| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2006;114:936-944.)
© 2006 American Heart Association, Inc.
Molecular Cardiology |
From the Department of Internal Medicine and Cardiology, Kitasato University School of Medicine, Sagamihara, Japan.
Correspondence to Dr Mototsugu Nishii, Department of Internal Medicine and Cardiology, Kitasato University School of Medicine, 1-15-1 Kitasato, Sagamihara, 228-8555 Japan. E-mail mototsugu{at}smz.ja-shizuoka.or.jp
Received December 14, 2005; revision received May 26, 2006; accepted June 22, 2006.
| Abstract |
|---|
|
|
|---|
Methods and Results Experimental autoimmune myocarditis (EAM) was induced in rats by immunization with cardiac myosin. On daily administration from day 0 after immunization, the ß2-selective AR agonists formoterol or salbutamol ameliorated EAM on day 21 and increased myocardial interleukin-10/interferon-
mRNA levels. Propranolol, a nonselective ß-AR antagonist, aggravated EAM on day 21 and decreased mRNA levels, whereas metoprolol, a ß1-selective AR antagonist, showed no effect. These results were reflected in vivo by the proliferation of cardiac myosinprimed lymph node cells from drug-treated rats. In vitro addition of ß2-selective AR agonists inhibited the activation of cardiac myosin fragmentspecific myocarditogenic T lymphocytes, and this effect was reversed by ICI118,551, a ß2-selective AR antagonist. Furthermore, treatment with 2 different ß2-selective AR agonists starting on day 14 also ameliorated EAM on day 21.
Conclusions ß2-AR stimulation suppressed the development of EAM by inhibiting cardiac myosinspecific T-lymphocyte activation in lymphoid organs and by shifting the imbalance in Th1/Th2 cytokine toward Th2 cytokine. Furthermore, it also ameliorated established myocardial inflammation. ß2-ARstimulating agents may represent important immunomodulators of the cardiac myosininduced autoimmune process and have potential as a new therapy for myocarditis.
Key Words: immune system myocarditis receptors, adrenergic, beta
| Introduction |
|---|
|
|
|---|
Clinical Perspective p 944
Investigations using rat experimental autoimmune myocarditis (EAM) have shown that Th1 cytokines such as interferon-
(IFN-
) and interleukin-12 (IL-12) are major promoters of these autoimmune processes.10,11 On the other hand, given reports that ß2-adrenergic receptors (ß2-ARs) are present on Th1 T lymphocytes and antigen-presenting cells and that their activation suppresses the production of Th1 cytokines such as IFN-
and IL-12,12,13 ß2-AR has been investigated as a potential immunomodulator in Th1 cytokineinduced autoimmune disease.14 However, the role of ß2-ARstimulating agents on myocardial structuremediated autoimmune processes remains unknown. In this study we compared the effects of ß-AR agents on EAM.
| Methods |
|---|
|
|
|---|
Therapeutic Protocols
Protocol I
Groups of 18 healthy animals each received intraperitoneal administration of propranolol (Sigma, St Louis, Mo) at 10 mg/kg per day as a nonselective ß-AR antagonist, metoprolol at 30 mg/kg per day as a ß1-selective AR antagonist (Novartis Pharmaceutical Co, Tokyo, Japan), formoterol at 22.5 µg/kg per day as a ß2-selective AR agonist16 (Yamanouchi Pharmaceutical Co, Tokyo, Japan), salbutamol at 200 µg/kg per day as a ß2-selective AR agonist13,14 (Sigma Chemical Co, St Louis, Mo), or an equal volume of phosphate-buffered saline vehicle containing 0.5% methylcellulose daily from immunization with myosin, on day 0 until euthanasia on day 21. These drugs were also administered to control groups of 8 healthy animals each without immunization with myosin for 3 weeks. Doses were selected on the basis of previous findings17 to ensure a near-equipotent ß1-AR blocking effect.
Protocol II
Groups of 12 healthy animals each were given formoterol at 22.5 µg/kg per day, salbutamol at 200 µg/kg per day, or an equal volume of vehicle by intraperitoneal administration from day 14 until day 21 after immunization with myosin.
Hemodynamic Analysis
Blood pressure (BP), heart rate (HR), and fractional shortening were determined in healthy (without myosin immunization) and diseased rats (with immunization) treated with ß-ARmodulating agents or vehicle by the tail-cuff method with the use of a photoelectric tail-cuff detection system (Softron, Tokyo, Japan) and echocardiographic study (SSD-6500SV, Aloka, Tokyo, Japan) just before euthanasia on day 21. All measurements were averaged over at least 3 consecutive cardiac cycles.
Assessment of Severity of Myocarditis
All rats were killed under ether anesthesia on day 21. The ratio of heart weight to body weight (HW/BW) was calculated, and macroscopic scores were classified according to a 5-grade scoring system as previously reported.18 The cardiac ventricles were then divided transversely into 2 sections. The ratio of the area of inflammatory infiltrates to that of the whole myocardium on a sliced half-transverse section was calculated with a microscope, as previously reported,18 by 2 blinded observers. Interobserver and intraobserver variance was <5%.
Measurement of Cytokine Expression in Hearts
Real-time reverse transcriptionpolymerase chain reaction (RT-PCR) was performed to measure myocardial expression of IFN-
or interleukin-10 (IL-10) mRNA in the other half of the hearts. Reverse transcriptasepolymerase chain reaction (RT-PCR) was performed with the use of an ABI PRISM 7700 Sequence Detection System (PE Biosystems). Positive-stranded and negative-stranded primers for mRNA amplification were ATCTGGAGGAACTGGCAAAAGGACG and CCTTAGGCTAGATTCTGGTGACAGC for IFN-
,19 ACTGCTCTGTTGCCTGCTCTTACT and GAATTCAAATGCTCCTTGATTTCT for IL-10,19 and ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA for glyceraldehyde phosphate dehydrogenase.19 A standard curve was calculated with the use of the ABI PRISM 7700 System, from which the absolute copy numbers of mRNA in the samples were obtained.
In Vitro Experiments
ß-ARModulating Agents on Myocarditogenic T-Lymphocyte Activities
A myocardiogenic CD4-positive Th1-phenotype T-lymphocyte line specific for the cardiac myosin fragment CM2 (a.a. 15391555)20 was established as previously reported.18 This T-lymphocyte line (5x104 per well) was cultured in triplicate supplemented with CM2 (10 µg/mL) and irradiated (5000 rad) syngeneic thymocytes as antigen-presenting cells (1x106 per well). Formoterol (1010 to 104 mol/L), salbutamol (1010 to 104 mol/L), or denopamine (1010 to 104 mol/L; Tanabe Pharmaceutical Co, Tokyo, Japan) as a ß1-selective AR agonist or vehicle was added to the cell-suspension culture solution, with or without ICI118,551 (108 to 106 mol/L; Tocris, Ellisville, Mo) as a ß2-selective AR antagonist. After incubation, proliferation of cardiac myosinspecific T lymphocytes and levels of IFN-
and IL-12 in each well were determined as previously described.18 Three series of experiments were performed for each investigation.
Proliferation Assay Using Myosin-Primed Lymph Node Cells From Treated Rats
Popliteal lymph nodes were removed from Lewis rats killed 11 days after immunization with porcine cardiac myosin under daily administration of metoprolol at 30 mg/kg per day, propranolol at 10 mg/kg per day, formoterol at 22.5 µg/kg per day, salbutamol at 200 µg/kg per day, or vehicle (n=9 each). Viable mononuclear cells (5x104 per well) from the lymph nodes in single-cell suspension were cultured for 48 hours in triplicate with or without 10 µg/mL of cardiac myosin. Cell proliferation and levels of IFN-
and IL-12 in each well were then determined as described previously.18
Intracellular cAMP Measurement
Myosin-primed lymph node cells (5x104 per well) from drug-treated rats (n=9 each) were cultured in triplicate with cardiac myosin as described above. Cells were pelleted by centrifugation at 1400g for 5 minutes followed by the addition of lysis buffer for 10 minutes. Intracellular cAMP levels were then measured with an enzyme-linked immunosorbent assay (ELISA) kit (Amersham, Piscataway, NJ).
Statistical Analysis
Data are expressed as mean±SEM. Statistical analyses were performed by 1-way ANOVA, followed by a post hoc test (Bonferroni multiple comparison test). RT-PCR analysis was performed as follows. The copy number of IFN-
or IL-10 mRNA was normalized for GAPDH mRNA, and the myocardial expression of cytokine in each sample from EAM rats that received treatment with the ß-AR agent or vehicle was then expressed as fold increase over the average level in the control group, composed of 9 EAM rats, on day 21 with no treatment. The balance of Th1 and Th2 cytokines was expressed as the ratio of IL-10 mRNA to IFN-
mRNA: IL-10/IFN-
. IL-10/IFN-
level in each sample with therapy was also expressed as fold increase over that of the control group. Levels of IFN-
, IL-10, or IL-10/IFN-
, as well as histological and hemodynamic variables in the vehicle and control groups, were approximately equal (data not shown). To examine the effects of ß-AR agents on the expression of cytokine, fold increase was compared across therapeutic groups. Probability values <0.05 were considered statistically significant.
The authors had full access to the data and take full responsibility for its integrity. All authors have read and agree to the manuscript as written.
| Results |
|---|
|
|
|---|
|
Administration of ß-AR Agents Starting on Day 0
Mortality
Four diseased rats treated with vehicle or metoprolol (mortality: 4/18, 22%) died between days 19 and 21, and 8 diseased rats treated with propranolol (8/18, 44%) died between days 15 and 21. However, all diseased rats treated with the ß2-AR agonists (0/18, 0%) survived until day 21.
Hemodynamics
Compared with the vehicle group, BP, HR, and fractional shortening were significantly decreased in the ß-AR antagonist groups, whereas fractional shortening and BP were significantly increased with a decrease of HR in the ß2-AR agonist groups. No significant differences in hemodynamic variables were seen between the ß-AR antagonist groups (Table 2).
|
Severity of Disease
Macroscopic score, HW/BW, and area of cellular infiltration into the myocardium were significantly reduced in the 2 ß2-AR agonist groups, indicating a significantly reduced severity of disease. In contrast, the propranolol but not the metoprolol group showed a significantly increased severity of disease compared with the vehicle group (Figure 1, Table 2).
|
Cytokine Profiles
Compared with the vehicle group, levels of IFN-
and IL-10 mRNA in the myocardium were significantly increased in the propranolol but not in the metoprolol group. In contrast, levels were decreased in both the formoterol and salbutamol groups. However, IL-10/IFN-
was significantly decreased in the propranolol group but increased in the 2 ß2-AR agonist groups compared with the vehicle group (Table 2).
Administration of ß2-AR Agonist From Day 14 After Immunization
Mortality
Three diseased rats treated with the vehicle (mortality: 3/12, 25%) died between days 19 and 21, whereas all diseased rats treated with the ß2-AR agonists (0/12, 0%) survived until day 21.
Hemodynamics
Among hemodynamic variables, significant increases in fractional shortening and systolic blood pressure were seen, with a significant decrease in heart rate in the formoterol and salbutamol groups compared with the vehicle group (Table 3).
|
Severity of Disease
Disease severity as indicated by macroscopic score, HW/BW, and area of cellular infiltration into the myocardium was significantly decreased in the formoterol and salbutamol groups compared with the vehicle group (Table 3). These macroscopic findings were reflected in microscopic findings, which included interstitial cellular infiltration and destruction of myocardial fibers (Figure 2).
|
Cytokine Profiles
Compared with levels in the vehicle group, myocardial mRNA levels of IFN-
and IL-10 were significantly decreased in both the formoterol group and salbutamol group. In contrast, myocardial IL-10/IFN-
mRNA levels were significantly increased in the ß2-AR agonist groups compared with the vehicle group (Table 3).
Myocardiogenic T Lymphocytes and ß-AR Stimulation
Formoterol as well as salbutamol strongly and dose-dependently suppressed cardiac myosinspecific T-lymphocyte proliferation and IL-12 production by antigen-presenting cells and IFN-
production by T lymphocytes, whereas denopamine only slightly suppressed cardiac myosinspecific T-lymphocyte activity (Figure 3). ICI118,551 reversed these inhibitory effects of formoterol or salbutamol (Figure 4).
|
|
Influence of In Vivo Administration of ß-AR Agents on Lymph Node Cell Activity
The proliferation of cardiac myosinprimed lymph node cells from treated EAM rats and their production of IL-12 and IFN-
were significantly decreased in both the formoterol group (6399±297 cpm, 76±4.9 pg/mL, 3480±145 pg/mL, respectively; each P<0.00001 versus the vehicle group) and the salbutamol group (6140±295 cpm, 61±4.5 pg/mL, 3012±189 pg/mL, respectively; each P<0.00001 versus the vehicle group) compared with the vehicle group (13283±309 cpm, 173±12 pg/mL, 12913±429 pg/mL, respectively). Conversely, cell proliferation and cytokine production were significantly increased in the propranolol group (28233±527 cpm, 402±24 pg/mL, 44022±1408 pg/mL, respectively; each P<0.00001 versus the vehicle group) but not in the metoprolol group (12388±253 cpm, P=0.08; 157±13 pg/mL, P=0.96; 13939±392 pg/mL, P=0.58; respectively) (Figure 5). Cell proliferation and cytokine expression were not observed in any culture without cardiac myosin (300±14 cpm).
|
Administration of formoterol and salbutamol increased intracellular cAMP levels in myosin-primed lymph node cells compared with vehicle (188±12, 179±9, versus 39±2 fmol, respectively; each P<0.00001), whereas that of propranolol decreased cAMP levels (11±0.8 fmol; P=0.00007 versus the vehicle group). Administration of metoprolol did not affect intracellular cAMP level (36±1 fmol; P=2.39 versus the vehicle group) (Figure 5).
| Discussion |
|---|
|
|
|---|
Wide use of ß2-selective ARstimulating agents such as formoterol and salbutamol has been restricted to bronchodilation in patients with asthma. Recently, however, interest in these agents was renewed for their potential immunomodulatory role in Th1 cytokineinduced autoimmune disease. Catecholamines and several adrenergic agonists have been shown to influence the production of Th1 cytokines, and ß2-AR is involved in this mechanism.12,13 Furthermore, intraperitoneal administration of salbutamol, a ß2-selective AR agonist, suppressed Th1 cytokineinduced autoimmune arthritis via ß2-AR in vivo.14 In the present study, the 2 ß2-selective AR agonists formoterol and salbutamol did not affect hemodynamics in healthy rats (Table 1) but ameliorated Th1 cytokineinduced EAM10,11 on day 21 (Table 2) and reduced mortality. Furthermore, treatment with propranolol but not metoprolol exacerbated EAM on day 21 and increased mortality, despite showing equivalent hemodynamic effects (Table 2). The different effect of the 2 ß-blockers according to ß-AR selectivity supports the existence of an immunomodulatory role of ß2-AR in the development of EAM. Together, the present results indicate that ß2-ARstimulating agents can ameliorate the development of EAM via ß2-AR.
In myocarditis, the autoimmune process leads to myocardial inflammation and injury via the effect of activated Th1 T lymphocytes specific for cardiac myosin.10,24 Th1 cytokines such as IL-12 and IFN-
promote this process.10 It has been demonstrated that ß2-AR stimulation inhibits the production of IFN-
and IL-12 in vitro.12,13 Furthermore, inhibition of antigen-specific T-cell proliferation was reported to be a therapeutic strategy for retarding the development of myocarditis.25 The protective effect on EAM of the 2 ß2-selective AR agonists seen here can therefore be explained by the idea that ß2-AR stimulation attenuates cardiac myosinspecific Th1 T-lymphocyte proliferation by suppressing the production of Th1 cytokines. However, the suppressive effect of ß2-AR stimulation on cardiac myosinspecific Th1 T-lymphocyte activity has not been elucidated.
To clarify this point, we used in vitro experimental systems using the immunodominant myosin peptidespecific CD4-positive Th1 T-lymphocyte line, the transfer of which induces EAM,18 and ex vivo experimental systems using cardiac myosinprimed lymph nodes from ß-AR agenttreated rats. The myocarditogenic Th1 T-lymphocyte line was stimulated with antigen-presenting cells and the specific antigen to emulate the priming step of EAM in vivo. Both formoterol and salbutamol reduced cardiac myosinspecific T-lymphocyte proliferation by suppressing the production of IL-12 and IFN-
(Figure 3). ICI118,551, a ß2-selective AR antagonist, but not metoprolol (data not shown), completely reversed the inhibitory effects of formoterol and salbutamol (Figure 4). Along with the difference in myosin-primed lymph node cell proliferation among formoterol-treated, salbutamol-treated, propranolol-treated, metoprolol-treated, and vehicle-treated rats (Figure 5), these results suggested that ß2-ARstimulating agents ameliorated the induction of EAM by attenuating cardiac myosinspecific Th1 T-lymphocyte proliferation in the lymphoid organs associated with the suppression of Th1 cytokines via ß2-AR stimulation. Previous reports have demonstrated that ß2-AR is present on Th1 T lymphocytes and antigen-presenting cells and that its activation inhibits their production of Th1 cytokines by increasing intracellular cAMP levels.12,13 In our ex vivo experiment, ß2-AR stimulation inhibited myosin-primed lymph node cell activity adversely, in parallel with increasing intracellular cAMP levels (Figure 5). Thus, the inhibitory effect of ß2-AR stimulation on Th1 T lymphocytes specific for the cardiac myosinmediated immune response identified here may have contributed to the activation of the ß2-ARcAMP signaling pathway on Th1 T lymphocytes and antigen-presenting cells.
An imbalance in Th1 and Th2 cytokines modulates the pathogenesis of EAM,11 and the Th2 cytokine IL-10 plays a protective role in the development of EAM.26 Previous reports showed that shifting the immune response toward the Th2 pattern prevented the development of EAM.10,27 Thus, we examined the production of the Th1 cytokine IFN-
and Th2 cytokine IL-10 in the heart. Administration of either formoterol or salbutamol, but not of propranolol, starting on day 0 reduced myocardial IFN-
expression on day 21 compared with the vehicle group. The influences of drugs on myocardial IL-10 expression showed a similar pattern, although to a lesser degree, which is in part associated with the interaction of IL-10 and IFN-
during the course of their production. However, myocardial IL-10/IFN-
mRNA expression was significantly increased in the 2 ß2-AR agonist groups, whereas it was significantly decreased in the propranolol group (Table 2). This finding suggests that ß2-AR stimulation shifts the myocardial Th1/Th2 cytokine balance toward Th2 cytokines and that this effect in part contributes to modulating the development of EAM by ß2-ARstimulating agents.
Not only extremely suppressed myocardial IFN-
expression by ß2-AR stimulation but also in part enhanced IL-10 expression by it may contribute to alteration of the myocardial Th1/Th2 cytokine balance in vivo. Myocardial inflammation in EAM mainly involves macrophages and CD4-positive Th1 T lymphocytes, and the dominance of these cells is a constant finding at lesion sites and throughout the course of the disease.28 The enhancement of IL-10 production in inflammatory cells such as monocytes, macrophages, and dendritic cells via ß2-AR stimulation has been reported.29,30
Propranolol enhanced disease severity in the present study. However, recent studies in the BALB/c mouse model of viral myocarditis found that propranolol exerts a protective effect against myocarditis.31 This difference may be explained in part by the promotion of a Th1 response in this infectious model, which clears the virus.23,31
In the present study, our intervention with ß2-ARstimulating agents was done in a later phase of EAM to examine their effect on established myocardial inflammation. Formoterol and salbutamol significantly reduced the severity and mortality of myocarditis (Table 3) and significantly increased myocardial IL-10/IFN-
mRNA levels on day 21 compared with the vehicle (Table 3). ß2-ARstimulating agents also ameliorated established myocardial inflammation, and this beneficial effect was in part associated with an alteration in the myocardial Th1/Th2 cytokine balance. Given that human myocarditis is usually diagnosed after disease onset, this result has important implications for clinical treatment.
Chronic ß-AR stimulation in heart failure induces myocardial apoptosis and thereby induces progressive myocardial remodeling.32 However, recent reports have demonstrated opposing effects of ß1- and ß2-AR stimulation on cardiac myocytes. In rat cardiomyocytes, ß1-AR stimulation induces apoptosis via a cAMP-dependent mechanism, whereas ß2-AR stimulation inhibits this process.33 A transgenic mice model overexpressing ß1-AR developed dilated cardiomyopathy along with hemodynamic deterioration, whereas those overexpressing ß2-AR did not.34,35 In the present study, treatment with ß2-AR agonists at doses that did not affect hemodynamic variables in healthy rats (Table 1) throughout the acute phase at least improved cardiac contractility in EAM rats (Table 2), and decreasing HR compared with the vehicle group (Table 2) may reflect an improvement of cardiac function. The new immunomodulatory effect of ß2-AR stimulation identified here also contributed to this effect. ß2-ARstimulating agents thus may represent the preferred therapy for inflammatory myocardial conditions with hemodynamic deterioration derived from autoimmune processes.
| Conclusions |
|---|
|
|
|---|
| Acknowledgments |
|---|
Sources of Funding
This study was supported by a grant-in-aid for scientific research from the Postgraduate Research Project at Kitasato University and a grant for scientific research from the Ministry of Education, Science, and Culture of Japan (No. 20311954).
Disclosures
None.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
I. Ahmet, M. Krawczyk, W. Zhu, A. Y.-H. Woo, C. Morrell, S. Poosala, R.-p. Xiao, E. G. Lakatta, and M. I. Talan Cardioprotective and Survival Benefits of Long-Term Combined Therapy with {beta}2 Adrenoreceptor (AR) Agonist and {beta}1 AR Blocker in Dilated Cardiomyopathy Postmyocardial Infarction J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 491 - 499. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lirussi, Z. Rakotoniaina, S. Madani, F. Goirand, M. Breuiller-Fouche, M.-J. Leroy, P. Sagot, J. J. Morrison, M. Dumas, and M. Bardou ADRB3 Adrenergic Receptor Is a Key Regulator of Human Myometrial Apoptosis and Inflammation During Chorioamnionitis Biol Reprod, March 1, 2008; 78(3): 497 - 505. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Mao, S. Fukuoka, C. Iwai, J. Liu, V. K. Sharma, S.-S. Sheu, M. Fu, and C.-s. Liang Cardiomyocyte apoptosis in autoimmune cardiomyopathy: mediated via endoplasmic reticulum stress and exaggerated by norepinephrine Am J Physiol Heart Circ Physiol, September 1, 2007; 293(3): H1636 - H1645. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2006 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |