Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2007;116:2043-2052
Published online before print October 15, 2007, doi: 10.1161/CIRCULATIONAHA.107.697789
CLINICAL PERSPECTIVE
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
116/18/2043    most recent
CIRCULATIONAHA.107.697789v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Niessner, A.
Right arrow Articles by Weyand, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Niessner, A.
Right arrow Articles by Weyand, C. M.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Related Collections
Right arrow Pathophysiology
Right arrow Cell biology/structural biology
Right arrow Growth factors/cytokines
Right arrow Acute coronary syndromes

(Circulation. 2007;116:2043-2052.)
© 2007 American Heart Association, Inc.


Molecular Cardiology

Synergistic Proinflammatory Effects of the Antiviral Cytokine Interferon-{alpha} and Toll-Like Receptor 4 Ligands in the Atherosclerotic Plaque

Alexander Niessner, MD; Min Sun Shin, PhD; Olga Pryshchep, BS; Jörg J. Goronzy, MD, PhD; Elliot L. Chaikof, MD, PhD; Cornelia M. Weyand, MD, PhD

From the Kathleen B. and Mason I. Lowance Center for Human Immunology, Department of Medicine (A.N., M.S.S., O.P., J.J.G., C.M.W.), and the Department of Surgery (E.L.C.), Emory University School of Medicine, Atlanta, Ga.

Correspondence to Cornelia M. Weyand, MD, PhD, Lowance Center for Human Immunology, Emory University, 101 Woodruff Cir, Atlanta, GA 30322. E-mail cweyand{at}emory.edu

Received February 19, 2007; accepted August 28, 2007.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— Interferon (IFN)-{alpha} is a pluripotent inflammatory cytokine typically induced by viral infections. In rupture-prone atherosclerotic plaques, plasmacytoid dendritic cells produce IFN-{alpha}. In the present study we explored the contribution of IFN-{alpha} to inflammation and tissue injury in the plaque microenvironment.

Methods and Results— In 53% of carotid plaques (n=30), CD123+ plasmacytoid dendritic cells clustered together with CD11c+ myeloid dendritic cells, a distinct dendritic cell subset specialized in sensing danger signals from bacteria and tissue breakdown. Tissue concentrations of IFN-{alpha} and tumor necrosis factor (TNF)-{alpha} transcripts were tightly correlated (r=0.76, P<0.001), suggesting a regulatory role of IFN-{alpha} in TNF-{alpha} production. Plaque tissue stimulation with CpG ODN, a Toll-like receptor (TLR) 9 ligand, increased IFN-{alpha} production (57.8±23.7 versus 25.9±8.6 pg/mL; P<0.001), whereas the TLR4 ligand lipopolysaccharide induced TNF-{alpha} secretion (225.1±3.0 versus 0.7±0.2 pg/mL; P<0.001). Treating plaque tissue with IFN-{alpha} markedly enhanced lipopolysaccharide-triggered TNF-{alpha} secretion (559.0±25.9 versus 225.1±3.0 pg/mL; P<0.001). IFN-{alpha} pretreatment also amplified the effects of lipopolysaccharide on interleukin-12, interleukin-23, and matrix metalloproteinase-9, suggesting that the antiviral cytokine sensitized myeloid dendritic cells and macrophages toward TLR4 ligands. Mechanistic studies demonstrated that IFN-{alpha} modulated the myeloid dendritic cell response pattern by upregulating TLR4 expression (P<0.001) involving both the STAT (signal transducer and activator of transcription) and the PI(3)K pathway.

Conclusions— In the atherosclerotic plaque, IFN-{alpha} functions as an inflammatory amplifier. It sensitizes antigen-presenting cells toward pathogen-derived TLR4 ligands by upregulating TLR4 expression and intensifies TNF-{alpha}, interleukin-12, and matrix metalloproteinase-9 production, all implicated in plaque destabilization. Thus, IFN-{alpha}–inducing pathogens, even when colonizing distant tissue sites, threaten the stability of inflamed atherosclerotic plaque.


Key Words: dendritic cell • inflammation • interferon-{alpha} • interleukins • toll-like receptor


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The atherosclerotic plaque, a vessel wall lesion formed around deposited lipids, is now understood as a specialized tissue microenvironment containing a chronic inflammatory infiltrate.1 Innate and adaptive immune cells are recruited into the plaque where they interact with resident cells to build the atherosclerotic lesion. Emerging concepts highlight the diversity of inflammatory cells, with each cell type contributing unique functional capabilities.2 Plaque infiltrates are composed of macrophages, dendritic cells (DCs), and lymphocytes.3 Macrophages have been implicated in lipid uptake and tissue injury through releasing metalloproteinases and reactive oxygen intermediates. Much less is known about plaque-residing DCs.3–5 When we extrapolate from the prime role DCs play in sensing infections, presenting antigenic peptides to T lymphocytes, and producing chemokines to support lymphoid organogenesis, it is clear that plaque-residing DCs are versatile and interfere with multiple immunopathways in this specialized tissue niche.

Clinical Perspective p 2052

We reported recently that human coronary and carotid plaques contain myeloid DCs (mDCs) in close cell-cell contact with T cells. Such mDCs are highly activated and produce the T-cell–attracting chemokines CCL19 and CCL21.5 Likewise, plasmacytoid DCs (pDCs), a distinct DC subpopulation implicated in regulating antiviral immune responses, populate the inflamed atherosclerotic plaque.6 Dysfunctional pDCs are now recognized as disease relevant in autoimmune syndromes, such as systemic lupus erythematosus (SLE).7 Activated pDCs have the unique ability to produce large amounts of interferon (IFN)-{alpha}. Potential triggers are viral as well as bacterial infections.8 pDCs sense infections through intracellular Toll-like receptors (TLR), specifically TLR7 and TLR9.9 IFN-{alpha} enhances CD8 T cell and natural killer cell cytotoxicity. In addition, IFN-{alpha} boosts the cytotoxic capacity of CD4 T cells, the main lymphocyte type in the atherosclerotic plaque. IFN-{alpha} enables CD4 T cells to kill stressed vascular smooth muscle cells in a TNF-related apoptosis-inducing ligand (TRAIL)–dependent way,6,10 threatening the stability of atherosclerotic lesions.11

The present study was designed to explore whether IFN-{alpha} produced in the plaque has immunoregulatory functions involving cell populations other than CD4 lymphocytes. We asked whether IFN-{alpha} affects the cytokine profile of inflamed atheroma and whether it influences the functional portfolio of antigen-presenting cells (APCs), such as macrophages and mDCs. After sensing infectious intruders, pDCs must mobilize and heighten adaptive immune responses, most effectively by regulating the functional activity of mDCs. mDCs are equipped with many pathogen-sensing TLRs, but their repertoire is distinct from that of pDCs, thereby avoiding microbe immune escape. Macrophages and mDCs express TLR1, TLR2, TLR3, TLR4, TLR5, and TLR8.9 TLR4 plays a pivotal role in plaque inflammatory activation. Circulating monocytes overexpress TLR4 during acute coronary syndrome,12 and TLR4 is expressed in atherosclerotic plaques.13,14 Apolipoprotein E knockout mice lacking TLR4 develop reduced atherosclerotic lesions,15 and a TLR4 genetic variation is associated with diminished risk of atherosclerosis.16 Apart from microbial molecules such as lipopolysaccharides, autoantigens found in the plaque environment are also candidates for TLR4-dependent activation of APCs.14,17–19

When activated by TLR ligands, macrophages and mDCs release powerful proinflammatory cytokines, such as TNF-{alpha} and interleukin (IL)-12. TNF-{alpha} activates every cellular component of the atheroma. IL-12 biases T cells toward the Th1 pathway and induces cellular recruitment into the lesion.20

Recent data suggest that mDCs and pDCs do not function independently but rather initiate and maintain immune responses in a coordinated fashion. Cross talk may be induced after simultaneous triggering of different TLRs.21 Particularly, TLR3- and TLR9-induced type I IFN may modulate mDC activation.22 It is also likely that mDCs and pDCs positioned in the atherosclerotic plaque are aware of each other and cross-regulate each other’s function. Here we report that IFN-{alpha} released from pDCs after triggering of TLR9 has profound effects on the plaque microenvironment, markedly boosting lipopolysaccharide-mediated inflammatory responses by directly modifying TLR4 expression levels. Thus, the infection-induced product IFN-{alpha} controls the response threshold of TLR4-expressing cells, predicting that infectious episodes and intrinsic dysregulation of IFN-{alpha} (eg, in SLE) render the host susceptible to plaque destabilization.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Specimen
Thirty carotid artery specimens were collected from patients (60% male, aged 72±8 years) undergoing endarterectomy procedures. Forty-three percent of the patients were symptomatic for cerebral ischemia. Baseline clinical characteristics of the patient cohort have been described.6 The institutional review board approved all protocols, and appropriate consent was obtained.

Immunohistochemistry
Carotid plaque tissue frozen sections were prepared as described previously.10 Acetone-fixed 5-µm sections were incubated with anti-CD11c (1:200, Dako, Glostrup, Denmark), anti-fascin (Dako), anti–DC-sign (BD Pharmingen, San Jose, Calif), anti-CD123 (1:100, BD Pharmingen), and anti–IFN-{alpha} (1:400, BD Pharmingen) for 1 hour at room temperature. Five percent of goat serum was added to inhibit nonspecific staining. Biotin-conjugated goat anti-mouse antibody (Dako) served as secondary antibody (1:125 to 1:400, 30 minutes at room temperature). Brown color development was achieved with the use of a peroxidase solution (ABC-peroxidase kit, Vector Laboratories, Burlingame, Calif) and 3,3'-diaminobenzidine (DAB) (Dako) as chromogen. Slides were counterstained with hematoxylin for 2 minutes.

Quantitative Reverse Transcription Polymerase Chain Reaction
Total RNA was isolated from shock-frozen endarterectomy tissues and cell culture samples with the use of TRIzol (Invitrogen Life Technologies, Grand Island, NY) and transformed into cDNA with the use of AMV reverse transcriptase (Roche Molecular Biochemicals, Indianapolis, Ind). cDNA was amplified with primers specific for TNF-{alpha} (5'-CTTTGGGATCATTGCCCTGTG-3' and 5'CGAAGTGGTGGTCTTGTTGCT-3'), IL-12p40 (5'-CCATTGAGGTCATGGTGGAT-3' and 5'-CAGGGAGAAGTAGGAATGTGG-3'), IL-12p35 (5'-TCCTAAAAAGCGAGGTCCC-3' and 5'-GGTATCATGTGGATGTAATAGTCCC-3'), IL-23p19 (5'-ATCCCCAAATTTCCCTTCC-3' and 5'-AATCTACCACCCCAGGCAC-3'), matrix metalloproteinase (MMP)-9 (5'-TCGAACTTTGACAGCGACAAGAA-3' and 5'-TCAGGGCGAGGACCATAGAGG-3'), TLR4 (5'-CTGCAATGGATCAAGGACCA-3' and 5'-TTATCTGAAGGTGTTGCACATTCC-3'), IFN-{alpha} (5'-ATGCGGACTCCATCTTG-3' and 5'-CGTGACCTGGTGTATGAG-3'), and TRAIL (5'-ATGGCTATGATGGAGGTCCAG-3' and 5'-TTGTCCTGCATCTGCTTCAGC-3'). Amplification with β-actin–specific primers (5'-ATGGCCACGGCTGCTTCCAGC-3' and 5'-CATGGTGGTGCCGCCAGACAG-3') provided a positive control. The quantitative reverse transcription polymerase chain reaction (RT-PCR) procedure with the use of a Mx3000 PCR machine (Stratagene, Cedar Creek, Tex) was described previously.6 For each sample, PCR reactions were completed in triplicate. Expression levels were determined by interpolation with a standard curve. cDNA copies were adjusted for 2x105 β-actin copies.

Stimulation of Explanted Atherosclerotic Plaque Tissue
Fresh tissues from 25 soft lipid-rich carotid plaques were processed as reported previously.6 Small plaque tissue pieces were randomly distributed into a 48-well plate. Tissue was stimulated with 1 µg/mL lipopolysaccharide (Escherichia coli, 0127:B8, Sigma-Aldrich, St Louis, Mo), 200 U/mL IFN-{alpha} (PBL Biomedical Laboratories, Piscataway, NJ), or 100 µg/mL synthetic CpG ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGT) for the indicated times in RPMI medium containing 10% fetal calf serum. To avoid imbalances, stimulations were done in duplicates in tissue pieces deriving from 1 plaque. After stimulation, tissue was shock-frozen for RNA isolation. IFN-{alpha} and TNF-{alpha} in supernatants were quantified by enzyme-linked immunosorbent assay (ELISA) (PBL and Amersham Biosciences, UK).

In Vitro Stimulation
CD14+ cells were isolated from fresh peripheral blood mononuclear cells by magnetic beads (Miltenyi, Auburn, Calif). To generate immature mDCs, cells were cultured for 6 days in IL-4 (1000 U/mL) and granulocyte-monocyte colony-stimulating factor (800 U/mL, R&D, Minneapolis, Minn). In parallel, the human monocytoid cell line THP-1 (acute monocytic leukemia) was used for in vitro experiments. Cells were stimulated with 1 µg/mL lipopolysaccharide and 200 U/mL IFN-{alpha} (PBL) in RPMI medium containing 10% fetal calf serum. Chemical inhibitors were used at concentrations specific for Janus kinase (JAK) (3 nmol/L, JAK Inhibitor I, catalog No. 420099),23 nuclear factor (NF)-{kappa}B24 (10 nmol/L, NF-{kappa}B Activation Inhibitor, catalog No. 481406; both Calbiochem, Nottingham, Germany), PI(3)K (50 µmol/L, LY294002, InvivoGen, San Diego, Calif), and histone deacetylase (HDAC) (0.1 µmol/L, Trichostatin A; Sigma-Aldrich). Phosphorylation of AKT on S473 was measured with the use of phospho-AKT (S-473) ELISA (Biosource, Camarillo, Calif).

Western Blotting
mDC lysates (10 µg) were separated on SDS-PAGE gel (Bio-Rad Laboratories, Hercules, Calif). Proteins were transferred to a polyvinylidene difluoride membrane (Amersham) and blocked with 5% skim milk. The membrane was incubated with a 1:250 dilution of polyclonal rabbit anti-human TLR4 AB (H80, Santa Cruz Biotechnology, Santa Cruz, Calif) overnight at 4°C, followed by washing with TBS-Tween-20. The membrane was subsequently incubated with horseradish peroxidase–conjugated goat anti-rabbit IgG (1:6000; Santa Cruz) for 1 hour at room temperature. After thorough washing, membranes were developed with the use of a luminol-based substrate (Boston Bioproducts, Worcester, Mass). To ensure equal loading, membranes were stripped and reprobed with the use of goat anti-human actin AB (1:4000; Santa Cruz).

Statistical Analysis
All data are shown as mean±SE and were analyzed by t tests for independent and paired samples when appropriate. Nonparametric data were log10-transformed before statistical analysis. ANOVA for single and repeated measures with a Tukey post hoc test was used for comparison of >2 groups. All analyses were calculated with the use of SPSS software package 12.0 for Windows (Chicago, Ill).

The authors had full access to and take full responsibility for the integrity of the data. All authors have read and agree to the manuscript as written.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
mDC and pDC in Atherosclerotic Plaque
In a set of 30 carotid endarterectomy samples, 53% of the tissues contained not only CD123+ pDCs but also CD11c+DC-Sign+fascin+ mDCs. Both DC populations were preferentially localized in the shoulder region (Figure 1A) and at the plaque base (Figure 1B). The DC subtypes were consistently found in close vicinity but clearly represented distinct cell populations (Figure 1C and Figure in the online-only Data Supplement). The mDC:pDC ratio in atherosclerotic plaques was 2.7.


Figure 1187021
View larger version (78K):
[in this window]
[in a new window]

 
Figure 1. mDCs and pDCs in atherosclerotic plaque. Serial frozen sections from carotid atherosclerotic plaques were stained for mDCs with anti-CD11c antibody (A and B, left panels; DAB, brown) and for pDCs with anti-CD123 antibody (A and B, right panels, DAB, brown; A, magnification x100; insets, magnification x400; B, magnification x200). Both DC types were found in the shoulder (A) and at the plaque base (B). An overlay of CD11c (blue) and CD123 (red) stains at the base showed that these cells cluster in close vicinity (C).

To examine mDC and pDC regulatory roles in the plaque environment, we used an organ culture system. Randomly distributed pieces of atherosclerotic plaques were placed into tissue culture and incubated with different TLR ligands. To target the distinct DC subtypes, we exploited their unique TLR expression patterns. Binding of CpG ODN ligands to TLR9 more than doubled IFN-{alpha} secretion within 24 hours (P<0.001; Figure 2A). On CpG ODN stimulation, the number of tissue-residing cells staining positive for IFN-{alpha} increased 2-fold (P<0.001 Figure 2B). This unservation suggests that only a fraction of pDCs is activated at baseline and that a nonactivated pDC reserve, which can be brought into a cytokine-producing state on TLR9-ligand exposure, resides in the tissue.


Figure 2187021
View larger version (13K):
[in this window]
[in a new window]

 
Figure 2. TLR4 and TLR9 ligands regulate cytokine production in the atheroma. The TLR9 ligand CpG ODN was added to organ cultures of lipid-rich plaque pieces. IFN-{alpha} production was compared between cultures without (control) or with CpG ODN (100 µg/mL) after 24 hours. IFN-{alpha} release into the supernatant was measured by ELISA (A; n=18 per group). The induction of IFN-{alpha} production in the plaque tissue was further assessed by comparing the number of IFN-{alpha}–producing cells with the use of immunohistochemistry. Representative pictures show IFN-{alpha}–producing cells (DAB, brown) in the absence (control) or presence of CpG ODN in plaque tissue sections (B, left). The number of IFN-{alpha}–producing cells was quantified by counting 5 high-power fields per section (magnification x400) in 5 nonadjacent sections from 5 different plaques per group (B, right). Alternatively, plaque tissue was stimulated with the TLR4 ligand lipopolysaccharide (LPS) (1 µg/mL). TNF-{alpha} secretion into the supernatant was measured by ELISA after 24 hours of organ culture without (control) or with LPS (C; n=10 per group).

Additionally, incubating intact atheroma tissue with the TLR4 ligand lipopolysaccharide promptly induced marked upregulation of TNF-{alpha} secretion (P<0.001; Figure 2C). Baseline TNF-{alpha} release was essentially undetectable, suggesting that spontaneous TLR4 ligand concentrations in the tissue are too low or that chronically stimulated atheroma cells have adapted by downregulating TLR4.

Synergistic Effects of IFN-{alpha} Production and TLR4 Ligation in the Plaque Microenvironment
The presence of functionally distinct DC subtypes within the plaque inflammatory infiltrate raised the question of whether cross-regulation between these APCs occurred. To address this, we bypassed pDC stimulation and exposed plaque organ cultures to IFN-{alpha}. Tissue macrophage and mDC functions were assessed by measuring TNF-{alpha}, IL-12p40, IL-12p35, IL-23p19, and MMP-9. Whereas these markers remained unaffected by IFN-{alpha} alone (Figure 3), lipopolysaccharide stimulation of intact plaque fragments resulted in enhanced transcription of all 5 (Figure 3). TNF-{alpha} secretion increased from immeasurable to >200 pg/mL (Figure 3B). Most remarkable was a pronounced enhancement of all inflammatory markers if IFN-{alpha} and lipopolysaccharide were combined. In the presence of IFN-{alpha}, lipopolysaccharide stimulation more than doubled TNF-{alpha}, IL-12p40, and MMP-9 transcription and amplified TNF-{alpha} protein secretion from 225.1±3.0 to 559.0±25.9 pg/mL (P<0.001). In addition, IFN-{alpha} enhanced lipopolysaccharide-induced IL-12p35 and IL-23p19 transcription, providing the conditions for parallel IL-12 and IL-23 production (Figure 3D, 3E). Thus, IFN-{alpha} sensitized tissue macrophages and mDCs to the stimulatory effect of TLR4 ligation. In contrast, mDC effector molecules such as TNF-{alpha} did not affect IFN-{alpha}–producing pDCs (data not shown).


Figure 3187021
View larger version (27K):
[in this window]
[in a new window]

 
Figure 3. Synergistic effects of TLR4 ligands and IFN-{alpha} in plaque tissue. Pieces of lipid-rich plaque tissue were stimulated with IFN-{alpha} (200 U/mL), lipopolysaccharide (LPS) (1 µg/mL), or both ligands combined and compared with an unstimulated part of the plaque. Transcripts of TNF-{alpha} (A), IL-12p40 (C), IL-12p35 (D), IL-23p19 (E), and MMP-9 (F) after 4 hours of stimulation were measured by quantitative RT-PCR and adjusted for 2x105 β-actin copies. Representative results from 1 of 3 experiments per group are shown. Secretion of TNF-{alpha} (B) into the supernatant was measured by ELISA (n=10 per group). *P<0.001 compared with control; {dagger}P<0.001 compared with LPS.

IFN-{alpha} Enhances Isolated mDC and Monocyte Sensitivity to Lipopolysaccharide
To study whether the immunomodulatory effect of IFN-{alpha} resulted from its direct action on monocytes and mDCs, lipopolysaccharide responsiveness of in vitro–generated mDCs and the monocytic cell line THP-1 was determined in the absence and presence of IFN-{alpha}. TNF-{alpha} mRNA production of mDCs was unchanged with IFN-{alpha}, increased with lipopolysaccharide, and dramatically amplified with the lipopolysaccharide/IFN-{alpha} combination (Figure 4A). The same pattern was observed for monocytic cells (Figure 4B). IL-12p40 and MMP-9 transcriptions were similarly boosted by combining IFN-{alpha} with lipopolysaccharide (data not shown).


Figure 4187021
View larger version (23K):
[in this window]
[in a new window]

 
Figure 4. IFN-{alpha} sensitizes monocyte-derived mDCs and monocytes to the stimulatory effects of TLR4 ligation. Monocyte-derived mDCs (150 000 cells per well [A]) or THP-1 cells (500 000 cells per well [B]) were stimulated with IFN-{alpha} (200 U/mL), lipopolysaccharide (LPS) (1 µg/mL), or their combination for 4 hours and compared with unstimulated cells. Transcripts of TNF-{alpha} were measured by quantitative RT-PCR and adjusted for 2x105 β-actin copies. Representative results from 1 of 3 experiments per group are shown. To examine the contribution of the NF-{kappa}B and JAK(-STAT) pathways, specific inhibitors (Inh) for these pathways were added to mDCs stimulated with LPS and IFN-{alpha} at optimal concentrations (C).

To determine the signaling pathways involved in this amplification loop, we added JAK/signal transducer and activator of transcription (STAT) and NF-{kappa}B pathway inhibitors. Both disrupted lipopolysaccharide and IFN-{alpha} synergistic effects, implicating both signaling pathways in the combined action of TLR4 and IFN-{alpha} (Figure 4C).

Association of TNF-{alpha} and IFN-{alpha} Production in Plaque Tissue
To examine whether IFN-{alpha} is associated with mDC and monocyte/macrophage TNF-{alpha} production in atherosclerotic plaques in vivo, we measured transcription levels of both cytokines in 30 native atherosclerotic plaques from carotid endarterectomy samples. IFN-{alpha} and TNF-{alpha} mRNA tissue concentrations were tightly correlated (n=30; r=0.76, P<0.001), suggesting IFN-{alpha}–mediated TNF-{alpha} regulation in vivo (Figure 5).


Figure 5187021
View larger version (12K):
[in this window]
[in a new window]

 
Figure 5. Association of TNF-{alpha} and IFN-{alpha} in plaque tissue. IFN-{alpha} and TNF-{alpha} mRNA concentrations in 30 native carotid endarterectomy samples were determined by quantitative RT-PCR. Results were adjusted for 2x105 β-actin copies and correlated as shown by scatterplot.

IFN-{alpha} Modulates Lipopolysaccharide Responsiveness by Upregulating TLR4 Expression
To determine underlying mechanisms through which IFN-{alpha} can profoundly change how mDCs and monocytes/macrophages react to TLR4 triggering, we examined whether this cytokine alters TLR4 expression. Kinetic experiments demonstrated that IFN-{alpha} increased the copy numbers of TLR4-specific transcripts after 6 hours of incubation (P<0.001; Figure 6A). As described previously,25 lipopolysaccharide stimulation downregulated TLR4 mRNA production with only minimal copy numbers detectable after 6 hours (P<0.001). This downregulatory effect of lipopolysaccharide stimulation was completely abrogated in the presence of IFN-{alpha}. Indeed, the combination of IFN-{alpha} and lipopolysaccharide produced by far the highest concentrations of TLR4-specific sequences after 2, 4, and 6 hours (P<0.001 compared with control and IFN-{alpha}).


Figure 6187021
View larger version (29K):
[in this window]
[in a new window]

 
Figure 6. IFN-{alpha} regulates expression of TLR4. A, TLR4 transcripts in monocyte-derived mDCs (150 000 cells per well) were measured by quantitative RT-PCR after stimulation with IFN-{alpha} (200 U/mL), lipopolysaccharide (LPS) (1 µg/mL), or their combination and compared with unstimulated mDCs. Representative results adjusted for 2x105 β-actin copies after 2, 4, and 6 hours from 1 of 3 experiments per group are shown. P<0.001 LPS+IFN compared with control, IFN alone, or LPS alone by ANOVA. P<0.001 IFN alone or LPS alone compared with control by ANOVA. B, Western blotting of mDC lysates (10 µg protein) confirmed that TLR4 was downregulated by LPS alone but increased after IFN-{alpha} stimulation. mDCs were stimulated as indicated for 6 hours. Actin served as loading control. Representative results from 1 of 3 experiments are shown. C and D, To explore cellular mechanisms responsible for IFN-{alpha}–dependent TLR4 upregulation, THP-1 cells were preincubated with inhibitors (Inh) specific for HDAC (4 hours), NF-{kappa}B (1 hour), and PI(3)K (1 hour) at optimal concentrations before stimulation with 200 U/mL IFN-{alpha} for 4 hours. Transcripts of TLR4 and TRAIL were measured by quantitative RT-PCR and adjusted for 2x105 β-actin copies. E, THP-1 cells were stimulated with 200 U/mL IFN-{alpha} for 10 minutes and 20 minutes, and AKT phosphorylation was determined by ELISA. AKT activation was suppressed with the PI(3)K inhibitor. *P<0.05 and P=NS compared with control at 10 minutes. Results represent 3 independent cultures.

To assess whether the altered TLR4 transcription translated into protein production, TLR4 was quantified by Western blotting (Figure 6B). IFN-{alpha} treatment enhanced the quantity of TLR4 protein, whereas lipopolysaccharide stimulation resulted in almost complete loss. This negative feedback regulation of lipopolysaccharide was clearly prevented by IFN-{alpha}; combined stimulation with IFN-{alpha} and lipopolysaccharide maintained high TLR4 protein concentrations in the cells.

To clarify cellular mechanisms responsible for IFN-{alpha}–dependent upregulation of TLR4, we screened several putative signaling pathways. PI(3)K inhibition suppressed IFN-{alpha}–induced TLR4 expression below the control level, indicating a dominant role of the PI(3)K-AKT pathway (Figure 6C). Measuring phosphorylation of AKT at position S473 confirmed that IFN-{alpha} activated AKT (P<0.05, Figure 6E). This activation again could be abolished with the PI(3)K inhibitor. In contrast to the prominent effect of the PI(3)K inhibitor, NF-{kappa}B inhibition only moderately suppressed IFN-{alpha}–mediated TLR4 expression (Figure 6C). To assess the role of epigenetic regulation, we utilized the HDAC inhibitor trichostatin A. Although IFN-{alpha}–induced TLR4 upregulation was not affected by HDAC inhibition, the regulation of TRAIL, another IFN-{alpha}–regulated molecule in the atherosclerotic plaque,6 was clearly sensitive to inhibiting HDAC (Figure 6C and 6D). Of note, inhibition of the PI(3)K and NF-{kappa}B pathway reduced the IFN-{alpha}–induced upregulation of both molecules in a similar pattern.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The present study explored functional activities of the antiviral cytokine IFN-{alpha} in the atherosclerotic plaque. Unstable atherosclerotic lesions are IFN-{alpha}–rich tissues; pDCs provide this powerful immunoregulatory cytokine.6 IFN-{alpha}–producing pDCs preferentially home to the shoulder region of rupture-prone atheromas. They sense viral-derived double-stranded DNA motifs; plaque tissue stimulation with the TLR9 ligand CpG ODN increases tissue secretion of IFN-{alpha}. Data reported here identify mDCs, a distinct set of DCs specialized in antigen presentation and T-cell instruction, as a primary target of tissue IFN-{alpha}. Clustered together with pDCs, such mDCs respond to IFN-{alpha} with a marked change in their activation threshold. Specifically, their reaction pattern to the bacterial motif lipopolysaccharide, a TLR4 ligand, is highly sensitive to IFN-{alpha} regulation. When exposed to IFN-{alpha}, mDCs produce markedly higher amounts of the proinflammatory cytokines TNF-{alpha}, IL-12, and IL-23 and boost their MMP-9 production, all mediators implicated in rendering plaque susceptible to rupture. This immune amplification loop assigns a critical function to IFN-{alpha} in adjusting the responsiveness of plaque-residing cells to stimulatory signals and identifies this innate immune marker as a key regulator in plaque inflammation and destabilization. IFN-{alpha} is typically induced during viral infections, raising the possibility that such infectious episodes expose patients to an immediate risk for acute complications of atherosclerosis.

IFN-{alpha} did not directly stimulate TNF-{alpha}, IL-12, IL-23, and MMP-9 but functioned by adjusting the response threshold of intact plaque tissue and isolated mDCs and monocytes to lipopolysaccharide. Lipopolysaccharide binding to TLR4 has been implicated in stimulating plaque inflammation.26 Molecular studies of the sensitizing effect of IFN-{alpha} for "danger signals" revealed enhancement of TLR4 signaling at the receptor level. Unexpectedly, this IFN-{alpha} effect was not only mediated through the STAT pathway but also involved the PI(3)K pathway. By upregulating TLR4 transcription and expression on APCs, IFN-{alpha} emerges as a critical regulator of mDC function. IFN-{alpha} has been reported to also upregulate MyD88, enhancing intracellular signaling via TLR4.27 The effect of IFN-{alpha} on TLR4 is unique; other cytokines like TNF-{alpha} or IFN-{gamma} lead to little or no TLR4 increase.28

Although binding of lipopolysaccharide to TLR4 usually results in receptor downregulation, causing endotoxin tolerance,25 IFN-{alpha} was capable of counteracting this inhibitory effect. Thus, simultaneous signaling of TLR9, triggering IFN-{alpha} production, and TLR4, inducing cytokine production, is required for a sustained immune response to TLR4 ligands. The necessity of recognizing >1 pathogen-associated molecular pattern through different TLRs has important consequences for the induction of adequate immunity. This mechanism prevents immune system activation in response to nonpathogenic structures mimicking only 1 pathogen detail. Requirements for multiple layers of APC activation create an elaborate security system and protect peripheral tolerance. TNF-{alpha} production in the plaque tissue was dependent on the synergistic action of IFN-{alpha} and lipopolysaccharide, building a considerable barrier for the induction of this powerful proinflammatory molecule. Placing IFN-{alpha} at the top of a hierarchical system in which immunoregulatory DCs first respond to virus-derived attack signals via TLR7 and TLR9 and then intensify their reaction to bacterial materials via TLR4 offers additional host protection. In chronic inflammatory disease, in which similar pathways of immunostimulation cause tissue damage instead of host protection, the coupling of viral immune responses with enhanced TNF-{alpha}, IL-12, IL-23, and MMP-9 production increases damage risk. Accordingly, patients harboring chronic inflammatory lesions, such as vulnerable atheromas, should be at particular risk for tolerance breakdown and tissue injury when battling viral infections.

IFN-{alpha}–producing pDCs classically respond to respiratory syncytial virus, influenza virus, herpes simplex virus, or cytomegalovirus, which have all been found in atherosclerotic lesions.29,30 In addition, TLR9 expressed by pDCs may recognize endogenous danger signals in the atherosclerotic plaque. In particular, self-DNA is able to trigger pDCs via TLR9.31 Apoptotic cells in the atherosclerotic plaque may be an important source of DNA that triggers TLR9 signaling.11,32 Self-DNA may also be an important trigger of IFN-{alpha} production in SLE patients who have an elevated risk for cardiovascular events.32

Biological effects of IFN-{alpha} in the tissue are clearly much broader than currently appreciated. Our group has recently shown that IFN-{alpha} is a critical regulator of T-cell function.6 By inducing the death ligand TRAIL on CD4 T cells, IFN-{alpha} has profound effects on tissue integrity because TRAIL-expressing CD4 T cells mediate apoptosis of death receptor–expressing cell populations. This is particularly important for stressed plaque-residing vascular smooth muscle cells, which become the targets of cytotoxic T cells.6,10 Current data widen the scope of potential biological functions of intraplaque IFN-{alpha}, now encompassing regulation of mDC and macrophage sensitivity to TLR4 ligands. IFN-{alpha}–facilitated recognition of TLR4 ligands may affect inflammatory activation not only in response to lipopolysaccharide and other microbial molecules33 but also to (modified) endogenous molecules including heat-shock proteins, modified lipids, fibronectin, biglycan, and hyaluronan oligosaccharides, all abundantly present in the atherosclerotic lesion microenvironment.14,17–19

Amplified effector cytokine production has severe consequences for atherosclerotic plaque stability.34 TNF-{alpha} destabilizes plaque tissue integrity by promoting macrophage-induced vascular smooth muscle cell apoptosis.35 Likewise, MMP-9 damages tissue via extracellular matrix degradation.36 IL-12 aids recruitment of cytotoxic CD4 T cells into the atherosclerotic plaque.20 IL-23 is emerging as a new and powerful regulator of autoimmune inflammation by supporting the expansion of Th17 cells.37 Synergistic effects of IFN-{alpha} and lipopolysaccharide are probably not restricted to these effector cytokines but likely involve a whole battery of cytokines via the NF-{kappa}B pathway. Moreover, TLR4 signaling promotes foam cell formation by increasing cholesteryl ester and triglyceride levels in macrophages.38,39

These severe consequences for inducing full-blown immune activation via simultaneous triggering of TLR4 and TLR9 raise the question of which situation may elicit this threatening outcome. Recognition of at least 2 "danger signals" corresponds well with the assumption that not 1 pathogen but the total infectious burden is relevant for atherosclerotic lesion progression.40 A single infectious organism triggering both TLRs could be sufficient to induce amplified effector molecule production in the tissue lesion.8 Most likely, simultaneous triggering of different TLRs is caused by a combination of exogenous and endogenous stimuli available in the plaque. Viral infection inducing IFN-{alpha} production should be sufficient to intensify and sustain endogenous TLR4 triggering, transforming chronic low-grade inflammation in the atherosclerotic lesion14,19 into acute inflammatory activation with abundant effector molecule production, potentially leading to plaque rupture.

The effect of pDC-produced IFN-{alpha} on mDCs has been studied in detail in SLE patients.41 SLE patients produce increased amounts of type I IFN, leading to peripheral tolerance breakdown through forced mDC maturation.42 Unabated DC activation through IFN-{alpha} in SLE patients not only may trigger the underlying autoimmune process but also may cause their increased cardiovascular risk. Notably, enhanced TLR4 expression has been shown recently to be pathogenic for lupus-like autoimmune disease.43 Likewise, enhanced TLR4 expression has been suggested as a signaling mechanism for immune-mediated progression of atherosclerosis.12

Our data suggest (Figure 7) that viral infections trigger pDCs through TLR9 to secrete IFN-{alpha} in the atherosclerotic plaque. Furthermore, IFN-{alpha} enhances the expression of TLR4 on APCs with both pDC and mDC populations localized in close vicinity in the rupture-prone shoulder region. As a result, responses of these cell types to exogenous and endogenous TLR4 ligands are amplified. These sensitized APCs strongly upregulate the production of cytokines such as TNF-{alpha}, IL-12, IL-23, and MMP-9. At the same time, IFN-{alpha} directly modulates T-cell effector functions, rendering these cells effective killer cells that can mediate apoptosis of local cell populations, such as vascular smooth muscle cells. Multiple pathways, including TNF-{alpha}– and MMP-mediated tissue damage, pose a direct strain on plaque stability. This model predicts that host infections, particularly those being sensed by pDCs and even when colonizing distant tissues, represent an immediate risk for the inflamed atherosclerotic plaque.


Figure 7187021
View larger version (36K):
[in this window]
[in a new window]

 
Figure 7. Synergistic proinflammatory effects of TLR4 and TLR9 ligands in atherosclerotic plaque. LPS indicates lipopolysaccharide.


*    Acknowledgments
 
The authors thank Tamela Yeargin for outstanding editorial support.

Sources of Funding

This work was funded in part by grants from the National Institutes of Health (RO1 AI 44142, R01 EY 11916, R01 HL 63919, and RO1 AG 15443) and by a grant from Fonds zur Foerderung der wissenschaftlichen Forschung (J2336-B14).

Disclosures

None.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Libby P, Theroux P. Pathophysiology of coronary artery disease. Circulation. 2005; 111: 3481–3488.[Abstract/Free Full Text]

2. Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. N Engl J Med. 2005; 352: 1685–1695.[Free Full Text]

3. Bobryshev YV, Lord RS. Mapping of vascular dendritic cells in atherosclerotic arteries suggests their involvement in local immune-inflammatory reactions. Cardiovasc Res. 1998; 37: 799–810.[Abstract/Free Full Text]

4. Yilmaz A, Lochno M, Traeg F, Cicha I, Reiss C, Stumpf C, Raaz D, Anger T, Amann K, Probst T, Ludwig J, Daniel WG, Garlichs CD. Emergence of dendritic cells in rupture-prone regions of vulnerable carotid plaques. Atherosclerosis. 2004; 176: 101–110.[CrossRef][Medline] [Order article via Infotrieve]

5. Erbel C, Sato K, Meyer FB, Kopecky SL, Frye RL, Goronzy JJ, Weyand CM. Functional profile of activated dendritic cells in unstable atherosclerotic plaque. Basic Res Cardiol. 2007; 102: 123–132.[CrossRef][Medline] [Order article via Infotrieve]

6. Niessner A, Sato K, Chaikof EL, Colmegna I, Goronzy JJ, Weyand CM. Pathogen-sensing plasmacytoid dendritic cells stimulate cytotoxic T-cell function in the atherosclerotic plaque through interferon-alpha. Circulation. 2006; 114: 2482–2489.[Abstract/Free Full Text]

7. Pascual V, Banchereau J, Palucka AK. The central role of dendritic cells and interferon-alpha in SLE. Curr Opin Rheumatol. 2003; 15: 548–556.[CrossRef][Medline] [Order article via Infotrieve]

8. Decker T, Muller M, Stockinger S. The yin and yang of type I interferon activity in bacterial infection. Nat Rev Immunol. 2005; 5: 675–687.[CrossRef][Medline] [Order article via Infotrieve]

9. Kadowaki N, Ho S, Antonenko S, de Waal Malefyt R, Kastelein RA, Bazan F, Liu Y-J. Subsets of human dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens. J Exp Med. 2001; 194: 863–870.[Abstract/Free Full Text]

10. Sato K, Niessner A, Kopecky SL, Frye RL, Goronzy JJ, Weyand CM. TRAIL-expressing T cells induce apoptosis of vascular smooth muscle cells in the atherosclerotic plaque. J Exp Med. 2006; 203: 239–250.[Abstract/Free Full Text]

11. Clarke MC, Figg N, Maguire JJ, Davenport AP, Goddard M, Littlewood TD, Bennett MR. Apoptosis of vascular smooth muscle cells induces features of plaque vulnerability in atherosclerosis. Nat Med. 2006; 12: 1075–1080.[CrossRef][Medline] [Order article via Infotrieve]

12. Methe H, Kim JO, Kofler S, Weis M, Nabauer M, Koglin J. Expansion of circulating Toll-like receptor 4–positive monocytes in patients with acute coronary syndrome. Circulation. 2005; 111: 2654–2661.[Abstract/Free Full Text]

13. Edfeldt K, Swedenborg J, Hansson GK, Yan ZQ. Expression of Toll-like receptors in human atherosclerotic lesions: a possible pathway for plaque activation. Circulation. 2002; 105: 1158–1161.[Abstract/Free Full Text]

14. Xu XH, Shah PK, Faure E, Equils O, Thomas L, Fishbein MC, Luthringer D, Xu XP, Rajavashisth TB, Yano J, Kaul S, Arditi M. Toll-like receptor-4 is expressed by macrophages in murine and human lipid-rich atherosclerotic plaques and upregulated by oxidized LDL. Circulation. 2001; 104: 3103–3108.[Abstract/Free Full Text]

15. Michelsen KS, Wong MH, Shah PK, Zhang W, Yano J, Doherty TM, Akira S, Rajavashisth TB, Arditi M. Lack of Toll-like receptor 4 or myeloid differentiation factor 88 reduces atherosclerosis and alters plaque phenotype in mice deficient in apolipoprotein E. Proc Natl Acad Sci U S A. 2004; 101: 10679–10684.[Abstract/Free Full Text]

16. Kiechl S, Lorenz E, Reindl M, Wiedermann CJ, Oberhollenzer F, Bonora E, Willeit J, Schwartz DA. Toll-like receptor 4 polymorphisms and atherogenesis. N Engl J Med. 2002; 347: 185–192.[Abstract/Free Full Text]

17. Miller YI, Viriyakosol S, Worrall DS, Boullier A, Butler S, Witztum JL. Toll-like receptor 4-dependent and -independent cytokine secretion induced by minimally oxidized low-density lipoprotein in macrophages. Arterioscler Thromb Vasc Biol. 2005; 25: 1213–1219.[Abstract/Free Full Text]

18. Okamura Y, Watari M, Jerud ES, Young DW, Ishizaka ST, Rose J, Chow JC, Strauss JF III. The extra domain A of fibronectin activates Toll-like receptor 4. J Biol Chem. 2001; 276: 10229–10233.[Abstract/Free Full Text]

19. Xu Q. Role of heat shock proteins in atherosclerosis. Arterioscler Thromb Vasc Biol. 2002; 22: 1547–1559.[Abstract/Free Full Text]

20. Zhang X, Niessner A, Nakajima T, Ma-Krupa W, Kopecky SL, Frye RL, Goronzy JJ, Weyand CM. Interleukin 12 induces T-cell recruitment into the atherosclerotic plaque. Circ Res. 2006; 98: 524–531.[Abstract/Free Full Text]

21. Dalpke AH, Lehner MD, Hartung T, Heeg K. Differential effects of CpG-DNA in Toll-like receptor-2/-4/-9 tolerance and cross-tolerance. Immunology. 2005; 116: 203–212.[CrossRef][Medline] [Order article via Infotrieve]

22. Gautier G, Humbert M, Deauvieau F, Scuiller M, Hiscott J, Bates EE, Trinchieri G, Caux C, Garrone P. A type I interferon autocrine-paracrine loop is involved in Toll-like receptor-induced interleukin-12p70 secretion by dendritic cells. J Exp Med. 2005; 201: 1435–1446.[Abstract/Free Full Text]

23. Thompson JE, Cubbon RM, Cummings RT, Wicker LS, Frankshun R, Cunningham BR, Cameron PM, Meinke PT, Liverton N, Weng Y, DeMartino JA. Photochemical preparation of a pyridone containing tetracycle: a Jak protein kinase inhibitor. Bioorg Med Chem Lett. 2002; 12: 1219–1223.[CrossRef][Medline] [Order article via Infotrieve]

24. Tobe M, Isobe Y, Tomizawa H, Nagasaki T, Takahashi H, Fukazawa T, Hayashi H. Discovery of quinazolines as a novel structural class of potent inhibitors of NF-kappa B activation. Bioorg Med Chem. 2003; 11: 383–391.[CrossRef][Medline] [Order article via Infotrieve]

25. Nomura F, Akashi S, Sakao Y, Sato S, Kawai T, Matsumoto M, Nakanishi K, Kimoto M, Miyake K, Takeda K, Akira S. Cutting edge: endotoxin tolerance in mouse peritoneal macrophages correlates with down-regulation of surface toll-like receptor 4 expression. J Immunol. 2000; 164: 3476–3479.[Abstract/Free Full Text]

26. Mayr M, Kiechl S, Tsimikas S, Miller E, Sheldon J, Willeit J, Witztum JL, Xu Q. Oxidized low-density lipoprotein autoantibodies, chronic infections, and carotid atherosclerosis in a population-based study. J Am Coll Cardiol. 2006; 47: 2436–2443.[Abstract/Free Full Text]

27. Siren J, Pirhonen J, Julkunen I, Matikainen S. IFN-alpha regulates TLR-dependent gene expression of IFN-alpha, IFN-beta, IL-28, and IL-29. J Immunol. 2005; 174: 1932–1937.[Abstract/Free Full Text]

28. Abreu MT, Arnold ET, Thomas LS, Gonsky R, Zhou Y, Hu B, Arditi M. TLR4 and MD-2 expression is regulated by immune-mediated signals in human intestinal epithelial cells. J Biol Chem. 2002; 277: 20431–20437.[Abstract/Free Full Text]

29. Chiu B, Viira E, Tucker W, Fong IW. Chlamydia pneumoniae, cytomegalovirus, and herpes simplex virus in atherosclerosis of the carotid artery. Circulation. 1997; 96: 2144–2148.[Abstract/Free Full Text]

30. Hornung V, Schlender J, Guenthner-Biller M, Rothenfusser S, Endres S, Conzelmann KK, Hartmann G. Replication-dependent potent IFN-alpha induction in human plasmacytoid dendritic cells by a single-stranded RNA virus. J Immunol. 2004; 173: 5935–5943.[Abstract/Free Full Text]

31. Barrat FJ, Meeker T, Gregorio J, Chan JH, Uematsu S, Akira S, Chang B, Duramad O, Coffman RL. Nucleic acids of mammalian origin can act as endogenous ligands for Toll-like receptors and may promote systemic lupus erythematosus. J Exp Med. 2005; 202: 1131–1139.[Abstract/Free Full Text]

32. Marshak-Rothstein A, Busconi L, Rifkin IR, Viglianti GA. The stimulation of Toll-like receptors by nuclear antigens: a link between apoptosis and autoimmunity. Rheum Dis Clin North Am. 2004; 30: 559–574, ix.[CrossRef][Medline] [Order article via Infotrieve]

33. Lien E, Ingalls RR. Toll-like receptors. Crit Care Med. 2002; 30: S1–S11.[CrossRef][Medline] [Order article via Infotrieve]

34. Young JL, Libby P, Schonbeck U. Cytokines in the pathogenesis of atherosclerosis. Thromb Haemost. 2002; 88: 554–567.[Medline] [Order article via Infotrieve]

35. Boyle JJ, Weissberg PL, Bennett MR. Tumor necrosis factor-alpha promotes macrophage-induced vascular smooth muscle cell apoptosis by direct and autocrine mechanisms. Arterioscler Thromb Vasc Biol. 2003; 23: 1553–1558.[Abstract/Free Full Text]

36. Galis ZS, Khatri JJ. Matrix metalloproteinases in vascular remodeling and atherogenesis: the good, the bad, and the ugly. Circ Res. 2002; 90: 251–262.[Abstract/Free Full Text]

37. Kikly K, Liu L, Na S, Sedgwick JD. The IL-23/Th(17) axis: therapeutic targets for autoimmune inflammation. Curr Opin Immunol. 2006; 18: 670–675.[CrossRef][Medline] [Order article via Infotrieve]

38. Cao F, Castrillo A, Tontonoz P, Re F, Byrne GI. Chlamydia pneumoniae–induced macrophage foam cell formation is mediated by Toll-like receptor 2. Infect Immun. 2007; 75: 753–759.[Abstract/Free Full Text]

39. Kazemi MR, McDonald CM, Shigenaga JK, Grunfeld C, Feingold KR. Adipocyte fatty acid-binding protein expression and lipid accumulation are increased during activation of murine macrophages by Toll-like receptor agonists. Arterioscler Thromb Vasc Biol. 2005; 25: 1220–1224.[Abstract/Free Full Text]

40. Shah PK, Falk E, Badimon JJ, Fernandez-Ortiz A, Mailhac A, Villareal-Levy G, Fallon JT, Regnstrom J, Fuster V. Human monocyte-derived macrophages induce collagen breakdown in fibrous caps of atherosclerotic plaques: potential role of matrix-degrading metalloproteinases and implications for plaque rupture. Circulation. 1995; 92: 1565–1569.[Medline] [Order article via Infotrieve]

41. Bennett L, Palucka AK, Arce E, Cantrell V, Borvak J, Banchereau J, Pascual V. Interferon and granulopoiesis signatures in systemic lupus erythematosus blood. J Exp Med. 2003; 197: 711–723.[Abstract/Free Full Text]

42. Banchereau J, Pascual V. Type I interferon in systemic lupus erythematosus and other autoimmune diseases. Immunity. 2006; 25: 383–392.[CrossRef][Medline] [Order article via Infotrieve]

43. Liu B, Yang Y, Dai J, Medzhitov R, Freudenberg MA, Zhang PL, Li Z. TLR4 up-regulation at protein or gene level is pathogenic for lupus-like autoimmune disease. J Immunol. 2006; 177: 6880–6888.[Abstract/Free Full Text]


 

CLINICAL PERSPECTIVE

Vulnerable atherosclerotic plaque is characterized by an infiltrate of immunoinflammatory cells, including T cells, macrophages, and dendritic cells (DCs) that have been implicated in mediating tissue damage, weakening the plaque’s scaffold, and eventually causing plaque rupture. Uncertainty remains on how plaque-residing immune cells are activated, how they communicate, and how their tissue-destructive potential is regulated. The present study has explored how pathogen-derived signals affect the function of DCs and modulate downstream plaque inflammation. DCs are sentinels that sense danger, in particular infections, with plasmacytoid and myeloid DCs each specialized in recognizing unique profiles of viral and bacterial products. The study demonstrates that plasmacytoid DCs in carotid atheroma respond vividly to a mimic of microbial DNA by producing the powerful proinflammatory cytokine interferon-{alpha}. Interferon-{alpha} then modulates the response threshold of myeloid DCs by sensitizing them to lipopolysaccharide, a bacterial wall product binding to Toll-like receptor 4. Amplified lipopolysaccharide responsiveness leads to massive production of tumor necrosis factor-{alpha}, interleukin-12, interleukin-23, and matrix metalloproteinase-9. In essence, the antiviral cytokine interferon-{alpha} functions as an inflammatory amplifier within the plaque microenvironment. Although the principle of cross-regulation between different DC subtypes protects the host by ensuring augmentation of anti-infectious immune responses, it creates immediate risk of unintended collateral damage in the atherosclerotic lesion because any type of viral infection, occurring either in the plaque or in a distant tissue site, intensifies tissue-injurious immune responses.


*    Footnotes
 
The online-only Data Supplement, consisting of a figure, is available with this article at http://circ.ahajournals.org/cgi/content/full/ CIRCULATIONAHA.107.697789/DC1.




This article has been cited by other articles:


Home page
haematolHome page
F. Angelot, E. Seilles, S. Biichle, Y. Berda, B. Gaugler, J. Plumas, L. Chaperot, F. Dignat-George, P. Tiberghien, P. Saas, et al.
Endothelial cell-derived microparticles induce plasmacytoid dendritic cell maturation: potential implications in inflammatory diseases
Haematologica, November 1, 2009; 94(11): 1502 - 1512.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
P. Y. Lee, Y. Li, Y. Kumagai, Y. Xu, J. S. Weinstein, E. S. Kellner, D. C. Nacionales, E. J. Butfiloski, N. van Rooijen, S. Akira, et al.
Type I Interferon Modulates Monocyte Recruitment and Maturation in Chronic Inflammation
Am. J. Pathol., November 1, 2009; 175(5): 2023 - 2033.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. J. Schulte, A. Yilmaz, K. Shimada, M. C. Fishbein, E. L. Lowe, S. Chen, M. Wong, T. M. Doherty, T. Lehman, T. R. Crother, et al.
Involvement of Innate and Adaptive Immunity in a Murine Model of Coronary Arteritis Mimicking Kawasaki Disease
J. Immunol., October 15, 2009; 183(8): 5311 - 5318.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
C A Wijbrandts, S I van Leuven, H D Boom, D M Gerlag, E G S Stroes, J J P Kastelein, and P P Tak
Sustained changes in lipid profile and macrophage migration inhibitory factor levels after anti-tumour necrosis factor therapy in rheumatoid arthritis
Ann Rheum Dis, August 1, 2009; 68(8): 1316 - 1321.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
A. Niessner, P. J. Hohensinner, K. Rychli, S. Neuhold, G. Zorn, B. Richter, M. Hulsmann, R. Berger, D. Mortl, K. Huber, et al.
Prognostic value of apoptosis markers in advanced heart failure patients
Eur. Heart J., April 1, 2009; 30(7): 789 - 796.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
O. Pryshchep, W. Ma-Krupa, B. R. Younge, J. J. Goronzy, and C. M. Weyand
Vessel-Specific Toll-Like Receptor Profiles in Human Medium and Large Arteries
Circulation, September 16, 2008; 118(12): 1276 - 1284.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Kuchibhotla, D. Vanegas, D. J. Kennedy, E. Guy, G. Nimako, R. E. Morton, and M. Febbraio
Absence of CD36 protects against atherosclerosis in ApoE knock-out mice with no additional protection provided by absence of scavenger receptor A I/II
Cardiovasc Res, April 1, 2008; 78(1): 185 - 196.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. W. Han, K. Shimada, W. Ma-Krupa, T. L. Johnson, R. M. Nerem, J. J. Goronzy, and C. M. Weyand
Vessel Wall-Embedded Dendritic Cells Induce T-Cell Autoreactivity and Initiate Vascular Inflammation
Circ. Res., March 14, 2008; 102(5): 546 - 553.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
116/18/2043    most recent
CIRCULATIONAHA.107.697789v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Niessner, A.
Right arrow Articles by Weyand, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Niessner, A.
Right arrow Articles by Weyand, C. M.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Related Collections
Right arrow Pathophysiology
Right arrow Cell biology/structural biology
Right arrow Growth factors/cytokines
Right arrow Acute coronary syndromes