Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
« Previous Article | Table of Contents | Next Article »
Circulation. 2007;116:2444-2452
Published online before print November 5, 2007, doi: 10.1161/CIRCULATIONAHA.107.701276
CLINICAL PERSPECTIVE
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
116/21/2444    most recent
CIRCULATIONAHA.107.701276v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Welch, C. L.
Right arrow Articles by Tall, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Welch, C. L.
Right arrow Articles by Tall, A. R.
Related Collections
Right arrow Arterial thrombosis
Right arrow Genetics of cardiovascular disease
Right arrow Animal models of human disease

(Circulation. 2007;116:2444-2452.)
© 2007 American Heart Association, Inc.

Vascular Medicine

Spontaneous Atherothrombosis and Medial Degradation in Apoe–/–, Npc1–/– Mice

Carrie L. Welch, PhD*; Yu Sun, PhD*; Brian J. Arey, PhD; Vincent Lemaitre, PhD; Naresh Sharma, MD; Minako Ishibashi, PhD; Scott Sayers, MS; Rong Li, BS; Anna Gorelik, BS; Nick Pleskac, BS; Kadesha Collins-Fletcher, BS; Yoshiyuki Yasuda, PhD; Dieter Bromme, PhD; Jeanine M. D’Armiento, MD, PhD; Martin L. Ogletree, PhD; Alan R. Tall, MBBS

From the Division of Molecular Medicine, Department of Medicine, Columbia University, New York, NY (C.L.W., Y.S., V.L., N.S., M.I., S.S., R.L., A.G., N.P., K.C.-F., J.M.D., A.R.T.); Bristol-Myers Squibb, Pennington, NJ (B.J.A., M.L.O.); and University of British Columbia, Vancouver, BC (Y.Y., D.B.).

Correspondence to Carrie L. Welch, Columbia University, Department of Medicine, P&S 8–401, 630 W 168th St, New York, NY 10032. E-mail cbw13{at}columbia.edu

Received March 7, 2007; accepted September 11, 2007.


*    Abstract
up arrowTop
 *Abstract
down arrowIntroduction
 down arrowMethods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Background— The formation of an occluding thrombus on a ruptured or eroded atherosclerotic plaque is the hallmark event leading to acute coronary syndromes, myocardial infarction, and sudden death in humans. However, other species are highly resistant to plaque complications, and the specific processes predisposing to plaque destabilization and thrombosis are poorly understood.

Methods and Results— Mice carrying a null mutation of a gene regulating intracellular cholesterol transport (the Niemann-Pick C1 [Npc1] gene) were crossed with apolipoprotein E (Apoe) knockout mice to examine the effect of Npc1 on atherosclerotic lesion formation. Double-mutant mice showed greater lesion area compared with Apoe–/– littermates. Remarkably, the double mutants also developed large, protruding thrombi associated with the plaques and prominent medial degradation with inflammatory cell infiltration into the adventitia. Genetic studies suggested that the BALB background was permissive for plaque complications compared with C57BL/6J, and a BALB susceptibility locus was mapped by linkage analysis to chromosome 6. Examination of clotting parameters in double-knockout mice revealed that native clotting times were shortened and thrombin-antithrombin complex and soluble CD40 ligand levels were elevated compared with wild-type controls. In addition, cathepsin K was induced in Npc1–/– macrophages, and cathepsin K immunostaining and elastase activity were increased in proximal aortas of double-mutant mice compared with controls.

Conclusions— A defect in intracellular cholesterol trafficking caused by the Npc1 null mutation predisposes to increased lesion formation, atherothrombosis, and medial degradation. Plaque complications may require a procoagulant state and an increased protease activity, leading to plaque destabilization.


Key Words: aneurysm • atherosclerosis • genetics • thrombosis


*    Introduction
up arrowTop
 up arrowAbstract
 *Introduction
down arrowMethods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
The acute complications of atherosclerosis such as myocardial infarction and stroke are thought to arise from the formation of a thrombus at the surface of an atherosclerotic plaque in coronary or carotid arteries.1 Mechanisms leading to thrombus formation include rupture of a thin-capped fibroatheroma containing a lipid-rich necrotic core or endothelial erosion of a fibrous, proteoglycan-rich cap.1 Disruption of the plaque as a result of the unbalanced activities of matrix metalloproteases and cathepsins2–4 is thought to lead to the exposure of plaque-associated tissue factor to circulating coagulation factors and, after platelet activation, gives rise to an occlusive thrombus.5,6

Unlike humans, most animal species are resistant to atherosclerotic lesion formation and, importantly, do not exhibit thrombotic complications. Apolipoprotein E knockout (Apoe–/–) and low-density lipoprotein receptor knockout (Ldlr–/–) mouse strains develop lesions with architectural and histological features similar to those of humans.7–10 Some features of atherosclerotic plaque instability, including cap thinning, intraplaque hemorrhage, and calcification, have been observed in the brachiocephalic (innominate) artery of older and long-term cholesterol-fed Apoe–/– and Ldlr–/– mice.11–13 There also have been reports of myocardial infarction in Apoe–/– mice.14–16 However, none of these mice have shown clear-cut intraluminal thrombus at the site of presumed plaque destabilization. Thus, the assessment of atherosclerotic plaque complications in mice is an active and developing area.

Clinical Perspective p 2452

Niemann-Pick type C1 disease is an autosomal, recessive disorder characterized by intracellular accumulations of cholesterol and other lipids throughout the body. Affected individuals exhibit progressive neurodegeneration, leading to death in childhood, adolescence, or early adulthood. The underlying gene, Npc1, encodes a multispanning membrane protein containing a SCAP-like sterol-sensing domain that is required for the egress of cholesterol from late endosomes.17 NPC1-deficient cells exhibit a defect in the intracellular trafficking of low-density lipoprotein–derived cholesterol, leading to cholesterol accumulation in late endosomes and lysosomes18,19 and defects in endoplasmic reticulum–initiated cholesterol regulatory events.20

We21 and others22 have previously reported that mice carrying a naturally occurring null mutation of Npc1 have a defect in apoA-1–mediated cholesterol efflux from macrophages. To test the hypothesis that Npc1 mutations might worsen atherosclerosis, we crossed the Npc1–/– allele into the Apoe–/– background. Unexpectedly, this resulted in a high frequency of spontaneous atherothrombosis and prominent medial destruction in the proximal aorta.


*    Methods
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 *Methods
down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Mice
BALB/cNctr-Npc1m1N/+/J (BALB-Npc1+/–) and B6.129P2-Apoetm1Unc/J (B6-Apoe–/–) mice were purchased from The Jackson Laboratory (Bar Harbor, Me). A series of genetic crosses was performed to produce Apoe–/– mice with and without homozygous Npc1 deficiency. The genetic background of these mice was {approx}75% B6 and 25% BALB. To examine mice with uniform genetic backgrounds, we generated congenics carrying both mutations in BALB, B6, and (B6xBALB)F1 backgrounds (see the online Data Supplement). Mice were weaned onto a standard chow diet (PicoLab Rodent Diet 20, No. 5053) at 21 days of age. All procedures were carried out in accordance with current National Institutes of Health guidelines and were approved by the Institute Animal Care and Use Committee.

Mutant Allele Genotyping
Npc1 alleles were typed as described in Loftus et al.23 Apoetm1Un/+ alleles were typed as described (http://www.jaxmice.jax.org).

Atherosclerotic Lesion Analysis
Cross sections from the proximal aorta were embedded in paraffin as described.24 Lesion area was quantified by morphometric analysis of hematoxylin and eosin (H&E)–stained sections with Image-Pro Plus v4.1 software (Media Cybernetics, Bethesda, Md). Atherothrombosis and medial degradation were scored as presence or absence in H&E-stained sections. Thrombi were not included in lesion area measurements. Medial degradation was confirmed with Verhoeff’s stain for elastin. Immunostaining was performed as described with antibodies used to detect macrophages (Mac-3, BD PharMingen, San Diego, Calif),24 smooth muscle cells ({alpha}-actin, Zymed Laboratories, Sal Francisco, Calif),24 endothelial cells (M-20, Santa Cruz Biotechnologies, Santa Cruz, Calif), tissue factor (kindly provided by Yale Nemerson at Mount Sinai School of Medicine), and cathepsin K (catK).26 Collagen was detected by Masson’s trichrome stain (Poly Scientific, Bay Shore, NY).

Plasma Lipid Analysis and Cellular Cholesterol Composition
Colorimetric cholesterol measurements and fast protein liquid chromatography were performed with plasma as described.27 Cellular total cholesterol mass and unesterified cholesterol mass were determined in untreated peritoneal macrophages by gas-liquid chromatography as described.28 Cholesteryl ester mass was calculated as the difference (total cholesterol minus unesterified cholesterol). Mean mass results are from 4 experiments run in triplicate using pools of 3 to 4 mice per group.

Genome Scan for Loci Contributing to Plaque Complications
A DNA pooling technique was used to initially scan the genome, followed by linkage analysis using individual samples from N2F1-Apoe–/–, Npc1–/– mice as described previously29 and in the online Data Supplement. Linkage was determined by {chi}2 analysis with Bonferroni correction for multiple testing. The corrected threshold for genome-wide significance was P=0.00125 (0.05/1 trait/40 markers).

Quantification of Clotting Parameters
Native clotting times were determined in whole blood drawn from the inferior vena cava of anesthetized mice (see the online Data Supplement). Recalcified blood was transferred to a thromboelastograph coagulation analyzer (Haemoscope Corp, Skokie, Ill). Clotting times were determined with thromboelastograph V3 version 3.0.112 software. Thrombin-antithrombin (T-AT) complex, plasminogen activator inhibitor-1 (PAI-1), D-dimers, and soluble CD40 ligand (sCD40L) were measured in platelet-poor plasma (see the online Data Supplement) using specially designed (D-dimers) or commercially available (T-AT: Dade-Behring, Deerfield, Ill; PAI-1: Oxford Biomedical, Oxford, Mich; and sCD40L: Bender Medsystems, Burlingame, Calif) ELISAs. Bleeding time was measured from tail tips. Three-millimeter segments were severed, and the remaining tail was immersed in phosphate-buffered saline. Time to cessation of bleeding was defined as the bleeding time.

Gene Expression Profiling
RNA was extracted from thioglycollate-elicited peritoneal macrophages derived from BALB or BALB-Npc1–/– mice. Labeling, hybridization, and data analysis were provided by the W.M. Keck Foundation Biotechnology Resource Laboratory at Yale University using the Affymetrix OMM16K gene chip. Two experiments were carried out with a total of 4 sets of samples and reciprocal labeling. A complete list of results is provided in the online Data Supplement. Differential expression of Ctsk mRNA was confirmed by Taqman real-time polymerase chain reaction using independent samples and the following primers (5' to 3'): forward, GGGAACGAGAAAGCCCTGA; reverse, GTAAAACTGGAAAGATGCCAAGC; and probe, 5'FAM(CCATCTCTGTGTCCATCGACGCAAG)BHQ3'.

Western Blotting and Elastase Activity
Postnuclear cell lysates were extracted from thioglycollate-elicited peritoneal macrophages derived from BALB or BALB-Npc1–/– mice. Media was obtained from macrophages cultured in Dulbecco’s modified Eagle’s medium plus 0.2% BSA for 24 hours and concentrated with Centricon-20 filtration columns. Immunoblotting was performed with an anti-mouse catK polyclonal antibody26 used at 1:500 dilution. Elastin degradation was carried out as described3 using proximal aorta homogenates derived from BALB-Apoe–/– or BALB-Apoe–/–, Npc1–/– mice and fluorescein-conjugated elastin (Molecular Probes, Carlsbad, Calif).

Statistical Analysis
Mann–Whitney (2-group lesion area, clotting parameter measurements), ANOVA (4-group comparisons), t tests, and Fisher’s exact test were carried out with Statview 5.0 (Abacus Concepts, Inc, Berkeley, Calif). Square root or log transformation was applied to approximate a normal distribution for ANOVA.

The authors had full access to and take responsibility for the integrity of the data. All authors have read and agree to the manuscript as written.


*    Results
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 *Results
down arrowDiscussion
 down arrowReferences
 
Spontaneous Atherosclerotic Plaque Complications in Apoe–/–, Npc1–/– Mice
The Npc1 null mutation arose spontaneously on the BALB background and homozygosity results in death from neurological disease at 12 to 14 weeks of age.23 We crossed BALB-Npc1–/– mice with B6-Apoe–/– mice to produce double-knockout mice on a mixed [(BALBxB6)xB6]N2F1 background. The bulk of cholesterol accumulating in peritoneal macrophages derived from these mice was unesterified (Apoe–/–, 99.7±49.8 µg/µg protein; Apoe–/–, Npc1–/–, 430.9±144.5 µg/µg protein [mean±SD]), but there also was a modest increase in cholesteryl ester (Apoe–/–, 39.1±36.8 µg/µg protein; Apoe–/–, Npc1–/–, 75.5±25.7 µg/µg protein). The progression of neurological disease was not altered by apoE deficiency as assessed by age of onset of weight loss, tremors, hind leg paralysis, and death. Thus, aortic lesions were evaluated in 10-week-old, chow-fed mice before the onset of advanced neurological disease. As expected, Apoe–/–, Npc1–/– mice exhibited accelerated atherosclerotic lesion development with 4.2-fold-greater lesion area relative to Apoe–/– littermate controls (56 975±30 384 versus 13 500±10 111 µm2 per section [mean±SD], respectively) (Figure 1A). Composition analysis with special stains confirmed that these early lesions were enriched in cholesterol-laden macrophages and largely devoid of smooth muscle cells and collagen (data not shown).


Figure 1187366
View larger version (25K):
[in this window]
[in a new window]

  		Figure 1. Increased atherosclerotic lesion area, luminal thrombosis, and medial degradation in Apoe–/–, Npc1–/– mice vs Apoe–/– littermates. A, Quantification of proximal aortic lesion area from 2 independent [(BALBxB6)xB6]N2F1 crosses using morphometric analysis followed by Mann-Whitney test. Mice were 10 weeks of age and chow fed. Horizontal bars indicate group means. B, Quantification of plaque complications by Fisher’s exact test. None of the N2F1 mice with wild-type Npc1 alleles exhibited thrombus or medial degradation.

Remarkably, 24% (6 of 26) of the double-mutant mice also exhibited large thrombi protruding into the lumen of the proximal aorta (Figures 1B and 2DownA). These thrombi were formed primarily on the surface of atherosclerotic lesions with loss of the endothelial monolayer at the plaque-thrombus interface (demonstrated by lack of PECAM-1 immunostaining; Figure 2B). In addition to thrombus, 35% of the double mutants displayed marked loss of the tunica media and invasion of inflammatory cells into the adventitia (ie, medial degradation; Figure 2A). Complete degradation of medial elastic fibers was confirmed with Verhoeff’s stain for elastin (Figure 2C). Some mice displayed both thrombus and medial degradation; others displayed only 1 type of complication. Neither complication was observed in nonatherosclerotic regions of the arterial tree. There was no evidence of tissue infarction by gross examination of the hearts at this early stage of atherosclerosis. Importantly, none of the Apoe–/– controls displayed thrombus or medial degradation at this time point (Figure 2D). The double-mutant mice exhibited elevated levels of plasma total cholesterol and non–high-density lipoprotein cholesterol compared with Apoe–/– littermates (Table 1). However, the differences in plasma cholesterol levels were considered unlikely to be the primary cause of plaque complications because atherosclerosis has been examined in many studies of B6-Apoe–/– mice exhibiting similar or much higher levels of total/non–high-density lipoprotein cholesterol levels without the occurrence of thrombus or frequent medial degradation.7,8,10,30


Figure 2187366
View larger version (87K):
[in this window]
[in a new window]

  		Figure 2. Spontaneous thrombosis and medial degradation was associated with atherosclerotic lesions in Apoe–/–, Npc1–/– mice but not in more advanced lesions of aged control mice carrying wild-type Npc1 alleles. A, H&E-stained cross section from the proximal aorta of a 10-week-old, chow-fed [(BALBxB6)xB6]N2F1-Apoe–/–, Npc1–/– mouse. A large, protruding thrombus (Thr) at the surface (open arrowheads) of a macrophage-rich atherosclerotic plaque (Pl) is shown. In this example, the plaque has invaded the tunica media (M) with complete disruption of the medial layer and an influx of inflammatory cells. A second, distinct small thrombus (Thrsm) also is present. B, Aortic section immunostained with a PECAM-1/CD31–specific antibody. Lack of staining (brown) at the plaque-thrombus interface (open arrowhead) indicates loss of endothelial cells. In contrast, there is clear staining of the endothelial monolayer along the surface of a plaque without thrombus and unaffected vessel (arrowheads). C, Aortic section stained with Verhoeff’s stain for elastin (black). Lack of staining in the media underlying an atherosclerotic plaque indicates complete degradation of elastic fibers. D, Representative section from an age-matched N2F1 mouse with wild-type Npc1 alleles. Only small collections of cholesterol-laden macrophages were observed. E, F, H&E-stained aortic sections from N2F1-Apoe–/–, Npc1–/– mice exhibiting thrombus within plaques and intraplaque hemorrhage (F, arrow). G, H, H&E-stained aortic sections from 20-week-old (G) and 40-week-old (H) chow-fed (B6xBALB)N2F1-Apoe–/– mice. The aged mice developed larger plaques with necrotic cores (nc), thinning caps (open arrowheads), and extensive outward remodeling (closed arrowheads) but no sign of thrombus formation. Adv indicates adventitia.


View this table:
[in this window]
[in a new window]

  		Table 1. Plasma Lipoprotein Cholesterol Levels in Chow-Fed [(BALBxB6)xB6]N2F1-Apoe–/– Mice Grouped by Genotype at the Npc1 Locus

The unexpected findings of luminal thrombus and frequent medial erosions were confirmed in a second larger, independent cross. Again, there was a significant difference in lesion area between Apoe–/–, Npc1–/– and Apoe–/– mice (84 879±46 370 versus 9118±8317 µm2/section [mean±SD], respectively) (Figure 1A). Thrombosis was observed in 21% of the double-mutant mice, and medial degradation was seen in 55%, whereas none of the Apoe–/– controls displayed plaque complications (Figure 1B). In addition to the occurrence of thrombus at the surface of plaques, some mice exhibited thrombus and hemorrhage within plaques (Figure 2E and 2F).

Next, we tested whether the occurrence of plaque complications simply reflected accelerated lesion formation in the double-knockout mice in the (B6xBALB)xB6 genetic background. Apoe–/– single-mutant controls in the mixed background were maintained on a chow diet for an additional 10 or 20 weeks. These "aged" mice exhibited larger, more advanced plaques compared with the 10-week-old double-mutant mice but no sign of thrombus formation (Figure 2G and 2H). Mean lesion area was 139 099±13 916 µm2 per section for 20-week-old mice (n=30) and 504 922±37 725 µm2 per section for 40-week-old mice (n=23). Medial degradation was observed in a small number of animals but with markedly less cellular infiltrate into the adventitia compared with that observed in the double mutants. These data indicate a specific role for the Npc1 gene in determining susceptibility to plaque complications.

Plaque Complications Are Determined, in Part, by Genetic Background
To further examine the direct role of Npc1 in determining plaque complications and to test the effect of genetic background, we created double congenics carrying null alleles for both Apoe and Npc1 in BALB, B6, or (B6xBALB)F1 uniform genetic backgrounds. Lesion analysis was performed and plaque phenotypes were compared between double congenics and respective littermates carrying wild-type Npc1 alleles (Figure 3). As in the mixed genetic background, homozygosity for the Npc1 null allele conferred increased lesion area in all 3 backgrounds compared with homozygosity for the wild-type allele. However, mutant mice in the BALB background had decreased lesion area compared with mice in the (B6xBALB)F1 or B6 background (34 484±32 005, 58 100±37 404, and 57 177±34 033 µm2 per section, respectively) (ANOVA, P<0.0001 for effect of genetic background on lesion area). In addition to a main effect of genetic background, there was evidence for an interactive effect with Npc1 genotype (ANOVA, P<0.004). Despite the decrease in lesion area, double-mutant mice in the BALB background exhibited significant frequencies of both thrombus (35%) and medial degradation (35%). In contrast, double-mutant mice in the (B6xBALB)F1 background exhibited a high frequency of medial degradation but not thrombus, and mice in the B6 background exhibited thrombus but were resistant to medial degradation. These data suggest a main effect of genetic background on plaque complications, but larger samples sizes are required to confirm the effect. There were no occurrences of thrombus in Npc1+/+ mice in any genetic background and only 1 occurrence of medial degradation in Npc1+/+ mice in the BALB background. Taken together, these data confirmed the role of Npc1 in determining susceptibility to plaque area and complications. In addition, the observations establish the BALB genetic background as permissive for the development of both luminal thrombus and medial degradation, whereas the B6 background is likely repressive at least for medial degradation.


Figure 3187366
View larger version (36K):
[in this window]
[in a new window]

  		Figure 3. The BALB genetic background is permissive for both atherothrombosis and medial degradation despite decreased lesion area compared with the (B6xBALB)F1 and B6 backgrounds. A, Quantification of proximal aortic lesion area (Mann–Whitney test) from congenic strains generated in BALB, (B6xBALB)F1, and B6 backgrounds. Because of breeding difficulties, the B6 group includes full and partial congenics with up to 18% of genetic content derived from BALB. The F1 strain was derived from full ({approx}100%) B6 congenics crossed with BALB congenics. Mice were 10- to 12-week-old, chow-fed animals. Horizontal bars indicate group means. B, Quantification of plaque complications by Fisher’s exact test.

To test the hypothesis that the BALB genetic background may harbor susceptibility loci for plaque complications, we performed a genome scan using DNA from mice of the mixed genetic background (segregating for BALB and B6 alleles throughout the genome). Significant genome-wide linkage for the more frequent complication, medial degradation, was observed at D6Mit74 ({chi}2 test, P=0.0002; n=136 individuals typed with 74 occurrences of medial degradation), where inheritance of BALB alleles conferred susceptibility (see the online Data Supplement Table I). Linkage for thrombus was suggestive (P=0.077; n=138 individuals typed with 23 occurrences of thrombus). These data are consistent with the localization of a BALB susceptibility locus, at least for medial degradation, on chromosome 6.

Npc1 Deficiency Results in a Prothrombotic State
We carried out an initial characterization of coagulation in Apoe–/– and Apoe–/–, Npc1–/– mice in the mixed genetic background to determine whether there might be an underlying prothrombotic state in the double-mutant mice. Abundant tissue factor antigen staining was observed in lesions from both Apoe–/– and Apoe–/–, Npc1–/– mice (Figure 4A and 4B), suggesting that the level of tissue factor antigen expression was not rate limiting for thrombus formation. Native clotting time was significantly shortened in double mutants (Figure 4C), and there was a trend toward shortened time to maximal clot strength (data not shown). Increased thrombin generation was indicated by a significant elevation in mean T-AT levels in the double-mutant mice compared with controls (Figure 4D). Together, these data suggested that the double-mutant mice harbor a procoagulant state.


Figure 4187366
View larger version (32K):
[in this window]
[in a new window]

  		Figure 4. Measures of coagulation suggest a prothrombotic state in Apoe–/–,Npc1–/– mice vs controls. A, B, Aortic sections from 10-week-old, chow-fed [(B6xBALB)xB6]N2F1-Apoe–/– (A) and [(B6xBALB)xB6]N2F1-Apoe–/–, Npc1–/– littermates (B) immunostained with a tissue factor–specific antibody. Plaques (Pl) from both genotypes exhibit abundant staining (brown). C, Native clotting times in N2F1-Apoe–/– and -Apoe–/–, Npc1–/– littermates assessed by thromboelastograph analysis of whole blood followed by Mann-Whitney test. D, Plasma T-AT complex levels in N2F1-Apoe–/– and -Apoe–/–, Npc1–/– littermates measured by ELISA and compared by Mann-Whitney test. E, Plasma sCD40L levels in BALB congenic mice carrying wild-type alleles, Npc1–/– or Apoe–/– single mutation, or Apoe–/–,Npc1–/– double mutations as measured by ELISA. ANOVA was performed with log transformation. Mice were 10- to 12-week-old, chow-fed animals. Horizontal bars indicate group means. M indicates media (typically devoid of tissue factor); A, adventitia (typically expressing tissue factor).

We then performed a more detailed characterization of the coagulation system, including measures of fibrinolysis and platelet activation, in single- and double-mutant mice of the uniform BALB background. There was an increase in T-AT levels in Npc1–/– and Apoe–/–, Npc1–/– mice compared with wild-type controls (Table 2), indicating an underlying increase in thrombin generation resulting from the Npc1 mutation. There was a significant increase in PAI-1 levels in double-mutant mice but not mice of the other genotypes (Table 2). However, there were no differences in D-dimer levels (Table 2), suggesting that fibrinolysis is not impaired. Soluble CD40L is a marker of activated platelets, and circulating levels have been associated with unstable plaques in humans.31,32 We observed slight elevations of sCD40L levels in Apoe–/– and Npc1–/– single-mutant mice (Figure 4E). However, double mutants exhibited a marked increase in sCD40L levels with no overlap in values compared with the other groups (Figure 4E). Together, these data suggest an underlying prothrombotic state in Npc1–/– mice, leading to increased thrombin generation. Although the cause is unknown, Npc1–/– mice have significant liver pathology, including apoptosis and inflammation,33 and an underlying prothrombotic state could reflect these abnormalities. In the presence of atherosclerotic plaque resulting from Apoe deficiency, the result may be formation of thrombus at the surface of the plaque. Because the increase in sCD40L is prominent only in double-mutant mice, this increase likely arises secondary to atherosclerosis rather than as a primary platelet abnormality. In support of this idea, bleeding time was normal in Npc1–/– mice compared with controls (data not shown).


View this table:
[in this window]
[in a new window]

  		Table 2. Plasma T-AT, PAI-1, and D-Dimer Levels in Chow-Fed BALB Congenic Mice Grouped by Genotype at Apoe and Npc1

Induction of Ctsk Expression and Elastase Activity in Npc1-Deficient Macrophages and Atherosclerotic Aorta
The loss of endothelial surface at the plaque-thrombus interface (Figure 2B) and the aggressive infiltration of macrophages through the media (Figure 2C) suggested that there might be factors producing plaque instability in addition to an underlying prothrombotic state in Apoe–/–, Npc1–/– mice. To screen for differential expression of genes potentially involved in plaque destabilization, we performed microarray analyses comparing macrophages derived from BALB-Npc1–/– or wild-type mice. Approximately 10% of the 16 000 genes surveyed were detected in macrophages. Of these genes, Ctsk repeatedly exhibited a 1.5- to 2.5-fold induction in Npc1–/– compared with wild-type macrophages. Ctsk encodes catK, a potent elastase expressed in atherosclerotic lesions. No other gene, including a variety of matrix metalloproteases and other cathepsins, was consistently induced ≥1.5-fold across experiments and with reciprocal labeling (see the online Data Supplement). The induction of Ctsk was confirmed by real-time polymerase chain reaction (Figure 5A). Moreover, protein levels of cellular and secreted catK were significantly elevated in macrophages derived from BALB-Npc1–/– compared with wild-type mice (Figure 5B and 5C). Immunostaining of atherosclerotic lesions revealed greater abundance of catK antigen in double-mutant mice compared with Apoe–/– controls (Figure 5D and 5E). Consistent with these data, 3-fold-greater elastase activity was observed in lesion-containing proximal aorta from double mutants compared with controls (Figure 5F).


Figure 5187366
View larger version (44K):
[in this window]
[in a new window]

  		Figure 5. Ctsk is induced by Npc1 deficiency and total elastase activity is increased in lesions derived from Apoe–/–, Npc1–/– mice vs controls. A, Ctsk mRNA levels in thioglycollate-elicited macrophages from BALB (wild-type [wt]) or BALB-Npc1–/– mice were determined by real-time polymerase chain reaction and expressed relative to β-actin. B, Western blot using thioglycollate-elicited macrophage cell lysate or media from BALB (wt) or BALB-Npc1–/– mice and a catK-specific antibody. β-Actin was used as a loading control. C, Quantification of protein blots by densitometry. D, E, Aortic sections from [(B6xBALB)xB6]N2F1-Apoe–/– (D) and [(B6xBALB)xB6]N2F1-Apoe–/–, Npc1–/– littermates (E) immunostained with a catK-specific antibody. Cells staining positive are brown. F, Elastin degradation in proximal aortic extracts from [(B6xBALB)xB6]N2F1-Apoe–/– and -Apoe–/–, Npc1–/– littermates using fluorescein-conjugated elastin as substrate. All mice were 10-week-old, chow-fed animals. Pl indicates plaque; M, media; Adv, adventitia; and Thr, thrombus.


*    Discussion
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 *Discussion
down arrowReferences
 
We found that Apoe–/–, Npc1–/– mice have increased atherosclerosis in the proximal aorta, luminal thrombus formation, and prominent medial degradation. The BALB genetic background was permissive for the development of both thrombus and medial degradation, whereas the B6 background was resistant to medial degradation. There was shortened clotting time and increased thrombin generation in double-mutant mice and prominent induction of the matrix protease catK in Npc1–/– macrophages and double-mutant aortas. Together, the data suggest that the combination of an underlying prothrombotic state and plaque instability related to increased Ctsk expression led to atherothrombosis in the double-mutant mice.

Studies in humans indicate that plaque complications depend on qualitative changes in plaque rather than lesion size per se. Similarly, the complication of luminal thrombus in Apoe–/–, Npc1–/– mice appeared to be largely independent of lesion area. Observed disruption of the endothelial monolayer at the plaque-thrombus interface in Apoe–/–, Npc1–/– mice suggested that loss of endothelial integrity or the underlying matrix may compromise the barrier between plaque-derived tissue factor and circulating coagulation factors. Matrix metalloproteases3 and cathepsins34,35 are expressed in human atheroma, suggesting that these proteases might contribute to matrix degradation and plaque destabilization. However, overexpression of metalloproteases in mouse models of atherosclerosis has had variable effects on atherosclerosis without obvious luminal thrombus formation.36 We observed increased levels of catK and elastase activity in Apoe–/–, Npc1–/– mice. Interestingly, Apoe–/–, Ctsk–/– mice have smaller, more fibrous lesions and decreased medial degradation compared with Apoe–/– mice.37 Thus, the extensive medial degradation observed in Apoe–/–, Npc1–/– mice could be a direct result of increased catK activity. It also is possible that increased catK activity near the surface of lesions may contribute to plaque destabilization.

Apoe–/–, Npc1–/– mice exhibit an increased procoagulant state relative to Apoe–/– mice that is not counterbalanced by increased fibrinolysis and thus favors thrombus formation. In humans, the extent of thrombus formation on a ruptured or eroded plaque is dependent on the balance between procoagulant, anticoagulant, and fibrinolytic activities. Type 2 diabetics exhibit a prothrombotic state caused by increases in thrombin and fibrinogen generation and impaired PAI-1–dependent fibrinolysis.38 The prothrombotic state may explain, in part, the significantly increased risk for acute coronary events compared with individuals without diabetes.38 Thus, it is tempting to speculate that the mechanism of atherothrombosis in humans also may involve both plaque instability and an underlying prothrombotic state.

The ability to predict which patients with acute coronary syndromes are at risk for an acute complication remains an important challenge. Biomarkers such as circulating levels of troponin, C-reactive protein, and sCD40L have been evaluated for their ability to predict outcome after acute coronary syndrome. In a case-control study comparing patients with acute coronary syndromes with unaffected controls, circulating levels of sCD40L were shown to be a predictor of death, recurrent myocardial infarction, and heart failure independently of troponin or C-reactive protein.32 In our study, elevated levels of sCD40L provided a sensitive marker for atherothrombosis. Although only a fraction of the double-mutant mice exhibited large thrombus at the time of death, all of these mice exhibited elevated sCD40L levels, suggesting that it could perhaps reflect ongoing formation of small thrombi. In contrast, T-AT, PAI-1, and D-dimer levels provided poor discrimination between controls, mice with atherosclerosis, and mice with atherothrombosis. These observations point to platelet activation as a key event in the development of atherothrombosis in both mice and humans. In the mice, this appeared to be secondary to plaque instability and the underlying procoagulant state.

In humans, atherosclerotic plaque thickness in the aortic arch is a significant predictor of recurrent brain infarction and other vascular events likely reflecting atherothrombosis and embolism.39 The double-mutant mice studied herein developed thrombus on lesions in the proximal aorta, but myocardial infarction and stroke were not observed. This may have been due to the early time point (ie, early stage of atherosclerosis) necessitated by the premature animal death that results from homozygous Npc1 deficiency. Transgenic rescue of the neurological disease by brain-specific expression of Npc1 has been described,40 and crossing this transgene into the Apoe–/– background may allow study of mice with a longer lifespan, more advanced atherosclerotic lesions, and potentially downstream complications involving tissue infarction.


*    Acknowledgments
 
We thank D. Seiffert for helpful discussions; J. Zhou, J. Molina, and N. Latib for technical assistance and animal husbandry; and J.A. Tamasi, S. Youssef, and D.E. Normandin for assistance with biomarker evaluations.

Sources of Funding

This work has been funded by National Institutes of Health grant HL22682 (A. Tall) and Canadian Institutes of Health Research MOP 64447 (Dr Bromme).

Disclosures

None.


*    References
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 up arrowDiscussion
 *References
 

  1. Virmani R, Burke AP, Farb A, Kolodgie FD. Pathology of the vulnerable plaque. J Am Coll Cardiol. 2006; 47: C13–C18.[Abstract/Free Full Text]
  2. Galis ZS, Muszynski M, Sukhova GK, Simon-Morrissey E, Unemori EN, Lark MW, Amento E, Libby P. Cytokine-stimulated human vascular smooth muscle cells synthesize a complement of enzymes required for extracellular matrix digestion. Circ Res. 1994; 75: 181–189.[Abstract/Free Full Text]
  3. Galis ZS, Sukhova GK, Lark MW, Libby P. Increased expression of matrix metalloproteinases and matrix degrading activity in vulnerable regions of human atherosclerotic plaques. J Clin Invest. 1994; 94: 2493–2503.[Medline] [Order article via Infotrieve]
  4. Liu J, Sukhova GK, Sun JS, Xu WH, Libby P, Shi GP. Lysosomal cysteine proteases in atherosclerosis. Arterioscler Thromb Vasc Biol. 2004; 24: 1359–1366.[Abstract/Free Full Text]
  5. Taubman MB, Fallon JT, Schecter AD, Giesen P, Mendlowitz M, Fyfe BS, Marmur JD, Nemerson Y. Tissue factor in the pathogenesis of atherosclerosis. Thromb Haemost. 1997; 78: 200–204.[Medline] [Order article via Infotrieve]
  6. Ardissino D, Merlini PA, Ariens R, Coppola R, Bramucci E, Mannucci PM. Tissue-factor antigen and activity in human coronary atherosclerotic plaques. Lancet. 1997; 349: 769–771.[CrossRef][Medline] [Order article via Infotrieve]
  7. Plump AS, Smith JD, Hayek T, Aalto-Setala K, Walsh A, Verstuyft JG, Rubin EM, Breslow JL. Severe hypercholesterolemia and atherosclerosis in apolipoprotein E-deficient mice created by homologous recombination in ES cells. Cell. 1992; 71: 343–353.[CrossRef][Medline] [Order article via Infotrieve]
  8. Zhang SH, Reddick RL, Piedrahita JA, Maeda N. Spontaneous hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science. 1992; 258: 468–471.[Abstract/Free Full Text]
  9. Ishibashi S, Brown MS, Goldstein JL, Gerard RD, Hammer RE, Herz J. Hypercholesterolemia in low density lipoprotein receptor knockout mice and its reversal by adenovirus-mediated gene delivery. J Clin Invest. 1993; 92: 883–893.[Medline] [Order article via Infotrieve]
  10. Nakashima Y, Plump AS, Raines EW, Breslow JL, Ross R. ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree. Arterioscler Thromb. 1994; 14: 133–140.[Abstract/Free Full Text]
  11. Calara F, Silvestre M, Casanada F, Yuan N, Napoli C, Palinski W. Spontaneous plaque rupture and secondary thrombosis in apolipoprotein E-deficient and LDL receptor-deficient mice. J Pathol. 2001; 195: 257–263.[CrossRef][Medline] [Order article via Infotrieve]
  12. Johnson JL, Jackson CL. Atherosclerotic plaque rupture in the apolipoprotein E knockout mouse. Atherosclerosis. 2001; 154: 399–406.[CrossRef][Medline] [Order article via Infotrieve]
  13. Rosenfeld ME, Polinsky P, Virmani R, Kauser K, Rubanyi G, Schwartz SM. Advanced atherosclerotic lesions in the innominate artery of the ApoE knockout mouse. Arterioscler Thromb Vasc Biol. 2000; 20: 2587–2592.[Abstract/Free Full Text]
  14. Caligiuri G, Levy B, Pernow J, Thoren P, Hansson GK. Myocardial infarction mediated by endothelin receptor signaling in hypercholesterolemic mice. Proc Natl Acad Sci U S A. 1999; 96: 6920–6924.[Abstract/Free Full Text]
  15. Braun A, Trigatti BL, Post MJ, Sato K, Simons M, Edelberg JM, Rosenberg RD, Schrenzel M, Krieger M. Loss of SR-BI expression leads to the early onset of occlusive atherosclerotic coronary artery disease, spontaneous myocardial infarctions, severe cardiac dysfunction, and premature death in apolipoprotein E-deficient mice. Circ Res. 2002; 90: 270–276.[Abstract/Free Full Text]
  16. Kuhlencordt PJ, Gyurko R, Han F, Scherrer-Crosbie M, Aretz TH, Hajjar R, Picard MH, Huang PL. Accelerated atherosclerosis, aortic aneurysm formation, and ischemic heart disease in apolipoprotein E/endothelial nitric oxide synthase double-knockout mice. Circulation. 2001; 104: 448–454.[Abstract/Free Full Text]
  17. Carstea ED, Morris JA, Coleman KG, Loftus SK, Zhang D, Cummings C, Gu J, Rosenfeld MA, Pavan WJ, Krizman DB, Nagle J, Polymeropoulos MH, Sturley SL, Ioannou YA, Higgins ME, Comly M, Cooney A, Brown A, Kaneski CR, Blanchette-Mackie EJ, Dwyer NK, Neufeld EB, Chang TY, Liscum L, Strauss JF 3rd, Ohno K, Zeigler M, Carmi R, Sokol J, Markie D, O’Neill RR, van Diggelen OP, Elleder M, Patterson MC, Brady RO, Vanier MT, Pentchev PG, Tagle DA. Niemann-Pick C1 disease gene: homology to mediators of cholesterol homeostasis. Science. 1997; 277: 228–231.[Abstract/Free Full Text]
  18. Lange Y, Ye J, Rigney M, Steck T. Cholesterol movement in Niemann-Pick type C cells and in cells treated with amphiphiles. J Biol Chem. 2000; 275: 17468–17475.[Abstract/Free Full Text]
  19. Cruz JC, Sugii S, Yu C, Chang TY. Role of Niemann-Pick type C1 protein in intracellular trafficking of low density lipoprotein-derived cholesterol. J Biol Chem. 2000; 275: 4013–4021.[Abstract/Free Full Text]
  20. Dahl NK, Gutheil WG, Liscum L. Abnormal regulation of low density lipoprotein-sensitive events in a cholesterol transport mutant. J Biol Chem. 1993; 268: 16979–16986.[Abstract/Free Full Text]
  21. Chen W, Sun Y, Welch C, Gorelik A, Leventhal AR, Tabas I, Tall AR. Preferential ATP-binding cassette transporter A1-mediated cholesterol efflux from late endosomes/lysosomes. J Biol Chem. 2001; 276: 43564–43569.[Abstract/Free Full Text]
  22. Choi HY, Karten B, Chan T, Vance JE, Greer WL, Heidenreich RA, Garver WS, Francis GA. Impaired ABCA1-dependent lipid efflux and hypoalphalipoproteinemia in human Niemann-Pick type C disease. J Biol Chem. 2003; 278: 32569–32577.[Abstract/Free Full Text]
  23. Loftus SK, Morris JA, Carstea ED, Gu JZ, Cummings C, Brown A, Ellison J, Ohno K, Rosenfeld MA, Tagle DA, Pentchev PG, Pavan WJ. Murine model of Niemann-Pick C disease: mutation in a cholesterol homeostasis gene. Science. 1997; 277: 232–235.[Abstract/Free Full Text]
  24. Lemaitre V, Soloway PD, D’Armiento J. Increased medial degradation with pseudo-aneurysm formation in apolipoprotein E-knockout mice deficient in tissue inhibitor of metalloproteinases-1. Circulation. 2003; 107: 333–338.[Abstract/Free Full Text]
  25. Deleted in proof.
  26. Li Z, Hou WS, Bromme D. Collagenolytic activity of cathepsin K is specifically modulated by cartilage-resident chondroitin sulfates. Biochemistry. 2000; 39: 529–536.[CrossRef][Medline] [Order article via Infotrieve]
  27. Seidelmann SB, De Luca C, Leibel RL, Breslow JL, Tall AR, Welch CL. Quantitative trait locus mapping of genetic modifiers of metabolic syndrome and atherosclerosis in low-density lipoprotein receptor-deficient mice: identification of a locus for metabolic syndrome and increased atherosclerosis on chromosome 4. Arterioscler Thromb Vasc Biol. 2005; 25: 204–210.[Abstract/Free Full Text]
  28. Yvan-Charvet L, Matsuura F, Wang N, Bamberger MJ, Nguyen T, Rinninger F, Jiang XC, Shear CL, Tall AR. Inhibition of cholesteryl ester transfer protein by torcetrapib modestly increases macrophage cholesterol efflux to HDL. Arterioscler Thromb Vasc Biol. 2007; 27: 1132–1138.[Abstract/Free Full Text]
  29. Welch CL, Bretschger S, Latib N, Bezouevski M, Guo Y, Pleskac N, Liang CP, Barlow C, Dansky H, Breslow JL, Tall AR. Localization of atherosclerosis susceptibility loci to chromosomes 4 and 6 using the Ldlr knockout mouse model. Proc Natl Acad Sci U S A. 2001; 98: 7946–7951.[Abstract/Free Full Text]
  30. Jawien J, Nastalek P, Korbut R. Mouse models of experimental atherosclerosis. J Physiol Pharmacol. 2004; 55: 503–517.[Medline] [Order article via Infotrieve]
  31. Malarstig A, Lindahl B, Wallentin L, Siegbahn A. Soluble CD40L levels are regulated by the –3459 A>G polymorphism and predict myocardial infarction and the efficacy of antithrombotic treatment in non-ST elevation acute coronary syndrome. Arterioscler Thromb Vasc Biol. 2006; 26: 1667–1673.[Abstract/Free Full Text]
  32. Varo N, de Lemos JA, Libby P, Morrow DA, Murphy SA, Nuzzo R, Gibson CM, Cannon CP, Braunwald E, Schonbeck U. Soluble CD40L: risk prediction after acute coronary syndromes. Circulation. 2003; 108: 1049–1052.[Abstract/Free Full Text]
  33. Beltroy EP, Richardson JA, Horton JD, Turley SD, Dietschy JM. Cholesterol accumulation and liver cell death in mice with Niemann-Pick type C disease. Hepatology. 2005; 42: 886–893.[CrossRef][Medline] [Order article via Infotrieve]
  34. Yasuda Y, Li Z, Greenbaum D, Bogyo M, Weber E, Bromme D. Cathepsin V, a novel and potent elastolytic activity expressed in activated macrophages. J Biol Chem. 2004; 279: 36761–36770.[Abstract/Free Full Text]
  35. Sukhova GK, Shi GP, Simon DI, Chapman HA, Libby P. Expression of the elastolytic cathepsins S and K in human atheroma and regulation of their production in smooth muscle cells. J Clin Invest. 1998; 102: 576–583.[Medline] [Order article via Infotrieve]
  36. Newby AC. Do metalloproteinases destabilize vulnerable atherosclerotic plaques? Curr Opin Lipidol. 2006; 17: 556–561.[Medline] [Order article via Infotrieve]
  37. Lutgens E, Lutgens SP, Faber BC, Heeneman S, Gijbels MM, de Winther MP, Frederik P, van der Made I, Daugherty A, Sijbers AM, Fisher A, Long CJ, Saftig P, Black D, Daemen MJ, Cleutjens KB. Disruption of the cathepsin K gene reduces atherosclerosis progression and induces plaque fibrosis but accelerates macrophage foam cell formation. Circulation. 2006; 113: 98–107.[Abstract/Free Full Text]
  38. Watson KE, Peters Harmel AL, Matson G. Atherosclerosis in type 2 diabetes mellitus: the role of insulin resistance. J Cardiovasc Pharmacol Ther. 2003; 8: 253–260.[Abstract/Free Full Text]
  39. Atherosclerotic disease of the aortic arch as a risk factor for recurrent ischemic stroke: the French Study of Aortic Plaques in Stroke Group. N Engl J Med. 1996; 334: 1216–1221.[Abstract/Free Full Text]
  40. Loftus SK, Erickson RP, Walkley SU, Bryant MA, Incao A, Heidenreich RA, Pavan WJ. Rescue of neurodegeneration in Niemann-Pick C mice by a prion-promoter-driven Npc1 cDNA transgene. Hum Mol Genet. 2002; 11: 3107–3114.[Abstract/Free Full Text]
 

CLINICAL PERSPECTIVE

The formation of an occluding thrombus on a ruptured or eroded atherosclerotic plaque is the hallmark event leading to acute coronary syndromes, myocardial infarction, and sudden death in humans. However, other species are highly resistant to plaque complications, and the specific processes predisposing to plaque destabilization and thrombosis are poorly understood. We generated apolipoprotein E–deficient mice carrying an additional null mutation of a gene regulating intracellular cholesterol transport (the Niemann-Pick C1 gene). Remarkably, the double-mutant mice developed large, protruding thrombi associated with atherosclerotic plaques and prominent medial degradation with inflammatory cell infiltration into the adventitia. An investigation of the underlying mechanisms suggested that susceptibility to plaque complications involved genetic background effects, induction of cathepsin K expression, and secretion from macrophages, as well as an underlying prothrombotic state. Soluble CD40 ligand appeared to be a sensitive marker of atherothrombosis, as has been suggested in some human studies. Similarly, atherothrombosis in humans may involve a complex interaction of factors involving both plaque instability and a prothrombotic state.


*    Footnotes
 
*Drs Welch and Sun contributed equally to this work. Back

The online Data Supplement can be found with this article at http://circ.ahajournals.org/cgi/content/full/CIRCULATIONAHA.107.701276/DC1.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
116/21/2444    most recent
CIRCULATIONAHA.107.701276v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Welch, C. L.
Right arrow Articles by Tall, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Welch, C. L.
Right arrow Articles by Tall, A. R.
Related Collections
Right arrow Arterial thrombosis
Right arrow Genetics of cardiovascular disease
Right arrow Animal models of human disease

Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search
Copyright © 2007 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited.