoz P. Reciprocal regulation of inflammation and lipid metabolism by liver X receptors. Nat Med. 2003; 9: 213–219.[CrossRef][Medline] [Order article via Infotrieve]
5. Castrillo A, Joseph SB, Marathe C, Mangelsdorf DJ, Tontonoz P. Liver X receptor-dependent repression of matrix metalloproteinase-9 expression in macrophages. J Biol Chem. 2003; 278: 10443–10449.
6. Pascual G, Fong AL, Ogawa S, Gamliel A, Li AC, Perissi V, Rose DW, Willson TM, Rosenfeld MG, Glass CK. A SUMOylation-dependent pathway mediates transrepression of inflammatory response genes by PPAR-gamma. Nature. 2005; 437: 759–763.[CrossRef][Medline] [Order article via Infotrieve]
7. Ghisletti S, Huang W, Ogawa S, Pascual G, Lin ME, Willson TM, Rosenfeld MG, Glass CK. Parallel SUMOylation-dependent pathways mediate gene- and signal-specific transrepression by LXRs and PPARgamma. Mol Cell. 2007; 25: 57–70.[CrossRef][Medline] [Order article via Infotrieve]
8. Lee CS, Joe EH, Jou I. Oxysterols suppress inducible nitric oxide synthase expression in lipopolysaccharide-stimulated astrocytes through liver X receptor. Neuroreport. 2006; 17: 183–187.[CrossRef][Medline] [Order article via Infotrieve]
9. Kim OS, Lee CS, Joe EH, Jou I. Oxidized low density lipoprotein suppresses lipopolysaccharide-induced inflammatory responses in microglia: oxidative stress acts through control of inflammation. Biochem Biophys Res Commun. 2006; 342: 9–18.[CrossRef][Medline] [Order article via Infotrieve]
10. Zhang-Gandhi CX, Drew PD. Liver X receptor and retinoid X receptor agonists inhibit inflammatory responses of microglia and astrocytes. J Neuroimmunol. 2007; 183: 50–59.[CrossRef][Medline] [Order article via Infotrieve]
11. Hindinger C, Hinton DR, Kirwin SJ, Atkinson RD, Burnett ME, Bergmann CC, Stohlman SA. Liver X receptor activation decreases the severity of experimental autoimmune encephalomyelitis. J Neurosci Res. 2006; 84: 1225–1234.[CrossRef][Medline] [Order article via Infotrieve]
12. Wang L, Schuster GU, Hultenby K, Zhang Q, Andersson S, Gustafsson JA. Liver X receptors in the central nervous system: from lipid homeostasis to neuronal degeneration. Proc Natl Acad Sci U S A. 2002; 99: 13878–13883.
13. Whitney KD, Watson MA, Collins JL, Benson WG, Stone TM, Numerick MJ, Tippin TK, Wilson JG, Winegar DA, Kliewer SA. Regulation of cholesterol homeostasis by the liver X receptors in the central nervous system. Mol Endocrinol. 2002; 16: 1378–1385.
14. Sun Y, Yao J, Kim TW, Tall AR. Expression of liver X receptor target genes decreases cellular amyloid beta peptide secretion. J Biol Chem. 2003; 278: 27688–27694.
15. Liang Y, Lin S, Beyer TP, Zhang Y, Wu X, Bales KR, DeMattos RB, May PC, Li SD, Jiang XC, Eacho PI, Cao G, Paul SM. A liver X receptor and retinoid X receptor heterodimer mediates apolipoprotein E expression, secretion and cholesterol homeostasis in astrocytes. J Neurochem. 2004; 88: 623–634.[CrossRef][Medline] [Order article via Infotrieve]
16. Abildayeva K, Jansen PJ, Hirsch-Reinshagen V, Bloks VW, Bakker AH, Ramaekers FC, de Vente J, Groen AK, Wellington CL, Kuipers F, Mulder M. 24(S)-hydroxycholesterol participates in a liver X receptor-controlled pathway in astrocytes that regulates apolipoprotein E-mediated cholesterol efflux. J Biol Chem. 2006; 281: 12799–12808.
17. Koldamova RP, Lefterov IM, Staufenbiel M, Wolfe D, Huang S, Glorioso JC, Walter M, Roth MG, Lazo JS. The liver X receptor ligand TO901317 decreases amyloid beta production in vitro and in a mouse model of Alzheimer’s disease. J Biol Chem. 2005; 280: 4079–4088.
18. Riddell DR, Zhou H, Comery TA, Kouranova E, Lo CF, Warwick HK, Ring RH, Kirksey Y, Aschmies S, Xu J, Kubek K, Hirst WD, Gonzales C, Chen Y, Murphy E, Leonard S, Vasylyev D, Oganesian A, Martone RL, Pangalos MN, Reinhart PH, Jacobsen JS. The LXR agonist TO901317 selectively lowers hippocampal Abeta42 and improves memory in the Tg2576 mouse model of Alzheimer’s disease. Mol Cell Neurosci. 2007; 34: 621–628.[CrossRef][Medline] [Order article via Infotrieve]
19. Andersson S, Gustafsson N, Warner M, Gustafsson JA. Inactivation of liver X receptor beta leads to adult-onset motor neuron degeneration in male mice. Proc Natl Acad Sci U S A. 2005; 102: 3857–3862.
20. Kim HJ, Fan X, Gabbi C, Yakimchuk K, Parini P, Warner M, Gustafsson JA. Liver X receptor beta (LXRbeta): a link between beta-sitosterol and amyotrophic lateral sclerosis-Parkinson’s dementia. Proc Natl Acad Sci U S A. 2008; 105: 2094–2099.
21. Repa JJ, Li H, Frank-Cannon TC, Valasek MA, Turley SD, Tansey MG, Dietschy JM. Liver X receptor activation enhances cholesterol loss from the brain, decreases neuroinflammation, and increases survival of the NPC1 mouse. J Neurosci. 2007; 27: 14470–14480.
22. Collins JL, Fivush AM, Watson MA, Galardi CM, Lewis MC, Moore LB, Parks DJ, Wilson JG, Tippin TK, Binz JG, Plunket KD, Morgan DG, Beaudet EJ, Whitney KD, Kliewer SA, Willson TM. Identification of a nonsteroidal liver X receptor agonist through parallel array synthesis of tertiary amines. J Med Chem. 2002; 45: 1963–1966.[CrossRef][Medline] [Order article via Infotrieve]
23. Schultz JR, Tu H, Luk A, Repa JJ, Medina JC, Li L, Schwendner S, Wang S, Thoolen M, Mangelsdorf DJ, Lustig KD, Shan B. Role of LXRs in control of lipogenesis. Genes Dev. 2000; 14: 2831–2838.
24. De Cristobal J, Moro MA, Davalos A, Castillo J, Leza JC, Camarero J, Colado MI, Lorenzo P, Lizasoain I. Neuroprotective effect of aspirin by inhibition of glutamate release after permanent focal cerebral ischemia in rats. J Neurochem. 2001; 79: 456–459.[CrossRef][Medline] [Order article via Infotrieve]
25. Caso JR, Pradillo JM, Hurtado O, Lorenzo P, Moro MA, Lizasoain I. Toll-like receptor 4 is involved in brain damage and inflammation after experimental stroke. Circulation. 2007; 115: 1599–1608.
26. Hunter AJ, Hatcher J, Virley D, Nelson P, Irving E, Hadingham SJ, Parsons AA. Functional assessments in mice and rats after focal stroke. Neuropharmacology. 2000; 39: 806–816.[CrossRef][Medline] [Order article via Infotrieve]
27. Sinz EH, Kochanek PM, Dixon CE, Clark RS, Carcillo JA, Schiding JK, Chen M, Wisniewski SR, Carlos TM, Williams D, DeKosky ST, Watkins SC, Marion DW, Billiar TR. Inducible nitric oxide synthase is an endogenous neuroprotectant after traumatic brain injury in rats and mice. J Clin Invest. 1999; 104: 647–656.[Medline] [Order article via Infotrieve]
28. Cárdenas A, Moro MA, Hurtado O, Leza JC, Lorenzo P, Castrillo A, Bodelon OG, Bosca L, Lizasoain I. Implication of glutamate in the expression of inducible nitric oxide synthase after oxygen and glucose deprivation in rat forebrain slices. J Neurochem. 2000; 74: 2041–2048.[CrossRef][Medline] [Order article via Infotrieve]
29. Costet P, Luo Y, Wang N, Tall AR. Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J Biol Chem. 2000; 275: 28240–28245.
30. Schwartz K, Lawn RM, Wade DP. ABC1 gene expression and ApoA-I-mediated cholesterol efflux are regulated by LXR. Biochem Biophys Res Commun. 2000; 274: 794–802.[CrossRef][Medline] [Order article via Infotrieve]
31. del Zoppo G, Ginis I, Hallenbeck JM, Iadecola C, Wang X, Feuerstein GZ. Inflammation and stroke: putative role for cytokines, adhesion molecules and iNOS in brain response to ischemia. Brain Pathol. 2000; 10: 95–112.[Medline] [Order article via Infotrieve]
32. Mun-Bryce S, Rosenberg GA. Matrix metalloproteinases in cerebrovascular disease. J Cereb Blood Flow Metab. 1998; 18: 1163–1172.[CrossRef][Medline] [Order article via Infotrieve]
33. Gosh S, May MJ, Kopp EB. NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses Annu Rev Immunol. 1998; 16: 225–260.[CrossRef][Medline] [Order article via Infotrieve]
34. Le Bail O, Schmidt-Ullrich R, Israel A. Promoter analysis of the gene encoding the I kappa B-alpha/MAD3 inhibitor of NF-kappa B: positive regulation by members of the rel/NF-kappa B family. EMBO J. 1993; 12: 5043–5049.[Medline] [Order article via Infotrieve]
35. Sun SC, Ganchi PA, Ballard DW, Greene WC. NF-kappa B controls expression of inhibitor I kappa B alpha: evidence for an inducible autoregulatory pathway. Science. 1993; 259: 1912–1915.
36. Repa JJ, Liang G, Ou J, Bashmakov Y, Lobaccaro J-MA, Shimomura I, Shan B, Brown MS, Goldstein JL, Mangelsdorf DJ. Regulation of mouse sterol regulatory element-binding protein-1c (SREBP-1c) by oxysterol receptors LXR and LXRβ. Genes Dev. 2000; 14: 2819–2830.
37. Pahl HL. Activators and target genes of Rel/NF-kappaB transcription factors. Oncogene. 1999; 18: 6853–6866.[CrossRef][Medline] [Order article via Infotrieve]
38. Koldamova RP, Lefterov IM, Ikonomovic MD, Skoko J, Lefterov PI, Isanski BA, DeKosky ST, Lazo JS. 22R-hydroxycholesterol and 9-cis-retinoic acid induce ATP-binding cassette transporter A1 expression and cholesterol efflux in brain cells and decrease amyloid beta secretion. J Biol Chem. 2003; 278: 13244–13256.
39. Burns MP, Vardanian L, Pajoohesh-Ganji A, Wang L, Cooper M, Harris DC, Duff K, Rebeck GW. The effects of ABCA1 on cholesterol efflux and Abeta levels in vitro and in vivo. J Neurochem. 2006; 98: 792–800.[CrossRef][Medline] [Order article via Infotrieve]
40. Planas AM, Soriano MA, Rodriguez-Farre E, Ferrer I. Induction of cyclooxygenase-2 mRNA and protein following transient focal ischemia in rat brain. Neurosci Lett. 1995; 200: 187–190.[CrossRef][Medline] [Order article via Infotrieve]
41. Collaco-Moraes Y, Aspey B, Harrison M, de Belleroche J. Cyclo-oxygenase-2 messenger RNA induction in focal cerebral ischemia. J Cereb Blood Flow Metab. 1996; 16: 1366–1372.[CrossRef][Medline] [Order article via Infotrieve]
42. Ohtsuki T, Kitagawa K, Yamagata K, Mandai K, Mabuchi T, Matsushita K, Yanagihara T, Matsumoto M. Induction of cyclooxygenase-2 mRNA in gerbil hippocampal neurons after transient forebrain ischemia. Brain Res. 1996; 736: 353–356.[CrossRef][Medline] [Order article via Infotrieve]
43. Iadecola C, Forster C, Nogawa S, Clark HB, Ross ME. Cyclooxygenase-2 immunoreactivity in the human brain following cerebral ischemia. Acta Neuropathol. 1999; 98: 9–14.[CrossRef][Medline] [Order article via Infotrieve]
44. Iadecola C, Niwa K, Nogawa S, Zhao X, Nagayama M, Araki E, Morham S, Ross ME. Reduced susceptibility to ischemic brain injury and N-methyl-D-aspartate-mediated neurotoxicity in cyclooxygenase-2-deficient mice. Proc Natl Acad Sci U S A. 2001; 98: 1294–1299.
45. Asahi M, Wang X, Mori T, Sumii T, Jung JC, Moskowitz MA, Fini ME, Lo EH. Effects of matrix metalloproteinase-9 gene knock-out on the proteolysis of blood-brain barrier and white matter components after cerebral ischemia. J Neurosci. 2001; 21: 7724–7732.
46. Montaner J, Alvarez-Sabin J, Molina CA, Angles A, Abilleira S, Arenillas J, Monasterio J. Matrix metalloproteinase expression is related to hemorrhagic transformation after cardioembolic stroke. Stroke. 2001; 32: 2762–2767.
47. Castellanos M, Leira R, Serena J, Pumar JM, Lizasoain I, Castillo J, Davalos A. Plasma metalloproteinase-9 concentration predicts hemorrhagic transformation in acute ischemic stroke. Stroke. 2003; 34: 40–46.
48. Ogawa S, Lozach J, Benner C, Pascual G, Tangirala RK, Westin S, Hoffmann A, Subramaniam S, David M, Rosenfeld MG, Glass CK. Molecular determinants of crosstalk between nuclear receptors and toll-like receptors. Cell. 2005; 122: 707–721.[CrossRef][Medline] [Order article via Infotrieve]
49. Lehmann JM, Kliewer SA, Moore LB, Smith-Oliver TA, Oliver BB, Su JL, Sundseth SS, Winegar DA, Blanchard DE, Spencer TA, Willson TM. Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J Biol Chem. 1997; 272: 3137–3140.
50. Zelcer N, Khanlou N, Clare R, Jiang Q, Reed-Geaghan EG, Landreth GE, Vinters HV, Tontonoz P. Attenuation of neuroinflammation and Alzheimer’s disease pathology by liver X receptors. Proc Natl Acad Sci U S A. 2007; 104: 10601–10606.
51. Andersson S, Gustafsson N, Warner M, Gustafsson JA. Inactivation of liver X receptor beta leads to adult-onset motor neuron degeneration in male mice. Proc Natl Acad Sci U S A. 2005; 102: 3857–3862.
52. Kim HJ, Fan X, Gabbi C, Yakimchuk K, Parini P, Warner M, Gustafsson JA. Liver X receptor beta (LXRbeta): a link between beta-sitosterol and amyotrophic lateral sclerosis-Parkinson’s dementia. Proc Natl Acad Sci U S A. 2008; 105: 2094–2099.
Related Article:
This article has been cited by other articles:
CLINICAL PERSPECTIVE
Liver X receptors (LXRs) and β are ligand-activated transcription factors that belong to the nuclear receptor superfamily. LXRs regulate the expression of a number of genes involved in cholesterol metabolism. In addition, LXRs are known to antagonize the expression of a panel of inflammatory genes. All these pieces of evidence suggest that LXR activation may exert a protective role in pathologies in which inflammation is involved such as stroke. Taking into account the epidemiological importance of stroke and the limited possibilities for treatment, activation of LXR might arise as a possible powerful approach for stroke treatment. The present results demonstrate that the activation of the LXR receptors exerts potent neuroprotective actions in experimental stroke, which are concomitant to the inhibition of inflammatory mediators. Apart from the possible therapeutic repercussions in acute stroke management, these findings suggest, on one hand, that the endogenous levels of LXR agonists such as oxysterols could serve as a helpful prognostic marker in stroke patients and, on the other, that polymorphisms or other alterations of the LXR receptor expression or function may increase vulnerability to stroke.
Circulation 2008 118: 1403-1404.
 |
|
 |
|
  J. Chen, X. Cui, A. Zacharek, C. Roberts, and M. Chopp eNOS Mediates TO90317 Treatment-Induced Angiogenesis and Functional Outcome After Stroke in Mice Stroke, July 1, 2009; 40(7): 2532 - 2538. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. Nelson, J. P. Otis, and H. V. Carey A role for nuclear receptors in mammalian hibernation J. Physiol., May 1, 2009; 587(9): 1863 - 1870. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Gabbi, M. Warner, and J.-A. Gustafsson Minireview: Liver X Receptor {beta}: Emerging Roles in Physiology and Diseases Mol. Endocrinol., February 1, 2009; 23(2): 129 - 136. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||