Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2006;114:936-944
Published online before print August 14, 2006, doi: 10.1161/CIRCULATIONAHA.105.607903
CLINICAL PERSPECTIVE
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
114/9/936    most recent
CIRCULATIONAHA.105.607903v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nishii, M.
Right arrow Articles by Izumi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nishii, M.
Right arrow Articles by Izumi, T.
Related Collections
Right arrow Other heart failure
Right arrow Animal models of human disease

(Circulation. 2006;114:936-944.)
© 2006 American Heart Association, Inc.


Molecular Cardiology

ß2-Adrenergic Agonists Suppress Rat Autoimmune Myocarditis

Potential Role of ß2-Adrenergic Stimulants as New Therapeutic Agents for Myocarditis

Mototsugu Nishii, PhD, MD; Takayuki Inomata, MD, PhD; Hiroe Niwano, MD, PhD; Hitoshi Takehana, MD, PhD; Ichiro Takeuchi, MD, PhD; Hironari Nakano, MD, PhD; Hisahito Shinagawa, MD; Takashi Naruke, MD; Toshimi Koitabashi, MD, PhD; Jun-ichi Nakahata, MD; Tohru Izumi, MD, PhD

From the Department of Internal Medicine and Cardiology, Kitasato University School of Medicine, Sagamihara, Japan.

Correspondence to Dr Mototsugu Nishii, Department of Internal Medicine and Cardiology, Kitasato University School of Medicine, 1-15-1 Kitasato, Sagamihara, 228-8555 Japan. E-mail mototsugu{at}smz.ja-shizuoka.or.jp

Received December 14, 2005; revision received May 26, 2006; accepted June 22, 2006.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowConclusions
down arrowReferences
 
Background— The therapeutic potential of ß2-adrenergic receptor (AR) agonists in the treatment of autoimmune diseases has been reported. However, the role of these drugs in the myocardial structure–induced autoimmune process, which is thought to play a crucial role in the progression of myocarditis to subsequent complications, has not been elucidated.

Methods and Results— Experimental autoimmune myocarditis (EAM) was induced in rats by immunization with cardiac myosin. On daily administration from day 0 after immunization, the ß2-selective AR agonists formoterol or salbutamol ameliorated EAM on day 21 and increased myocardial interleukin-10/interferon-{gamma} mRNA levels. Propranolol, a nonselective ß-AR antagonist, aggravated EAM on day 21 and decreased mRNA levels, whereas metoprolol, a ß1-selective AR antagonist, showed no effect. These results were reflected in vivo by the proliferation of cardiac myosin–primed lymph node cells from drug-treated rats. In vitro addition of ß2-selective AR agonists inhibited the activation of cardiac myosin fragment–specific myocarditogenic T lymphocytes, and this effect was reversed by ICI118,551, a ß2-selective AR antagonist. Furthermore, treatment with 2 different ß2-selective AR agonists starting on day 14 also ameliorated EAM on day 21.

Conclusions— ß2-AR stimulation suppressed the development of EAM by inhibiting cardiac myosin–specific T-lymphocyte activation in lymphoid organs and by shifting the imbalance in Th1/Th2 cytokine toward Th2 cytokine. Furthermore, it also ameliorated established myocardial inflammation. ß2-AR–stimulating agents may represent important immunomodulators of the cardiac myosin–induced autoimmune process and have potential as a new therapy for myocarditis.


Key Words: immune system • myocarditis • receptors, adrenergic, beta


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowConclusions
down arrowReferences
 
Apart from those with fulminant cases requiring mechanical circulatory support for severely deteriorated circulatory collapse, most patients with acute myocarditis recover rapidly to an uncomplicated status, with cessation of myocardial inflammation and a generally favorable outcome.1 Some patients, however, progress to persistent myocardial inflammation and subsequent dilated cardiomyopathy.2,3 Although chronic viral infection has long been recognized as a candidate causative factor for these pathophysiological mechanisms,3 a number of experimental models have demonstrated the crucial role4,5 of myocardial structure–mediated autoimmune processes, which follow the myocardial damage provoked by the initial viral infection.6,7 The presence of autoantibodies against myocardial structure in patients with myocarditis and dilated cardiomyopathy8,9 supports the involvement of myocardial structure–mediated autoimmune processes in these settings in humans.

Clinical Perspective p 944

Investigations using rat experimental autoimmune myocarditis (EAM) have shown that Th1 cytokines such as interferon-{gamma} (IFN-{gamma}) and interleukin-12 (IL-12) are major promoters of these autoimmune processes.10,11 On the other hand, given reports that ß2-adrenergic receptors (ß2-ARs) are present on Th1 T lymphocytes and antigen-presenting cells and that their activation suppresses the production of Th1 cytokines such as IFN-{gamma} and IL-12,12,13 ß2-AR has been investigated as a potential immunomodulator in Th1 cytokine–induced autoimmune disease.14 However, the role of ß2-AR–stimulating agents on myocardial structure–mediated autoimmune processes remains unknown. In this study we compared the effects of ß-AR agents on EAM.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowConclusions
down arrowReferences
 
In Vivo Experiments
Induction of Rat Autoimmune Myocarditis
EAM was induced by immunizing 5-week-old female Lewis rats (Charles River Laboratory, Tsukuba, Ibaraki, Japan) with 0.25 mg of porcine cardiac myosin conjugated with complete Freund’s adjuvant containing 0.25 mg of Mycobacterium tuberculosis H73RA (Difco, Detroit, Mich), as previously reported.15 All experimental procedures and protocols used in this study conformed to the institutional guidelines of Kitasato University School of Medicine for the care and use of animals.

Therapeutic Protocols
Protocol I
Groups of 18 healthy animals each received intraperitoneal administration of propranolol (Sigma, St Louis, Mo) at 10 mg/kg per day as a nonselective ß-AR antagonist, metoprolol at 30 mg/kg per day as a ß1-selective AR antagonist (Novartis Pharmaceutical Co, Tokyo, Japan), formoterol at 22.5 µg/kg per day as a ß2-selective AR agonist16 (Yamanouchi Pharmaceutical Co, Tokyo, Japan), salbutamol at 200 µg/kg per day as a ß2-selective AR agonist13,14 (Sigma Chemical Co, St Louis, Mo), or an equal volume of phosphate-buffered saline vehicle containing 0.5% methylcellulose daily from immunization with myosin, on day 0 until euthanasia on day 21. These drugs were also administered to control groups of 8 healthy animals each without immunization with myosin for 3 weeks. Doses were selected on the basis of previous findings17 to ensure a near-equipotent ß1-AR blocking effect.

Protocol II
Groups of 12 healthy animals each were given formoterol at 22.5 µg/kg per day, salbutamol at 200 µg/kg per day, or an equal volume of vehicle by intraperitoneal administration from day 14 until day 21 after immunization with myosin.

Hemodynamic Analysis
Blood pressure (BP), heart rate (HR), and fractional shortening were determined in healthy (without myosin immunization) and diseased rats (with immunization) treated with ß-AR–modulating agents or vehicle by the tail-cuff method with the use of a photoelectric tail-cuff detection system (Softron, Tokyo, Japan) and echocardiographic study (SSD-6500SV, Aloka, Tokyo, Japan) just before euthanasia on day 21. All measurements were averaged over at least 3 consecutive cardiac cycles.

Assessment of Severity of Myocarditis
All rats were killed under ether anesthesia on day 21. The ratio of heart weight to body weight (HW/BW) was calculated, and macroscopic scores were classified according to a 5-grade scoring system as previously reported.18 The cardiac ventricles were then divided transversely into 2 sections. The ratio of the area of inflammatory infiltrates to that of the whole myocardium on a sliced half-transverse section was calculated with a microscope, as previously reported,18 by 2 blinded observers. Interobserver and intraobserver variance was <5%.

Measurement of Cytokine Expression in Hearts
Real-time reverse transcription–polymerase chain reaction (RT-PCR) was performed to measure myocardial expression of IFN-{gamma} or interleukin-10 (IL-10) mRNA in the other half of the hearts. Reverse transcriptase–polymerase chain reaction (RT-PCR) was performed with the use of an ABI PRISM 7700 Sequence Detection System (PE Biosystems). Positive-stranded and negative-stranded primers for mRNA amplification were ATCTGGAGGAACTGGCAAAAGGACG and CCTTAGGCTAGATTCTGGTGACAGC for IFN-{gamma},19 ACTGCTCTGTTGCCTGCTCTTACT and GAATTCAAATGCTCCTTGATTTCT for IL-10,19 and ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA for glyceraldehyde phosphate dehydrogenase.19 A standard curve was calculated with the use of the ABI PRISM 7700 System, from which the absolute copy numbers of mRNA in the samples were obtained.

In Vitro Experiments
ß-AR–Modulating Agents on Myocarditogenic T-Lymphocyte Activities
A myocardiogenic CD4-positive Th1-phenotype T-lymphocyte line specific for the cardiac myosin fragment CM2 (a.a. 1539–1555)20 was established as previously reported.18 This T-lymphocyte line (5x104 per well) was cultured in triplicate supplemented with CM2 (10 µg/mL) and irradiated (5000 rad) syngeneic thymocytes as antigen-presenting cells (1x106 per well). Formoterol (10–10 to 10–4 mol/L), salbutamol (10–10 to 10–4 mol/L), or denopamine (10–10 to 10–4 mol/L; Tanabe Pharmaceutical Co, Tokyo, Japan) as a ß1-selective AR agonist or vehicle was added to the cell-suspension culture solution, with or without ICI118,551 (10–8 to 10–6 mol/L; Tocris, Ellisville, Mo) as a ß2-selective AR antagonist. After incubation, proliferation of cardiac myosin–specific T lymphocytes and levels of IFN-{gamma} and IL-12 in each well were determined as previously described.18 Three series of experiments were performed for each investigation.

Proliferation Assay Using Myosin-Primed Lymph Node Cells From Treated Rats
Popliteal lymph nodes were removed from Lewis rats killed 11 days after immunization with porcine cardiac myosin under daily administration of metoprolol at 30 mg/kg per day, propranolol at 10 mg/kg per day, formoterol at 22.5 µg/kg per day, salbutamol at 200 µg/kg per day, or vehicle (n=9 each). Viable mononuclear cells (5x104 per well) from the lymph nodes in single-cell suspension were cultured for 48 hours in triplicate with or without 10 µg/mL of cardiac myosin. Cell proliferation and levels of IFN-{gamma} and IL-12 in each well were then determined as described previously.18

Intracellular cAMP Measurement
Myosin-primed lymph node cells (5x104 per well) from drug-treated rats (n=9 each) were cultured in triplicate with cardiac myosin as described above. Cells were pelleted by centrifugation at 1400g for 5 minutes followed by the addition of lysis buffer for 10 minutes. Intracellular cAMP levels were then measured with an enzyme-linked immunosorbent assay (ELISA) kit (Amersham, Piscataway, NJ).

Statistical Analysis
Data are expressed as mean±SEM. Statistical analyses were performed by 1-way ANOVA, followed by a post hoc test (Bonferroni multiple comparison test). RT-PCR analysis was performed as follows. The copy number of IFN-{gamma} or IL-10 mRNA was normalized for GAPDH mRNA, and the myocardial expression of cytokine in each sample from EAM rats that received treatment with the ß-AR agent or vehicle was then expressed as fold increase over the average level in the control group, composed of 9 EAM rats, on day 21 with no treatment. The balance of Th1 and Th2 cytokines was expressed as the ratio of IL-10 mRNA to IFN-{gamma} mRNA: IL-10/IFN-{gamma}. IL-10/IFN-{gamma} level in each sample with therapy was also expressed as fold increase over that of the control group. Levels of IFN-{gamma}, IL-10, or IL-10/IFN-{gamma}, as well as histological and hemodynamic variables in the vehicle and control groups, were approximately equal (data not shown). To examine the effects of ß-AR agents on the expression of cytokine, fold increase was compared across therapeutic groups. Probability values <0.05 were considered statistically significant.

The authors had full access to the data and take full responsibility for its integrity. All authors have read and agree to the manuscript as written.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowConclusions
down arrowReferences
 
Hemodynamics in Healthy Rats Treated With ß-AR Agents
HR and BP were significantly decreased in the rats of the 2 ß-AR antagonist groups compared with the vehicle group, with no significant difference between them. In contrast, no change in hemodynamic variables was seen in the formoterol or salbutamol groups (Table 1).


View this table:
[in this window]
[in a new window]

 
TABLE 1. Hemodynamic Variables in Healthy Rats Treated With ß-AR Agents

Administration of ß-AR Agents Starting on Day 0
Mortality
Four diseased rats treated with vehicle or metoprolol (mortality: 4/18, 22%) died between days 19 and 21, and 8 diseased rats treated with propranolol (8/18, 44%) died between days 15 and 21. However, all diseased rats treated with the ß2-AR agonists (0/18, 0%) survived until day 21.

Hemodynamics
Compared with the vehicle group, BP, HR, and fractional shortening were significantly decreased in the ß-AR antagonist groups, whereas fractional shortening and BP were significantly increased with a decrease of HR in the ß2-AR agonist groups. No significant differences in hemodynamic variables were seen between the ß-AR antagonist groups (Table 2).


View this table:
[in this window]
[in a new window]

 
TABLE 2. Histological and Hemodynamic Variables and Cytokine Profiles in EAM Rats Treated From Day 0

Severity of Disease
Macroscopic score, HW/BW, and area of cellular infiltration into the myocardium were significantly reduced in the 2 ß2-AR agonist groups, indicating a significantly reduced severity of disease. In contrast, the propranolol but not the metoprolol group showed a significantly increased severity of disease compared with the vehicle group (Figure 1, Table 2).


Figure 1177440
View larger version (107K):
[in this window]
[in a new window]

 
Figure 1. Histological findings in EAM hearts on day 21 of in vivo administration of ß-AR agents. Administration of propranolol at 10 mg/kg (A) facilitated interstitial cellular infiltration compared with that of metoprolol at 30 mg/kg (B) or vehicle (C). Conversely, administration of either formoterol at 22.5 µg/kg (D) or salbutamol at 200 µg/kg ameliorated interstitial cellular infiltration (E). Bars=1 mm or 250 µm (thick, for x1; thin, for x40, respectively).

Cytokine Profiles
Compared with the vehicle group, levels of IFN-{gamma} and IL-10 mRNA in the myocardium were significantly increased in the propranolol but not in the metoprolol group. In contrast, levels were decreased in both the formoterol and salbutamol groups. However, IL-10/IFN-{gamma} was significantly decreased in the propranolol group but increased in the 2 ß2-AR agonist groups compared with the vehicle group (Table 2).

Administration of ß2-AR Agonist From Day 14 After Immunization
Mortality
Three diseased rats treated with the vehicle (mortality: 3/12, 25%) died between days 19 and 21, whereas all diseased rats treated with the ß2-AR agonists (0/12, 0%) survived until day 21.

Hemodynamics
Among hemodynamic variables, significant increases in fractional shortening and systolic blood pressure were seen, with a significant decrease in heart rate in the formoterol and salbutamol groups compared with the vehicle group (Table 3).


View this table:
[in this window]
[in a new window]

 
TABLE 3. Histological and Hemodynamic Variables and Cytokine Profiles in EAM Rats Treated From Day 14

Severity of Disease
Disease severity as indicated by macroscopic score, HW/BW, and area of cellular infiltration into the myocardium was significantly decreased in the formoterol and salbutamol groups compared with the vehicle group (Table 3). These macroscopic findings were reflected in microscopic findings, which included interstitial cellular infiltration and destruction of myocardial fibers (Figure 2).


Figure 2177440
View larger version (62K):
[in this window]
[in a new window]

 
Figure 2. Microscopic findings in EAM rats treated with formoterol at 22.5 µg/kg, salbutamol at 200 µg/kg, or vehicle from days 14 to 21. ß2-AR agonists reduced interstitial cellular infiltration and destruction of myocardial fibers compared with the vehicle. Bars=250 µm (thin, for x100).

Cytokine Profiles
Compared with levels in the vehicle group, myocardial mRNA levels of IFN-{gamma} and IL-10 were significantly decreased in both the formoterol group and salbutamol group. In contrast, myocardial IL-10/IFN-{gamma} mRNA levels were significantly increased in the ß2-AR agonist groups compared with the vehicle group (Table 3).

Myocardiogenic T Lymphocytes and ß-AR Stimulation
Formoterol as well as salbutamol strongly and dose-dependently suppressed cardiac myosin–specific T-lymphocyte proliferation and IL-12 production by antigen-presenting cells and IFN-{gamma} production by T lymphocytes, whereas denopamine only slightly suppressed cardiac myosin–specific T-lymphocyte activity (Figure 3). ICI118,551 reversed these inhibitory effects of formoterol or salbutamol (Figure 4).


Figure 3177440
View larger version (33K):
[in this window]
[in a new window]

 
Figure 3. Effects of ß-AR agonists on myocarditogenic T lymphocytes stimulated by specific antigen and antigen-presenting cells. Cell proliferation (A) and production of IL-12 (B) and IFN-{gamma} (C) in the culture supernatant were determined by 3H-thymidine uptake and an ELISA kit. Three series of experiments were performed for each investigation. Error bars represent SEM. ß-AR agonists decreased cell proliferation and production of IL-12 and IFN-{gamma} (*P<0.00001 vs culture with vehicle only), and inhibitory effects by formoterol and salbutamol were very much stronger compared with denopamine in each concentration (P<0.0001).


Figure 4177440
View larger version (45K):
[in this window]
[in a new window]

 
Figure 4. ICI118,551 reversed the inhibitory effect of ß2-AR stimulation on the production of Th1-cytokines. Levels of IL-12 and IFN-{gamma} in the culture supernatant were determined by an ELISA kit. Three series of experiments were performed for each investigation. Error bars represent SEM. *P<0.00001 vs culture with the vehicle only; #P<0.00001 vs each concentration of formoterol without ICI118,551.

Influence of In Vivo Administration of ß-AR Agents on Lymph Node Cell Activity
The proliferation of cardiac myosin–primed lymph node cells from treated EAM rats and their production of IL-12 and IFN-{gamma} were significantly decreased in both the formoterol group (6399±297 cpm, 76±4.9 pg/mL, 3480±145 pg/mL, respectively; each P<0.00001 versus the vehicle group) and the salbutamol group (6140±295 cpm, 61±4.5 pg/mL, 3012±189 pg/mL, respectively; each P<0.00001 versus the vehicle group) compared with the vehicle group (13283±309 cpm, 173±12 pg/mL, 12913±429 pg/mL, respectively). Conversely, cell proliferation and cytokine production were significantly increased in the propranolol group (28233±527 cpm, 402±24 pg/mL, 44022±1408 pg/mL, respectively; each P<0.00001 versus the vehicle group) but not in the metoprolol group (12388±253 cpm, P=0.08; 157±13 pg/mL, P=0.96; 13939±392 pg/mL, P=0.58; respectively) (Figure 5). Cell proliferation and cytokine expression were not observed in any culture without cardiac myosin (300±14 cpm).


Figure 5177440
View larger version (32K):
[in this window]
[in a new window]

 
Figure 5. The proliferation of T lymphocytes and levels of IL-12, IFN-{gamma}, and intracellular cAMP in cardiac myosin–primed lymph nodes from EAM rats treated with ß-AR agent or vehicle. Cell proliferation, levels of Th1-cytokines, and levels of intracellular cAMP were determined by measuring radioactivity of incorporated 3H-thymidine and an ELISA kit. Each group contained 9 rats. Closed circle indicates individual data; open circle and error bar, mean±SEM for each group. No significant difference was shown in comparisons of metoprolol and vehicle groups.

Administration of formoterol and salbutamol increased intracellular cAMP levels in myosin-primed lymph node cells compared with vehicle (188±12, 179±9, versus 39±2 fmol, respectively; each P<0.00001), whereas that of propranolol decreased cAMP levels (11±0.8 fmol; P=0.00007 versus the vehicle group). Administration of metoprolol did not affect intracellular cAMP level (36±1 fmol; P=2.39 versus the vehicle group) (Figure 5).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowConclusions
down arrowReferences
 
The role of ß-adrenergic stimulation on myocarditis has been investigated. It has been shown that the ß1-AR agonist denopamine prolongs survival in mice with viral myocarditis.21 However, other recent reports demonstrated that metoprolol, a ß1-selective AR antagonist, did not affect disease severity and mortality in rats with autoimmune myocarditis22 and mice with viral myocarditis,23 suggesting that ß1-AR has only a weak modulatory effect on the development of myocarditis. Thus, the protective effect of denopamine on myocarditis may result from an improvement in hemodynamic deterioration via its positive inotropic effect rather than from any other effect. On the other hand, these reports also indicated the immunomodulatory potential on myocarditis of carvedilol, which has ß-AR–blocking and antioxidative effects,22,23 and indicated that this effect was explained mainly by its antioxidative effect. However, the role of ß2-AR stimulation on myocarditis remains uncertain.

Wide use of ß2-selective AR–stimulating agents such as formoterol and salbutamol has been restricted to bronchodilation in patients with asthma. Recently, however, interest in these agents was renewed for their potential immunomodulatory role in Th1 cytokine–induced autoimmune disease. Catecholamines and several adrenergic agonists have been shown to influence the production of Th1 cytokines, and ß2-AR is involved in this mechanism.12,13 Furthermore, intraperitoneal administration of salbutamol, a ß2-selective AR agonist, suppressed Th1 cytokine–induced autoimmune arthritis via ß2-AR in vivo.14 In the present study, the 2 ß2-selective AR agonists formoterol and salbutamol did not affect hemodynamics in healthy rats (Table 1) but ameliorated Th1 cytokine–induced EAM10,11 on day 21 (Table 2) and reduced mortality. Furthermore, treatment with propranolol but not metoprolol exacerbated EAM on day 21 and increased mortality, despite showing equivalent hemodynamic effects (Table 2). The different effect of the 2 ß-blockers according to ß-AR selectivity supports the existence of an immunomodulatory role of ß2-AR in the development of EAM. Together, the present results indicate that ß2-AR–stimulating agents can ameliorate the development of EAM via ß2-AR.

In myocarditis, the autoimmune process leads to myocardial inflammation and injury via the effect of activated Th1 T lymphocytes specific for cardiac myosin.10,24 Th1 cytokines such as IL-12 and IFN-{gamma} promote this process.10 It has been demonstrated that ß2-AR stimulation inhibits the production of IFN-{gamma} and IL-12 in vitro.12,13 Furthermore, inhibition of antigen-specific T-cell proliferation was reported to be a therapeutic strategy for retarding the development of myocarditis.25 The protective effect on EAM of the 2 ß2-selective AR agonists seen here can therefore be explained by the idea that ß2-AR stimulation attenuates cardiac myosin–specific Th1 T-lymphocyte proliferation by suppressing the production of Th1 cytokines. However, the suppressive effect of ß2-AR stimulation on cardiac myosin–specific Th1 T-lymphocyte activity has not been elucidated.

To clarify this point, we used in vitro experimental systems using the immunodominant myosin peptide–specific CD4-positive Th1 T-lymphocyte line, the transfer of which induces EAM,18 and ex vivo experimental systems using cardiac myosin–primed lymph nodes from ß-AR agent–treated rats. The myocarditogenic Th1 T-lymphocyte line was stimulated with antigen-presenting cells and the specific antigen to emulate the priming step of EAM in vivo. Both formoterol and salbutamol reduced cardiac myosin–specific T-lymphocyte proliferation by suppressing the production of IL-12 and IFN-{gamma} (Figure 3). ICI118,551, a ß2-selective AR antagonist, but not metoprolol (data not shown), completely reversed the inhibitory effects of formoterol and salbutamol (Figure 4). Along with the difference in myosin-primed lymph node cell proliferation among formoterol-treated, salbutamol-treated, propranolol-treated, metoprolol-treated, and vehicle-treated rats (Figure 5), these results suggested that ß2-AR–stimulating agents ameliorated the induction of EAM by attenuating cardiac myosin–specific Th1 T-lymphocyte proliferation in the lymphoid organs associated with the suppression of Th1 cytokines via ß2-AR stimulation. Previous reports have demonstrated that ß2-AR is present on Th1 T lymphocytes and antigen-presenting cells and that its activation inhibits their production of Th1 cytokines by increasing intracellular cAMP levels.12,13 In our ex vivo experiment, ß2-AR stimulation inhibited myosin-primed lymph node cell activity adversely, in parallel with increasing intracellular cAMP levels (Figure 5). Thus, the inhibitory effect of ß2-AR stimulation on Th1 T lymphocytes specific for the cardiac myosin–mediated immune response identified here may have contributed to the activation of the ß2-AR–cAMP signaling pathway on Th1 T lymphocytes and antigen-presenting cells.

An imbalance in Th1 and Th2 cytokines modulates the pathogenesis of EAM,11 and the Th2 cytokine IL-10 plays a protective role in the development of EAM.26 Previous reports showed that shifting the immune response toward the Th2 pattern prevented the development of EAM.10,27 Thus, we examined the production of the Th1 cytokine IFN-{gamma} and Th2 cytokine IL-10 in the heart. Administration of either formoterol or salbutamol, but not of propranolol, starting on day 0 reduced myocardial IFN-{gamma} expression on day 21 compared with the vehicle group. The influences of drugs on myocardial IL-10 expression showed a similar pattern, although to a lesser degree, which is in part associated with the interaction of IL-10 and IFN-{gamma} during the course of their production. However, myocardial IL-10/IFN-{gamma} mRNA expression was significantly increased in the 2 ß2-AR agonist groups, whereas it was significantly decreased in the propranolol group (Table 2). This finding suggests that ß2-AR stimulation shifts the myocardial Th1/Th2 cytokine balance toward Th2 cytokines and that this effect in part contributes to modulating the development of EAM by ß2-AR–stimulating agents.

Not only extremely suppressed myocardial IFN-{gamma} expression by ß2-AR stimulation but also in part enhanced IL-10 expression by it may contribute to alteration of the myocardial Th1/Th2 cytokine balance in vivo. Myocardial inflammation in EAM mainly involves macrophages and CD4-positive Th1 T lymphocytes, and the dominance of these cells is a constant finding at lesion sites and throughout the course of the disease.28 The enhancement of IL-10 production in inflammatory cells such as monocytes, macrophages, and dendritic cells via ß2-AR stimulation has been reported.29,30

Propranolol enhanced disease severity in the present study. However, recent studies in the BALB/c mouse model of viral myocarditis found that propranolol exerts a protective effect against myocarditis.31 This difference may be explained in part by the promotion of a Th1 response in this infectious model, which clears the virus.23,31

In the present study, our intervention with ß2-AR–stimulating agents was done in a later phase of EAM to examine their effect on established myocardial inflammation. Formoterol and salbutamol significantly reduced the severity and mortality of myocarditis (Table 3) and significantly increased myocardial IL-10/IFN-{gamma} mRNA levels on day 21 compared with the vehicle (Table 3). ß2-AR–stimulating agents also ameliorated established myocardial inflammation, and this beneficial effect was in part associated with an alteration in the myocardial Th1/Th2 cytokine balance. Given that human myocarditis is usually diagnosed after disease onset, this result has important implications for clinical treatment.

Chronic ß-AR stimulation in heart failure induces myocardial apoptosis and thereby induces progressive myocardial remodeling.32 However, recent reports have demonstrated opposing effects of ß1- and ß2-AR stimulation on cardiac myocytes. In rat cardiomyocytes, ß1-AR stimulation induces apoptosis via a cAMP-dependent mechanism, whereas ß2-AR stimulation inhibits this process.33 A transgenic mice model overexpressing ß1-AR developed dilated cardiomyopathy along with hemodynamic deterioration, whereas those overexpressing ß2-AR did not.34,35 In the present study, treatment with ß2-AR agonists at doses that did not affect hemodynamic variables in healthy rats (Table 1) throughout the acute phase at least improved cardiac contractility in EAM rats (Table 2), and decreasing HR compared with the vehicle group (Table 2) may reflect an improvement of cardiac function. The new immunomodulatory effect of ß2-AR stimulation identified here also contributed to this effect. ß2-AR–stimulating agents thus may represent the preferred therapy for inflammatory myocardial conditions with hemodynamic deterioration derived from autoimmune processes.


*    Conclusions
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*Conclusions
down arrowReferences
 
To our knowledge, this study is the first to report that ß2-AR–stimulating agents ameliorate the development of EAM by reducing cardiac myosin–specific T-cell activity in the lymphoid organs, which plays an important role in the initiation of myocarditis, and by altering the imbalance between Th1 and Th2 cytokines. These agents also ameliorate established myocardial inflammation. These findings indicate that ß2-AR stimulation is a major immunomodulatory factor in the development of EAM. The potential of ß2-AR–stimulating agents as new therapeutic drugs for the treatment of myocarditis requires further investigation.


*    Acknowledgments
 
We thank Toshie Hashizume and Chiaki Notoya for their outstanding technical assistance.

Sources of Funding

This study was supported by a grant-in-aid for scientific research from the Postgraduate Research Project at Kitasato University and a grant for scientific research from the Ministry of Education, Science, and Culture of Japan (No. 20311954).

Disclosures

None.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
up arrowConclusions
*References
 

  1. Nishii M, Inomata T, Takehana H, Takeuchi I, Nakano H, Koitabashi T, Nakahata J, Aoyama N, Izumi T. Serum levels of interleukin-10 on admission as a prognostic predictor of human fulminant myocarditis. J Am Coll Cardiol. 2004; 44: 1292–1297.[Abstract/Free Full Text]
  2. Hühl U, Noutsias M, Seeberg B, Schultheiss HP. Immunohistochemical evidence for a chronic intramyocardial inflammatory process in dilated cardiomyopathy. Heart. 1996; 75: 295–300.[Abstract/Free Full Text]
  3. Jin O, Sole MJ, Butany JW, Chia WK, McLaughlin PR, Liu P, Liew CC. Detection of enterovirus RNA in myocardial biopsies from patients with myocarditis and cardiomyopathy using gene amplification by polymerase chain reaction. Circulation. 1990; 82: 8–16.[Abstract/Free Full Text]
  4. Kodama M, Hanawa H, Saeki M, Hosono H, Inomata T, Suzuki K, Shibata A. Rat dilated cardiomyopathy after autoimmune giant cell myocarditis. Circ Res. 1994; 75: 278–284.[Abstract/Free Full Text]
  5. Nakamura H, Yamamura T, Umemoto S, Fukuta S, Shioi T, Matsumori A, Sasayama S, Matsuzaki M. Autoimmune response in chronic ongoing myocarditis demonstrated by heterotopic cardiac transplantation in mice. Circulation. 1996; 94: 3348–3354.[Abstract/Free Full Text]
  6. Rose NR, Hill SL. The pathogenesis of postinfectious myocarditis. Clin Immunol Immunopathol. 1996; 80: S92–S99.[CrossRef][Medline] [Order article via Infotrieve]
  7. Hubes SA, Lodge PA. Coxsackievirus B3 myocarditis in BALB/c mice: evidence for autoimmunity to myocyte antigens. Am J Pathol. 1984; 116: 21–29.[Abstract]
  8. Lauer B, Padberg K, Schultheiss HP, Strauer BE. Autoantibodies against cardiac myosin in patients with myocarditis and dilated cardiomyopathy. Z Kardiol. 1995; 84: 301–310.[Medline] [Order article via Infotrieve]
  9. Maisch B, Deeg P, Liebau G, Kochsiek K. Diagnostic relevance of humoral and cytotoxic immune reactions in primary and secondary dilated cardiomyopathy. Am J Cardiol. 1983; 52: 1072–1078.[CrossRef][Medline] [Order article via Infotrieve]
  10. Okura Y, Takeda K, Honda S, Hanawa H, Watanabe H, Kodama M, Izumi T, Aizawa Y, Seki S, Abo T. Recombinant murine interleukin-12 facilitates induction of cardiac myosin-specific type 1 helper T cells in rats. Circ Res. 1998; 82: 1035–1042.[Abstract/Free Full Text]
  11. Okura Y, Yamamoto T, Goto S, Inomata T, Hirono S, Hanawa H, Feng L, Wilson CB, Kihara I, Izumi T, Shibata A, Aizawa Y, Seki S, Abo T. Characterization of cytokine and iNOS mRNA expression in situ during the course of experimental autoimmune myocarditis in rats. J Mol Cell Cardiol. 1997; 29: 491–502.[CrossRef][Medline] [Order article via Infotrieve]
  12. Borger P, Hoekstra Y, Esselink MT, Postma DS, Zaagsma J, Vellenga E, Kauffman HF. Beta-adrenoceptor-mediated inhibition of IFN-gamma, IL-3, and GM-CSF mRNA accumulation in activated human T lymphocytes is solely mediated by the beta2-adrenoceptor subtype. Am J Respir Cell Mol Biol. 1998; 19: 400–407.[Abstract/Free Full Text]
  13. Panina-Bordignon P, Mazzeo D, Lucia PD, D’Ambrosio D, Lang R, Fabbri L, Self C, Sinigaglia F. Beta2-agonists prevent Th1 development by selective inhibition of interleukin-12. J Clin Invest. 1997; 100: 1513–1519.[Medline] [Order article via Infotrieve]
  14. Malfait AM, Malik AS, Marinova-Mutafchieva L, Butler DM, Maini RN, Feldmann M. The beta2-adrenergic agonist salbutamol is a potent suppressor of established collagen-induced arthritis: mechanisms of action. J Immunol. 1999; 162: 6278–6283.[Abstract/Free Full Text]
  15. Inomata T, Hanawa H, Miyanishi T, Yajima E, Nakayama S, Maita T, Kodama M, Izumi T, Shibata A, Abo T. Localization of porcine cardiac myosin epitopes that induce experimental autoimmune myocarditis. Circ Res. 1995; 76: 726–733.[Medline] [Order article via Infotrieve]
  16. van der Molen T, Sears MR, de Graaff CS, Postma DS, Meyboom-de Jong B, for the Canadian and Dutch Formoterol Investigators. Quality of life during formoterol treatment: comparison between asthma-specific and generic questionnaires. Eur Respir J. 1998; 12: 30–34.[Abstract]
  17. Sponer G, Bartsch W, Strein K, Muller-Beckmann B, Bohm E. Pharmacological profile of carvedilol as a beta-blocking agent with vasodilating and hypertensive properties. J Cardiovasc Pharmacol. 1987; 9: 317–327.[Medline] [Order article via Infotrieve]
  18. Takehana H, Inomata T, Niwano H, Nishii M, Matsuda C, Kohno K, Machida Y, Izumi T. Immunomodulatory effect of pentoxifyline in suppressing experimental autoimmune myocarditis. Jpn Circ J. 2002; 66: 499–504.
  19. Hanawa H, Abe S, Hayashi M, Yoshida T, Yoshida K, Shiono T, Fuse K, Ito M, Tachikawa H, Kashimura T, Okura Y, Kato K, Kodama M, Maruyama S, Yamamoto T, Aizawa Y. Time course of gene expression in rat experimental autoimmune myocarditis. Clin Sci. 2002; 103: 623–632.[Medline] [Order article via Infotrieve]
  20. Wegmann KW, Zhao W, Griffin AC, Hickey WF. Identification of myocarditogenic peptides derived from cardiac myosin capable of inducing experimental allergic myocarditis in the Lewis rat. J Immunol. 1994; 153: 892–900.[Abstract]
  21. Nishio R, Matsumori A, Shioi T, Wang W, Yamada T, Ono K, Sasayama S. Denopamine, a beta1-adrenergic agonist, prolongs survival in a murine model of congestive heart failure induced by viral myocarditis: suppression of tumor necrosis factor-alpha production in the heart. J Am Coll Cardiol. 1998; 32: 808–815.[Abstract/Free Full Text]
  22. Yuan Z, Shioji K, Kihara Y, Takenaka H, Onozawa Y, Kishimoto C. Cardioprotective effects of carvedilol on acute autoimmune myocarditis: anti-inflammatory effects associated with antioxidant property. Am J Physiol. 2004; 286: 83–90.
  23. Nishio R, Shioi T, Sasayama S, Matsumori A. Carvedilol increases the production of interleukin-12 and interferon-gamma and improves the survival of mice infected with the encephalomyocarditis virus. J Am Coll Cardiol. 2003; 41: 340–345.[Abstract/Free Full Text]
  24. Kodama M, Matsumoto Y, Fujiwara M. In vivo lymphocyte-mediated myocardial injuries demonstrated by adoptive transfer of experimental autoimmune myocarditis. Circulation. 1992; 85: 1918–1926.[Abstract/Free Full Text]
  25. Futamatsu H, Suzuki J, Kosuge H, Yokoseki O, Kamada M, Ito H, Inobe M, Isobe M, Uede T. Attenuation of experimental autoimmune myocarditis by blocking activated T cells through inducible costimulatory molecule pathway. Cardiovasc Res. 2003; 59: 95–104.[Abstract/Free Full Text]
  26. Watanabe K, Nakazawa M, Fuse K, Hanawa H, Kodama M, Aizawa Y, Ohnuki T, Gejyo F, Maruyama H, Miyazaki J. Protection against autoimmune myocarditis by gene transfer of interleukin-10 by electroporation. Circulation. 2001; 104: 1098–1100.[Abstract/Free Full Text]
  27. Futamatsu H, Suzuki J, Mizuno S, Koga N, Adachi S, Kosuge H, Maejima Y, Hirao K, Nakamura T, Isobe M. Hepatocyte growth factor ameliorates the progression of experimental autoimmune myocarditis: a potential role for induction of T helper 2 cytokines. Circ Res. 2005; 96: 823–830.[Abstract/Free Full Text]
  28. Kodama M, Zhang S, Hanawa H, Shibata A. Immunohistochemical characterization of infiltrating mononuclear cells in the rat heart with experimental autoimmune giant cell myocarditis. Clin Exp Immunol. 1992; 90: 330–335.[Medline] [Order article via Infotrieve]
  29. Kavelaars A, van de Pol M, Zijlstra J, Heijnen CJ. Beta2-adrenergic activation enhances interleukin-8 production by human monocytes. J Neuroimmunol. 1997; 77: 211–216.[CrossRef][Medline] [Order article via Infotrieve]
  30. van der Poll T, Coyle SM, Barbosa K, Braxton CC, Lowry SF. Epinephrine inhibits tumor necrosis factor-alpha and potentiates interleukin-10 production during human endotoxemia. J Clin Invest. 1996; 97: 713–719.[Medline] [Order article via Infotrieve]
  31. Wang JF, Meissner A, Malek S, Chen Y, Ke Q, Zhang J, Chu V, Hampton TG, Crumpacker CS, Abelmann WH, Amende I, Morgan JP. Propranolol ameliorates and epinephrine exacerbates progression of acute and chronic viral myocarditis. Am J Physiol. 2005; 289: 1577–1583.
  32. Bristow MR. Beta-adrenergic receptor blockade in chronic heart failure. Circulation. 2000; 101: 558–569.[Free Full Text]
  33. Communal C, Singh K, Sawyer DB, Colucci WS. Opposing effects of beta1- and beta2-adrenergic receptors on cardiac myocyte apoptosis: role of a pertussis toxin-sensitive G protein. Circulation. 1999; 100: 2210–2212.[Abstract/Free Full Text]
  34. Bisognano JD, Weinberger HD, Bohlmeyer TJ, Pende A, Raynolds MV, Sastravaha A, Roden R, Asano K, Blaxall BC, Wu SC, Communal C, Singh K, Colucci WS, Bristow MR, Port DJ. Myocardial-directed overexpression of the human beta1-adrenergic receptor in transgenic mice. J Mol Cell Cardiol. 2000; 32: 817–830.[CrossRef][Medline] [Order article via Infotrieve]
  35. Rockman HA, Hamilton RA, Jones LR, Milano CA, Mao L, Lefkowitz RJ. Enhanced myocardial relaxation in vivo in transgenic mice overexpressing the beta 2-adrenergic receptor is associated with reduced phospholamban protein. J Clin Invest. 1996; 97: 1618–1623.[Medline] [Order article via Infotrieve]

 

CLINICAL PERSPECTIVE

We present a compelling case for evaluating ß2-adrenergic agonists in patients with myocarditic heart failure. Differences among in vivo therapies with ß2-adrenergic agonists, propranolol as a nonselective ß-adrenergic antagonist, and metoprolol as a ß1-selective adrenergic antagonist in rat experimental autoimmune myocarditis (EAM) produced by immunization with cardiac myosin demonstrated that ß2-adrenergic agonists modulate the development of EAM via ß2-adrenergic stimulation. This effect was associated with modulating myocarditogenic Th1 T lymphocytes specific for cardiac myosin–mediated immune response in the lymphoid organs and shifting the imbalance of the Th1 cytokine and Th2 cytokine pattern toward the Th2 cytokine pattern in the myocardium, which was contributed to the suppression of Th1 cytokine production by ß2-adrenergic stimulation. Therapy with ß2-adrenergic agonists furthermore suppressed not only the induction of myocarditis but also established myocardial inflammation. It contributed to the improvement of hemodynamics and mortality in EAM. Taken together, these findings indicate the new role of the ß2-adrenergic agonist as an immunomodulator in the development of EAM and may provide a novel approach for therapy in patients suffering from inflammatory myocardial conditions with hemodynamic deterioration, particularly those derived from autoimmune processes. Interest in ß2-adrenergic agonists, which has been restricted to bronchodilators, should be renewed because of their potential as an immunomodulatory and therapeutic agent in myocardial inflammatory disease complicated by heart failure.




This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
I. Ahmet, M. Krawczyk, W. Zhu, A. Y.-H. Woo, C. Morrell, S. Poosala, R.-p. Xiao, E. G. Lakatta, and M. I. Talan
Cardioprotective and Survival Benefits of Long-Term Combined Therapy with {beta}2 Adrenoreceptor (AR) Agonist and {beta}1 AR Blocker in Dilated Cardiomyopathy Postmyocardial Infarction
J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 491 - 499.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
F. Lirussi, Z. Rakotoniaina, S. Madani, F. Goirand, M. Breuiller-Fouche, M.-J. Leroy, P. Sagot, J. J. Morrison, M. Dumas, and M. Bardou
ADRB3 Adrenergic Receptor Is a Key Regulator of Human Myometrial Apoptosis and Inflammation During Chorioamnionitis
Biol Reprod, March 1, 2008; 78(3): 497 - 505.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
W. Mao, S. Fukuoka, C. Iwai, J. Liu, V. K. Sharma, S.-S. Sheu, M. Fu, and C.-s. Liang
Cardiomyocyte apoptosis in autoimmune cardiomyopathy: mediated via endoplasmic reticulum stress and exaggerated by norepinephrine
Am J Physiol Heart Circ Physiol, September 1, 2007; 293(3): H1636 - H1645.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
114/9/936    most recent
CIRCULATIONAHA.105.607903v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nishii, M.
Right arrow Articles by Izumi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nishii, M.
Right arrow Articles by Izumi, T.
Related Collections
Right arrow Other heart failure
Right arrow Animal models of human disease