Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2006;114:2482-2489
Published online before print November 20, 2006, doi: 10.1161/CIRCULATIONAHA.106.642801
CLINICAL PERSPECTIVE
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
114/23/2482    most recent
CIRCULATIONAHA.106.642801v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Niessner, A.
Right arrow Articles by Weyand, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Niessner, A.
Right arrow Articles by Weyand, C. M.
Related Collections
Right arrow Apoptosis
Right arrow Pathophysiology
Right arrow Acute coronary syndromes
Right arrow Mechanism of atherosclerosis/growth factors

(Circulation. 2006;114:2482-2489.)
© 2006 American Heart Association, Inc.


Molecular Cardiology

Pathogen-Sensing Plasmacytoid Dendritic Cells Stimulate Cytotoxic T-Cell Function in the Atherosclerotic Plaque Through Interferon-{alpha}

Alexander Niessner, MD; Kayoko Sato, MD, PhD; Elliot L. Chaikof, MD, PhD; Ines Colmegna, MD; Jörg J. Goronzy, MD, PhD; Cornelia M. Weyand, MD, PhD

From the Kathleen B. and Mason I. Lowance Center for Human Immunology, Department of Medicine (A.N., K.S., I.C., J.J.G., C.M.W.), and Department of Surgery, Division of Vascular Surgery (E.L.C.), Emory University School of Medicine, Atlanta, Ga.

Correspondence to Cornelia M. Weyand, MD, PhD, Lowance Center for Human Immunology, Emory University School of Medicine, 101 Woodruff Circle, 1003 WMRB, Atlanta, GA 30322. E-mail cweyand{at}emory.edu

Received June 9, 2006; revision received September 13, 2006; accepted September 29, 2006.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— Unstable atherosclerotic plaque is characterized by an infiltrate of inflammatory cells. Both macrophages and T cells have been implicated in mediating the tissue injury leading to plaque rupture; however, signals regulating their activation remain unidentified. Infectious episodes have been suspected to render plaques vulnerable to rupture. We therefore explored whether plasmacytoid dendritic cells (pDCs) that specialize in sensing bacterial and viral products can regulate effector functions of plaque-residing T cells and thus connect host infection and plaque instability.

Methods and Results— pDCs were identified in 53% of carotid atheromas (n=30) in which they localized to the shoulder region and produced the potent immunoregulatory cytokine interferon (INF)-{alpha}. IFN-{alpha} transcript concentrations in atheroma tissues correlated strongly with plaque instability (P<0.0001). Plaque-residing pDCs responded to pathogen-derived motifs, CpG-containing oligodeoxynucleotides binding to toll-like receptor 9, with enhanced IFN-{alpha} transcription (P=0.03) and secretion (P=0.007). IFN-{alpha} emerged as a potent regulator of T-cell function, even in the absence of antigen recognition. Specifically, IFN-{alpha} induced a 10-fold increase of tumor necrosis factor–related apoptosis-inducing ligand (TRAIL) on the surface of CD4 T cells (P<0.0001) and enabled them to effectively kill vascular smooth muscle cells (P=0.0003).

Conclusions— pDCs in atherosclerotic plaque sense microbial motifs and amplify cytolytic T-cell functions, thus providing a link between host-infectious episodes and acute immune-mediated complications of atherosclerosis.


Key Words: immune system • inflammation • lymphocytes • muscle, smooth • plaque rupture • plasmacytoid dendritic cell • toll-like receptor


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Atherosclerotic plaque inflammation is a well-established risk factor for rupture of the protective cap, subsequent thrombotic vessel occlusion, and acute coronary syndrome (ACS).1–3 Accordingly, recruitment of lymphocytes and antigen-presenting cells to the atheroma is a critical event in the transition of a stable atherosclerotic lesion to a vulnerable plaque.4 Although plaque-residing macrophages have been recognized as participants in the tissue injury leading to plaque destabilization, it has recently become clear that T cells also have tissue-injurious effector functions.5 In particular, plaque-infiltrating CD4 T cells have cytotoxic capability, harming endothelial cells (ECs) as well as vascular smooth muscle cells (VSMCs).6–8 It is unclear how such T cells are activated in the plaque environment.

Dendritic cells (DCs) residing in the plaque may facilitate in situ T-cell activation.9 DCs activate T cells by presenting antigen and providing costimulatory signals. DCs also affect T cells in an antigen-independent way by secreting cytokines, such as interleukin (IL)-12, which regulate the recruitment of plaque-infiltrating CD4 T cells.10 DCs colocalize with T cells in the plaque, emphasizing their potential role in modulating T-cell function in vivo.11,12 The presence of DCs in rupture-prone areas of the atheroma raises the possibility that they interfere directly with tissue-damaging effector pathways.9,12

Clinical Perspective p 2489

The capacity of DCs to stimulate T cells depends crucially on their stage of maturation. Toll-like receptors (TLR) provide a powerful mechanism of DC maturation by recognizing pathogen-associated molecular patterns (PAMPs) that signal "danger" imposed by infection or tissue damage. Overexpression of TLR4 on circulating antigen-presenting cells in ACS and expression of TLR1, TLR2, and TLR4 in the atherosclerotic plaque have been described.13–16 Candidate TLR ligands in the atherosclerotic plaque include microbes and (modified) autoantigens such as human heat shock protein 60 and oxidized low-density lipoprotein.17–19

To date, studies have focused on CD11+ myeloid DCs in atherosclerotic plaques. However, DCs also include another major subtype, CD11CD123high plasmacytoid DCs (pDCs), which express TLR7 and TLR9.20 Oligodeoxynucleotides containing particular CpG motifs (CpG ODN) typically found in microbial DNA are recognized by TLR9 and facilitate abundant interferon (IFN)-{alpha} production.20

IFN-{alpha} is best known for its vital function in host immune responses that protect from infections. Specifically, IFN-{alpha} enhances cytotoxicity of CD8 and natural killer cells21 and induces the expansion and activation of Th1-polarized CD4 T cells.22,23 IFN-{alpha} amplifies the ability of CD4 T cells to kill tumor cells.24 Proapoptotic effects of CD4 T cells have recently been implicated in tissue-injurious responses in atherosclerotic plaques.25 TNF-related apoptosis-inducing ligand (TRAIL) is expressed on CD4 T cells and binds to death receptor (DR)5, which is upregulated on stressed VSMCs.8 DR5 ligation initiates the death pathway leading to VSMC apoptosis, a mechanism proposed to contribute to weakening of the fibrous cap.26–28

We examined whether pDCs have immunoregulatory functions in the atherosclerotic plaque and respond to PAMPs. We further investigated the role of IFN-{alpha} in regulating T-cell function through the induction of TRAIL, a powerful mediator of apoptosis implicated in cell death associated with plaque vulnerability.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Study Population
Blood was drawn from 31 patients (61% male, aged 55±10 years) with ACS (32% ST-elevation myocardial infarction) at admission. Patients with infectious, autoimmune, or neoplastic disease were ineligible. Thirty-one sex- and age-matched individuals without cardiovascular disease served as controls. Thirty carotid artery specimens were collected from patients undergoing endarterectomy procedures (Table I in the online-only Data Supplement). We determined atherosclerotic plaque vulnerability using a score modified from Depre et al29 and Naghavi et al.4 The size of the lipid core (0 to 2 points), the density of the inflammatory infiltrate (0 to 2 points), and the presence of residual thrombus (0 to 1 point) were determined in each plaque by macroscopic and microscopic analysis and semiquantified with the use of ImageJ (National Institutes of Health). Plaques with a score ≥3 were classified as vulnerable. Twelve morphologically atheroma-free parts of the specimens were used as controls. The Emory University Institutional Review Board approved all protocols, and appropriate consent was obtained.

Immunohistochemistry
Frozen carotid plaque tissues were cut into 5-µm sections, fixed in acetone for 10 minutes, and dried. Endogenous peroxidase was blocked, and 5% of the appropriate animal serum was added to inhibit nonspecific staining. Slides were stained with the following antibodies for 1 hour at room temperature: mouse anti-human IFN-{alpha} (1:400; BD Pharmingen, San Jose, Calif), mouse anti-human CD123 for pDCs (1:100; BD Pharmingen), mouse anti-human TLR9 (1:100; Imgenex, San Diego, Calif), mouse anti-human CD3 for T cells (1:200; Dako, Carpenteria, Calif), mouse anti-human CD11c for myeloid DCs (1:200; Dako), and rabbit anti-human von Willebrand factor (vWF) for endothelial cells (1:1000; Dako). A biotin-conjugated goat anti-mouse (Dako) or sheep anti-rabbit (Abcam, Cambridge, Mass) antibody served as secondary antibody (1:125 to 1:600, 30 minutes at room temperature). Brown color was developed with the use of a peroxidase solution (ABC-peroxidase kit; Vector Laboratories, Burlingame, Calif) and 3,3'-diaminobenzidine (DAB) (Dako) as chromogen. For double staining, red color was developed with the use of an alkaline phosphatase solution (ABC-AP kit; Vector Laboratories) and Vector Red (Vector Laboratories). Levamisole was used to inhibit endogenous alkaline phosphatase activity. Slides were counterstained with hematoxylin (Vector Laboratories) for 2 minutes.

Quantitative Reverse Transcriptase Polymerase Chain Reaction
Total RNA was isolated from shock-frozen endarterectomy and cell culture samples with the use of TRIzol (Invitrogen Life Technologies, Grand Island, NY) and transformed into cDNA with avian myeloblastosis virus reverse transcription (RT) (Roche Molecular Biochemicals). cDNA was amplified with primers specific for IFN-{alpha} (5'-A T G C G G A C T C C A T C T T G-3' and 5'-C G T G A C C T G G T G T A T G A G -3'), TRAIL (5'-A C C A A C G A G C T G A A G C A G A T-3' and 5'-C A A G T G C A A G T T G C T C A G G A-3'), TLR9 (5'-T G A A G A C T T C A G G C C C A A C T G-3' and 5'-T G C A C G G T C A C C A G G T T G T-3'), and ß-actin (5'-A T G G C C A C G G C T G C T T C C A G C-3' and 5'-C A T G G T G G T G C C G C C A G A C A G-3'), as described elsewhere.20 Amplifications were performed in a Mx3000 polymerase chain reaction (PCR) machine (Stratagene, Cedar Creek, Tex) under the following cycling conditions: denaturation at 94°C for 10 minutes, followed by 40 cycles at 95°C for 30 seconds, 55°C for 60 seconds, and 72°C for 60 seconds. For each sample, PCR reactions were done in triplicate. The level of gene expression was determined by interpolation with a standard curve. cDNA copy numbers are expressed relative to 2x105 ß-actin copies.

Stimulation of Explanted Atherosclerotic Plaque Tissue
Fresh tissue from 6 soft lipid-rich carotid plaques was cut into small pieces. For each plaque, equal numbers of nonadjacent plaque pieces were randomly distributed into wells of a 48-well plate filled with RPMI medium that contained 10% fetal calf serum. Tissue fragments were stimulated with 100 µg/mL synthetic CpG ODN (2006, TCGTCGTTTTGTCGTTTTGTCGT) for 24 hours. Stimulations were done in duplicate. After stimulation, tissue was shock-frozen for RNA isolation. In addition, IFN-{alpha} was measured in supernatants with an enzyme-linked immunosorbent assay (PBL Biomedical Laboratories, Piscataway, NJ).

Cells
Peripheral blood mononuclear cells were isolated from fresh blood with the use of Ficoll-Hypaque (Amersham Biosciences, Piscataway, NJ). CD4 T cells were isolated by negative selection (RosetteSep, StemCell Technologies, purity ≥94%). T-cell lines were isolated from carotid artery plaques by culturing tissue fragments with 50 U/mL recombinant IL-2 (Proleukin Chiron, Emeryville, Calif). Every 7 days, tissue-derived T cells were stimulated with 1x106/mL irradiated peripheral blood mononuclear cells, 1.5x105/mL irradiated Epstein-Barr virus–transformed B cells, 30 ng/mL anti-CD3 monoclonal antibody (Ortho Diagnostics), and 50 U/mL recombinant human IL-2. Tissue-derived CD4 T cells were memory T cells and lacked CD28 (data not shown). T cells were stimulated for 2 hours with IFN-{alpha} (200 U/mL, PBL, Biomedical Laboratories) or with 250 ng/mL anti-CD3 monoclonal antibody in the presence of FcRII+ P815 cells. Human coronary smooth muscle cells (SMCs) (Cambrex, Walkersville, Md) were grown in SmGM-2 smooth muscle medium (Cambrex).

Flow Cytometry
Multicolor flow cytometry analysis was performed by staining peripheral blood mononuclear cells and T cells for 30 minutes with peridinin chlorophyll protein–conjugated anti-CD4 monoclonal antibody, phycoerythrin-conjugated anti-TRAIL monoclonal antibody, and respective isotype control antibodies (all Becton Dickinson, Franklin Lakes, NJ). Cells were analyzed with a FACSCalibur flow cytometer (Becton Dickinson) and WinMDI software (Scripps Research Institute).

Apoptosis Assays
Confluent coronary SMCs grown in collagen-coated 96-well plates were pretreated for 1 hour with the nuclear binding dye 6'-diamidino-2-phenylindole (DAPI) (1 µg/mL; Sigma-Aldrich, St Louis, Mo). Freshly isolated T cells or resting T-cell lines pretreated for 2 hours with IFN-{alpha} (200 U/mL) were added at varying effector-to-target ratios for 4 hours at 37°C in phenol red–free RPMI medium supplemented with 2% fetal calf serum. Untreated T cells served as controls. Apoptosis was assessed as previously described,8 and apoptotic nuclear changes determined by DAPI staining were confirmed by annexin V membrane staining (1 µg/mL; Molecular Probes, Eugene, Ore). To inhibit TRAIL-mediated apoptosis, T cells were treated with a mouse anti-human TRAIL monoclonal antibody (25 µg/mL, RIK-2, Becton Dickinson) or IgG1 mouse control antibody before being added to coronary SMCs. Apoptosis rates observed in coronary SMCs without T cells (<5%) were subtracted. A minimum of 3 pictures per experiment were taken with a fluorescence microscope with 200-fold magnification and analyzed by an observer blinded for treatment using ImageJ (W. Rasband, National Institutes of Health).

Statistical Analysis
The normal distribution of data was tested with the Kolmogorov-Smirnov test. Normally distributed data were analyzed with t tests for independent samples or t tests for paired samples (eg, for stimulation data). In case of skewed distribution (eg, RT-PCR results), corresponding nonparametric tests (Mann-Whitney U tests or Wilcoxon signed rank tests) were used. Correlations were analyzed with the Pearson correlation coefficient. A general linear model procedure was used to analyze experiments with repeated measures (eg, various effector-to-target ratios in cytotoxic assays). All analyses were calculated with the use of the SPSS software package 12.0 for Windows (SPSS, Inc, Chicago, Ill).

The authors had full access to and take full responsibility for the integrity of the data. All authors have read and agree to the manuscript as written.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
IFN-{alpha}–Producing pDCs in the Atherosclerotic Plaque
Sixteen of 30 atherosclerotic plaques (53%) contained cells staining positive for CD123, a marker typically expressed on pDCs. CD123+ pDCs were located in the shoulder region (Figure 1A) or at the base of the plaque (Figure 1C). In addition, IFN-{alpha}–producing cells were restricted to these atheroma regions (Figure 1B, 1D). Double staining demonstrated that pDCs were the main source of IFN-{alpha} (>90%) (Figure 1C, 1D). The number of pDCs was 10-fold higher in unstable than in stable plaques (P<0.0001; Figure 1E). ECs, which can express low CD123 levels, were identified through the vWF marker and remained negative for IFN-{alpha} (data not shown).


Figure 1179633
View larger version (65K):
[in this window]
[in a new window]

 
Figure 1. IFN-{alpha}–producing plasmacytoid dendritic cells in the atherosclerotic plaque. Frozen sections from carotid atherosclerotic plaques were stained with anti-CD123 antibody, a marker for pDCs (A; DAB, brown, magnification x200, bar=200 µm; C, Vector Red, immunofluorescence, magnification x100, bar=500 µm; insets, magnification x400) and anti–IFN-{alpha} antibody (B; DAB, brown, magnification x200, bar=200 µm; D, DAB, brown, magnification x100, bar=500 µm; insets, magnification x400). CD123+ and IFN-{alpha}–producing cells were found in the shoulder region (A and B) and at the plaque base (C and D). Double staining with anti-CD123 (C; Vector Red, immunofluorescence) and anti–IFN-{alpha} antibody (D; DAB, brown) was used to define pDCs as the main source of IFN-{alpha}. Stains of serial sections for IFN-{alpha} and CD123 confirmed that IFN-{alpha} was primarily produced by pDCs (Figure I in the online-only Data Supplement). IFN-{alpha}–producing cells were negative for CD11c (data not shown). Numbers of CD123+ pDCs were counted in 3 sections of each plaque (E). Plaque stability was categorized on the basis of the size of the lipid core, the presence of residual thrombus, and the density of the cellular infiltrate, as described in Methods.

IFN-{alpha} in the Vulnerable Atheroma
IFN-{alpha} production in the atherosclerotic plaque was confirmed at the transcription level by quantitative RT-PCR. Tissue extracts were prepared from 30 plaques and 12 unaffected parts of carotid arteries. Plaques showed higher concentrations of IFN-{alpha} transcripts than normal vessel walls (P<0.0001; Figure 2). To assess the relation between plaque vulnerability and IFN-{alpha} tissue levels, endarterectomy samples were graded according to the presence of thrombus, lipid content, and density of the inflammatory infiltrate (TLI score). IFN-{alpha} mRNA levels were markedly higher in plaques with high TLI scores than in noninflamed, nonthrombosed plaques (P<0.0001; Figure 2).


Figure 2179633
View larger version (18K):
[in this window]
[in a new window]

 
Figure 2. Production of IFN-{alpha} in the atherosclerotic plaque. Carotid atheromas were collected by endarterectomy. mRNA was isolated from 30 plaque tissues and 12 carotid wall pieces free of atheroma. IFN-{alpha} cDNA copies were measured by quantitative RT-PCR and adjusted to 2x105 ß-actin copies. Plaques were categorized on the basis of the presence of residual thrombus, the size of the lipid core, and the density of the cellular infiltrate, as described in Methods. Box plots show median (bold black lines), interquartile range (boxes), and values within 1.5 interquartile ranges from the upper or lower edge of the box (whiskers).

The TLR9 Ligand CpG ODN Induces IFN-{alpha} in Atherosclerotic Plaques
Immunohistochemical staining revealed TLR9 expression in the atherosclerotic plaque (Figure 3A). TLR9 transcripts correlated closely with IFN-{alpha} production in atheroma tissue, indicating a possible role for TLR9 in the activation of plaque-residing pDCs (r=0.83, P<0.0001; Figure 3B). To assess whether TLR9 in the lesion mediates responses to PAMPs, we stimulated plaque tissue with the macromolecule CpG ODN. Twenty-four fresh tissues from 6 lipid-rich plaques were examined in organ culture. Two tissue pieces from each plaque were randomly selected for stimulation with CpG ODN (n=12), and 2 pieces from each served as controls (n=12). CpG ODN stimulation resulted in a 2.5-fold increase of IFN-{alpha} mRNA levels compared with unstimulated control tissue (P=0.03; Figure 3C). In addition, IFN-{alpha} concentrations secreted into the supernatant were significantly higher in the CpG ODN–stimulated tissues (P=0.007; Figure 3D). In contrast, CpG ODN stimulation of stable plaques failed to induce IFN-{alpha} secretion (n=12 per group; P=0.57).


Figure 3179633
View larger version (48K):
[in this window]
[in a new window]

 
Figure 3. The TLR9 ligand CpG ODN induces IFN-{alpha} in the atherosclerotic plaque. Frozen sections from carotid atherosclerotic plaques were stained with anti-TLR9 antibody (A; DAB, brown, magnification x200, bar=200 µm). IFN-{alpha} and TLR9 transcript levels were determined by quantitative RT-PCR in extracts from 26 carotid endarterectomy samples (B). Tissue pieces from soft lipid-rich carotid plaques were cultured in the absence or presence of 100 µg/mL synthetic CpG ODN for 24 hours (n=12 per group). IFN-{alpha} mRNA production was measured in tissue extracts by quantitative RT-PCR (C). IFN-{alpha} release was determined in culture supernatants by enzyme-linked immunosorbent assay (D). Box plots were used for data presentation as described in Figure 2.

IFN-{alpha} Induces TRAIL on CD4 T Cells
CD4 T cells are the dominant lymphocyte population in the atheroma, and IFN-{alpha} may modulate their function by affecting TRAIL surface expression.24 IFN-{alpha}–producing cells and T cells were typically positioned in close vicinity (Figure 4A, 4B). Examining 30 endarterectomy samples for TRAIL and IFN-{alpha} transcript levels revealed a close correlation of both markers (r=0.67, P<0.0001; Figure 4C). In addition, plaque tissue activation with CpG ODN was associated with a significant increase in TRAIL mRNA compared with unstimulated controls (n=12 per group) (P=0.004; Figure 4D).


Figure 4179633
View larger version (55K):
[in this window]
[in a new window]

 
Figure 4. IFN-{alpha}–induced TRAIL expression. Stains of serial sections showed the mapping of IFN-{alpha}–producing cells (A; brown) and T cells to the same area (B; brown; anti-CD3 antibody, both magnification x100 and x400 for insets, bars=250 µm). Atherosclerotic plaque tissues from 30 carotid endarterectomy samples were analyzed for IFN-{alpha} and TRAIL mRNA by quantitative RT-PCR (C). TRAIL transcript levels were determined in plaque tissues (n=12 per group) cultured for 24 hours in the absence (control) or presence of 100 µg/mL synthetic CpG. Results are given as box plots as described in Figure 2 (D). Peripheral blood lymphocytes from 31 ACS patients were activated by CD3 cross-linking (250 ng/mL) or by stimulation with IFN-{alpha} (200 U/mL). TRAIL surface expression on CD4+ T cells was measured by fluorescence-activated cell sorter. A representative histogram is shown in E. Fluorescence-activated cell sorter results for all 31 patients obtained with and without IFN-{alpha} are shown as mean±SD in F. Induction of TRAIL mRNA was measured by quantitative RT-PCR in 3 donors after 4-hour culture in the absence (control) and presence of 200 U/mL IFN-{alpha} (G).

Immunomodulatory effects of IFN-{alpha} in CD4 T cells were examined in peripheral blood CD4 T cells collected from 31 ACS patients. Two hours of stimulation was sufficient to upregulate TRAIL surface expression on CD4 T cells by 10-fold (P<0.0001; Figure 4E and 4F). Remarkably, IFN-{alpha} much more efficiently brought TRAIL to the T-cell surface than did triggering of the T-cell receptor through anti-CD3 antibody (Figure 4E). IFN-{alpha} exposure not only enhanced TRAIL surface expression, but it also markedly increased transcription of the TNF-like molecule (P=0.009; Figure 4G).

IFN-{alpha}–mediated TRAIL upregulation on CD4 T cells was not unique for ACS patients. Rather, peripheral blood CD4 T cells collected from age- and sex-matched controls responded similarly. However, IFN-{alpha}–induced TRAIL upregulation in plaque-derived CD4 T cells was more pronounced, with >90% of CD4 T cells positive for TRAIL (data not shown).

IFN-{alpha} Induces TRAIL-Mediated SMC Apoptosis
To explore the functional relevance of IFN-{alpha}–induced TRAIL expression on CD4 T cells, we investigated the death-inducing functions of such CD4 T cells. Coronary SMCs, which express the TRAIL receptor DR5, were chosen as targets. Plaque-derived CD4 T cells were added to coronary SMC monolayers for 4 hours at different effector to target ratios. CD4 T cells induced coronary SMC apoptosis very effectively (Figure 5A). Coronary SMC apoptosis was quantified by assessing the frequency of cells with typical nuclear changes of apoptosis through DAPI staining and by staining with the apoptosis membrane marker annexin. As shown in Figure 5B, coronary SMCs with intense DAPI staining of the nucleus double stained for annexin. IFN-{alpha} amplified CD4 T-cell killing ability at all effector to target ratios (P=0.002; Figure 5A). Incubating coronary SMCs with IFN-{alpha} alone did not induce apoptosis. Using peripheral CD4 T cells from 10 ACS patients, we found a consistent increase of coronary SMC apoptosis after pretreating CD4 T cells with IFN-{alpha} (P=0.0003; Figure 5C). Detection of apoptotic coronary SMCs by annexin confirmed enhanced coronary SMC apoptosis with IFN-{alpha}–pretreated CD4 T cells compared with untreated CD4 T cells (23±3.5% versus 15±2.6%; P=0.005). Apoptosis could be inhibited by blocking with a neutralizing antibody specific for TRAIL in a dose-dependent manner (P=0.0002; Figure 5D), documenting that CD4 T cells utilize TRAIL to trigger the SMC death pathway.


Figure 5179633
View larger version (38K):
[in this window]
[in a new window]

 
Figure 5. IFN-{alpha} enhances TRAIL-mediated apoptosis of coronary SMCs. CD4 T-cell lines were established from endarterectomy tissues, pretreated with IFN-{alpha} (black bars) or medium (open bars) for 2 hours, and cocultured with coronary SMC monolayers for 4 hours at varying effector-to-target ratios in triplicate. Cultures were examined by microscopy, and the frequencies of coronary SMCs with apoptotic nuclear changes were determined. Results from 1 of 3 experiments are shown as mean±SD (A). Typical nuclear changes detected with DAPI (blue) strongly correlated with annexin staining (green) (B). Peripheral blood CD4 T cells from 10 ACS patients were left untreated or were pretreated with IFN-{alpha} and then tested for their ability to induce coronary SMC apoptosis at an effector-to-target ratio of 20:1 (C). Increasing concentrations of neutralizing anti-TRAIL antibody ({diamond}) or isotype control antibody ({blacksquare}) were added to cocultures of IFN-{alpha}–pretreated CD4 T cells and coronary SMCs (D). Apoptotic rates are shown as mean±SD of triplicate cultures.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
CD4 T cells, the dominant type of lymphocytes in the atherosclerotic plaque,30 have powerful tissue-damaging functions. They are able to activate macrophages via IFN-{gamma},31,32 inducing the release of matrix-degrading proteases. CD4 effector cells also have the ability to directly kill plaque-residing cells, including ECs and VSMCs.7,8 T cells are generally controlled through TCRs by recognizing antigen, yet a unique subset of CD4 T cells characterized by CD28 loss can be activated independently from TCRs.5 In this report we provide data that IFN-{alpha} released in the plaque controls CD4 T-cell cytotoxic effector functions. The efficacy of IFN-{alpha} in rapidly modulating CD4 T-cell function is not only independent from antigen recognition; it also outperforms signals initiated by TCR cross-linking. Indeed, plaque-residing CD4 T cells are remarkably sensitive to the IFN-{alpha} action. IFN-{alpha} biases CD4 T cells toward harming matrix-producing and structure-stabilizing VSMCs and thus emerges as a critical contributor to plaque instability.

The innate cytokine IFN-{alpha} is released when DCs sense microbial products, mechanistically linking host infections and plaque destabilization. The ability of IFN-{alpha} to profoundly modulate T-cell effector functions immediately raises the question of the source of IFN-{alpha} in the plaque environment. Immunohistochemical studies (Figure 1) in the atheroma support the notion that pDCs are the dominant producer of IFN-{alpha}.33,34 Most plaque tissues contain IFN-{alpha}–producing pDCs preferentially located in the shoulder region. This observation is in accordance with recent data indicating that pDCs are not limited to lymphoid organs but are often encountered in inflamed skin or lung tissues.33,35 CCL5 and CCL3 abundantly expressed in atherosclerotic plaques10 may attract pDCs expressing their corresponding chemokine receptor CCR5.36 Whether DC recruitment reflects local infection or is a consequence of chronic inflammation remains to be investigated.

A close correlation between IFN-{alpha} and TLR9 transcripts indicated the relevance of TLR9 triggering for activating plaque pDCs. Upregulation of IFN-{alpha} transcripts and protein after stimulation of plaque explants with the TLR9 ligand CpG ODN confirmed the functional relevance of TLR9 triggering for activation of IFN-{alpha}–producing cells in the intact tissue. With regard to human pathogens, viruses such as herpes simplex virus type 1, cytomegalovirus, and influenza virus stimulate pDCs to produce IFN-{alpha} via well-understood signaling pathways involving myeloid differentiation factor 88 and IFN regulatory factor 7.34,37,38 IFN-{alpha} production also plays a critical role in response to bacterial infections.39 The sensitivity of IFN-{alpha}–producing cells to multiple pathogens correlates well with the concept of the infectious burden, emphasizing the importance of numerous infections rather than the role of a single and specific pathogen.40 Multiple suspects have been found in the plaque,41–43 but data presented here would also allow systemic disease to modulate plaque inflammation. Circulating "danger" signals may trigger pDCs to produce IFN-{alpha}, potentially explaining the link between acute infections and inflammatory activation of vulnerable plaques.44

IFN-{alpha} released in close vicinity to lymphocytes in the atheroma effectively induced the expression of the apoptosis mediator TRAIL on CD4 T cells. Additional upregulation of TRAIL transcripts indicates that IFN-{alpha} not only induces surface expression of vesicle-stored TRAIL but also its transcription. As previously shown, CD4 T cells from ACS patients kill coronary SMCs in a TRAIL-dependent manner.8 In this report we demonstrate that IFN-{alpha} stimulation of CD4 T cells from ACS patients translates into even more pronounced coronary SMC apoptosis, a process that could be blocked by TRAIL-specific antibodies. Coronary SMCs abundantly express DR5 and are therefore susceptible to TRAIL.8 VSMC loss may result in structural weakening and rupture of the atheroma cap.26–28 Moreover, apoptotic VSMCs induce thrombin generation,45 accelerating the thrombotic occlusion of the artery.28 TRAIL may also induce apoptosis of other plaque-residing cells such as ECs.46 When the unique and powerful ability of IFN-{alpha} to induce TRAIL expression on CD4 T cells is considered, IFN-{alpha}–induced, T cell–mediated apoptosis of plaque-residing cells appears to be an important mechanism in plaque destabilization. The presence of IFN-{alpha}–producing pDCs in the plaque shoulder and the association of IFN-{alpha} transcript with plaque vulnerability emphasize the potential role of IFN-{alpha} in inducing plaque rupture. Immunoregulatory function for IFN-{alpha} in coronary artery disease is also suggested by the recent recognition that complications of coronary disease are markedly accelerated in systemic lupus erythematosus, a syndrome characterized by the overexpression of IFN-{alpha}.47,48

The association of immune effector functions critically involved in host protection, such as the potent antiviral and antitumor effects of IFN-{alpha} via TRAIL-mediated killing of tumor cells or infected cells,24 with tissue injury reemphasizes the ambiguity of immune effector pathways. The coexistence of protective and harmful immune functions raises concerns about the cost-benefit ratio of therapeutic interventions targeting such pathways. Enhancing TRAIL-dependent immune reactions in cancer and hepatitis C may indeed put patients with coexisting advanced atherosclerosis at risk for plaque instability.

Our data suggest a model of plaque injury in which pattern recognition receptors such as TLR9 respond to infectious molecular patterns from both viral and bacterial sources and amplify tissue-damaging immune responses in the inflamed plaque. By releasing IFN-{alpha}, pDCs not only enhance host protection, but they also enable tissue-injurious effector functions that threaten the tissue integrity of the plaque. This mechanism of tissue damage requires the presence of IFN-{alpha}–responsive CD4 T cells in the plaque and sensitivity by plaque-residing cells, including VSMCs and ECs, to TRAIL, a requirement that is met in unstable lesions. TLR9 ligands initiating a cascade of events leading to cellular loss in the plaque may be derived from local sources in the plaque but also from infections distant from the vessel wall lesion. Transient peaks in circulating PAMPs may be sufficient to trigger plaque inflammation and plaque disruption. Protection from plaque instability may therefore require shielding the host from infectious episodes. Similarly, targeting pathways relevant in the immune-mediated injury of the plaque holds the promise for novel therapeutic interventions.


*    Acknowledgments
 
The authors thank Tamela Yeargin for manuscript editing.

Sources of Funding

This work was funded in part by grants from the National Institutes of Health (RO1 AI 44142, R01 EY 11916, R01 HL 63919, and RO1 AG 15443) and a grant from "Fonds zur Foerderung der wissenschaftlichen Forschung" (J2236-B14).

Disclosures

None.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Falk E, Shah PK, Fuster V. Coronary plaque disruption. Circulation. 1995; 92: 657–671.[Free Full Text]

2. Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. N Engl J Med. 2005; 352: 1685–1695.[Free Full Text]

3. Libby P, Theroux P. Pathophysiology of coronary artery disease. Circulation. 2005; 111: 3481–3488.[Abstract/Free Full Text]

4. Naghavi M, Libby P, Falk E, Casscells SW, Litovsky S, Rumberger J, Badimon JJ, Stefanadis C, Moreno P, Pasterkamp G, Fayad Z, Stone PH, Waxman S, Raggi P, Madjid M, Zarrabi A, Burke A, Yuan C, Fitzgerald PJ, Siscovick DS, de Korte CL, Aikawa M, Juhani Airaksinen KE, Assmann G, Becker CR, Chesebro JH, Farb A, Galis ZS, Jackson C, Jang IK, Koenig W, Lodder RA, March K, Demirovic J, Navab M, Priori SG, Rekhter MD, Bahr R, Grundy SM, Mehran R, Colombo A, Boerwinkle E, Ballantyne C, Insull W Jr, Schwartz RS, Vogel R, Serruys PW, Hansson GK, Faxon DP, Kaul S, Drexler H, Greenland P, Muller JE, Virmani R, Ridker PM, Zipes DP, Shah PK, Willerson JT. From vulnerable plaque to vulnerable patient: a call for new definitions and risk assessment strategies: part I. Circulation. 2003; 108: 1664–1672.[Abstract/Free Full Text]

5. Raines EW. Antigen-independent targeting of long-lived CD4+ cytolytic T effector cells to lesions of atherosclerosis. Circ Res. 2006; 98: 434–436.[Free Full Text]

6. Nakajima T, Schulte S, Warrington KJ, Kopecky SL, Frye RL, Goronzy JJ, Weyand CM. T-cell-mediated lysis of endothelial cells in acute coronary syndromes. Circulation. 2002; 105: 570–575.[Abstract/Free Full Text]

7. Pryshchep S, Sato K, Goronzy JJ, Weyand CM. T cell recognition and killing of vascular smooth muscle cells in acute coronary syndrome. Circ Res. 2006; 98: 1168–1176.[Abstract/Free Full Text]

8. Sato K, Niessner A, Kopecky SL, Frye RL, Goronzy JJ, Weyand CM. TRAIL-expressing T cells induce apoptosis of vascular smooth muscle cells in the atherosclerotic plaque. J Exp Med. 2006; 203: 239–250.[Abstract/Free Full Text]

9. Lord RS, Bobryshev YV. Clustering of dendritic cells in athero-prone areas of the aorta. Atherosclerosis. 1999; 146: 197–198.[CrossRef][Medline] [Order article via Infotrieve]

10. Zhang X, Niessner A, Nakajima T, Ma-Krupa W, Kopecky SL, Frye RL, Goronzy JJ, Weyand CM. Interleukin 12 induces T-cell recruitment into the atherosclerotic plaque. Circ Res. 2006; 98: 524–531.[Abstract/Free Full Text]

11. Bobryshev YV, Lord RS. Mapping of vascular dendritic cells in atherosclerotic arteries suggests their involvement in local immune-inflammatory reactions. Cardiovasc Res. 1998; 37: 799–810.[Abstract/Free Full Text]

12. Yilmaz A, Lochno M, Traeg F, Cicha I, Reiss C, Stumpf C, Raaz D, Anger T, Amann K, Probst T, Ludwig J, Daniel WG, Garlichs CD. Emergence of dendritic cells in rupture-prone regions of vulnerable carotid plaques. Atherosclerosis. 2004; 176: 101–110.[CrossRef][Medline] [Order article via Infotrieve]

13. Edfeldt K, Swedenborg J, Hansson GK, Yan ZQ. Expression of toll-like receptors in human atherosclerotic lesions: a possible pathway for plaque activation. Circulation. 2002; 105: 1158–1161.[Abstract/Free Full Text]

14. Methe H, Kim JO, Kofler S, Weis M, Nabauer M, Koglin J. Expansion of circulating Toll-like receptor 4-positive monocytes in patients with acute coronary syndrome. Circulation. 2005; 111: 2654–2661.[Abstract/Free Full Text]

15. Xu XH, Shah PK, Faure E, Equils O, Thomas L, Fishbein MC, Luthringer D, Xu XP, Rajavashisth TB, Yano J, Kaul S, Arditi M. Toll-like receptor-4 is expressed by macrophages in murine and human lipid-rich atherosclerotic plaques and upregulated by oxidized LDL. Circulation. 2001; 104: 3103–3108.[Abstract/Free Full Text]

16. Michelsen KS, Doherty TM, Shah PK, Arditi M. TLR signaling: an emerging bridge from innate immunity to atherogenesis. J Immunol. 2004; 173: 5901–5907.[Abstract/Free Full Text]

17. Muhlestein JB, Anderson JL. Chronic infection and coronary artery disease. Cardiol Clin. 2003; 21: 333–362.[CrossRef][Medline] [Order article via Infotrieve]

18. Xu Q. Role of heat shock proteins in atherosclerosis. Arterioscler Thromb Vasc Biol. 2002; 22: 1547–1559.[Abstract/Free Full Text]

19. Miller YI, Chang MK, Binder CJ, Shaw PX, Witztum JL. Oxidized low density lipoprotein and innate immune receptors. Curr Opin Lipidol. 2003; 14: 437–445.[CrossRef][Medline] [Order article via Infotrieve]

20. Kadowaki N, Ho S, Antonenko S, de Waal Malefyt R, Kastelein RA, Bazan F, Liu Y-J. Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J Exp Med. 2001; 194: 863–870.[Abstract/Free Full Text]

21. Colonna M, Trinchieri G, Liu YJ. Plasmacytoid dendritic cells in immunity. Nat Immunol. 2004; 5: 1219–1226.[CrossRef][Medline] [Order article via Infotrieve]

22. Kadowaki N, Antonenko S, Lau JY, Liu YJ. Natural interferon alpha/beta-producing cells link innate and adaptive immunity. J Exp Med. 2000; 192: 219–226.[Abstract/Free Full Text]

23. Cella M, Facchetti F, Lanzavecchia A, Colonna M. Plasmacytoid dendritic cells activated by influenza virus and CD40L drive a potent TH1 polarization. Nat Immunol. 2000; 1: 305–310.[CrossRef][Medline] [Order article via Infotrieve]

24. Kayagaki N, Yamaguchi N, Nakayama M, Eto H, Okumura K, Yagita H. Type I interferons (IFNs) regulate tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) expression on human T cells: a novel mechanism for the antitumor effects of type I IFNs. J Exp Med. 1999; 189: 1451–1460.[Abstract/Free Full Text]

25. Michowitz Y, Goldstein E, Roth A, Afek A, Abashidze A, Ben Gal Y, Keren G, George J. The involvement of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) in atherosclerosis. J Am Coll Cardiol. 2005; 45: 1018–1024.[Abstract/Free Full Text]

26. Davies MJ, Richardson PD, Woolf N, Katz DR, Mann J. Risk of thrombosis in human atherosclerotic plaques: role of extracellular lipid, macrophage, and smooth muscle cell content. Br Heart J. 1993; 69: 377–381.[Abstract/Free Full Text]

27. Geng YJ, Libby P. Evidence for apoptosis in advanced human atheroma: colocalization with interleukin-1 beta-converting enzyme. Am J Pathol. 1995; 147: 251–266.[Abstract]

28. Bennett MR. Apoptosis of vascular smooth muscle cells in vascular remodelling and atherosclerotic plaque rupture. Cardiovasc Res. 1999; 41: 361–368.[Abstract/Free Full Text]

29. Depre C, Wijns W, Robert AM, Renkin JP, Havaux X. Pathology of unstable plaque: correlation with the clinical severity of acute coronary syndromes. J Am Coll Cardiol. 1997; 30: 694–702.[Abstract]

30. Benagiano M, Azzurri A, Ciervo A, Amedei A, Tamburini C, Ferrari M, Telford JL, Baldari CT, Romagnani S, Cassone A, D’Elios MM, Del Prete G. T helper type 1 lymphocytes drive inflammation in human atherosclerotic lesions. Proc Natl Acad Sci U S A. 2003; 100: 6658–6663.[Abstract/Free Full Text]

31. Liuzzo G, Goronzy JJ, Yang H, Kopecky SL, Holmes DR, Frye RL, Weyand CM. Monoclonal T-cell proliferation and plaque instability in acute coronary syndromes. Circulation. 2000; 101: 2883–2888.[Abstract/Free Full Text]

32. Liuzzo G, Vallejo AN, Kopecky SL, Frye RL, Holmes DR, Goronzy JJ, Weyand CM. Molecular fingerprint of interferon-gamma signaling in unstable angina. Circulation. 2001; 103: 1509–1514.[Abstract/Free Full Text]

33. Farkas L, Beiske K, Lund-Johansen F, Brandtzaeg P, Jahnsen FL. Plasmacytoid dendritic cells (natural interferon-alpha/beta-producing cells) accumulate in cutaneous lupus erythematosus lesions. Am J Pathol. 2001; 159: 237–243.[Abstract/Free Full Text]

34. Asselin-Paturel C, Trinchieri G. Production of type I interferons: plasmacytoid dendritic cells and beyond. J Exp Med. 2005; 202: 461–465.[Abstract/Free Full Text]

35. de Heer HJ, Hammad H, Soullie T, Hijdra D, Vos N, Willart MA, Hoogsteden HC, Lambrecht BN. Essential role of lung plasmacytoid dendritic cells in preventing asthmatic reactions to harmless inhaled antigen. J Exp Med. 2004; 200: 89–98.[Abstract/Free Full Text]

36. Diacovo TG, Blasius AL, Mak TW, Cella M, Colonna M. Adhesive mechanisms governing interferon-producing cell recruitment into lymph nodes. J Exp Med. 2005; 202: 687–696.[Abstract/Free Full Text]

37. Honda K, Yanai H, Negishi H, Asagiri M, Sato M, Mizutani T, Shimada N, Ohba Y, Takaoka A, Yoshida N, Taniguchi T. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature. 2005; 434: 772–777.[CrossRef][Medline] [Order article via Infotrieve]

38. Cella M, Jarrossay D, Facchetti F, Alebardi O, Nakajima H, Lanzavecchia A, Colonna M. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat Med. 1999; 5: 919–923.[CrossRef][Medline] [Order article via Infotrieve]

39. Decker T, Muller M, Stockinger S. The yin and yang of type I interferon activity in bacterial infection. Nat Rev Immunol. 2005; 5: 675–687.[CrossRef][Medline] [Order article via Infotrieve]

40. Shah PK. Link between infection and atherosclerosis: who are the culprits: viruses, bacteria, both, or neither? Circulation. 2001; 103: 5–6.[Free Full Text]

41. Benditt EP, Barrett T, McDougall JK. Viruses in the etiology of atherosclerosis. Proc Natl Acad Sci U S A. 1983; 80: 6386–6389.[Abstract/Free Full Text]

42. Chiu B, Viira E, Tucker W, Fong IW. Chlamydia pneumoniae, cytomegalovirus, and herpes simplex virus in atherosclerosis of the carotid artery. Circulation. 1997; 96: 2144–2148.[Abstract/Free Full Text]

43. Ott SJ, El Mokhtari NE, Musfeldt M, Hellmig S, Freitag S, Rehman A, Kuhbacher T, Nikolaus S, Namsolleck P, Blaut M, Hampe J, Sahly H, Reinecke A, Haake N, Gunther R, Kruger D, Lins M, Herrmann G, Folsch UR, Simon R, Schreiber S. Detection of diverse bacterial signatures in atherosclerotic lesions of patients with coronary heart disease. Circulation. 2006; 113: 929–937.[Abstract/Free Full Text]

44. Smeeth L, Thomas SL, Hall AJ, Hubbard R, Farrington P, Vallance P. Risk of myocardial infarction and stroke after acute infection or vaccination. N Engl J Med. 2004; 351: 2611–2618.[Abstract/Free Full Text]

45. Flynn PD, Byrne CD, Baglin TP, Weissberg PL, Bennett MR. Thrombin generation by apoptotic vascular smooth muscle cells. Blood. 1997; 89: 4378–4384.[Abstract/Free Full Text]

46. Li JH, Kirkiles-Smith NC, McNiff JM, Pober JS. TRAIL induces apoptosis and inflammatory gene expression in human endothelial cells. J Immunol. 2003; 171: 1526–1533.[Abstract/Free Full Text]

47. Karrar A, Sequeira W, Block JA. Coronary artery disease in systemic lupus erythematosus: a review of the literature. Semin Arthritis Rheum. 2001; 30: 436–443.[CrossRef][Medline] [Order article via Infotrieve]

48. Bennett L, Palucka AK, Arce E, Cantrell V, Borvak J, Banchereau J, Pascual V. Interferon and granulopoiesis signatures in systemic lupus erythematosus blood. J Exp Med. 2003; 197: 711–723.[Abstract/Free Full Text]


 

CLINICAL PERSPECTIVE

The immune system employs dendritic cells (DCs) to sense infections. Binding of microbial DNA motifs, so-called unmethylated CpG-containing oligodeoxynucleotides, by toll-like receptor 9 alerts plasmacytoid DCs (pDCs) and initiates immune responses. This article reports that pDCs populate inflamed atherosclerotic plaques, in which they preferentially sit in the shoulder region. When triggered with CpG-containing oligodeoxynucleotides, plaque-residing pDCs release high amounts of interferon-{alpha} (IFN-{alpha}), which induces neighboring T lymphocytes to express tumor necrosis factor–related apoptosis-inducing ligand (TRAIL), a member of the tumor necrosis factor superfamily with potent apoptosis-inducing capability. TRAIL-expressing T cells function as killer cells that trigger death receptors on vascular smooth muscle cells and thus can facilitate plaque destabilization. This study connects the function of innate immune cells (pDCs) with those of the adaptive immune system (T cells) in the atherosclerotic plaque and provides a mechanism through which antimicrobial immune responses induce unintended tissue damage and plaque destruction. IFN-{alpha} has also emerged as a biomarker in patients with chronic autoimmune syndromes, such as systemic lupus erythematosus, and IFN-{alpha}–mediated hyperstimulation of cytotoxic T-cell function may represent an important mechanistic link between immune dysfunction and accelerated atherosclerosis in autoimmune patients.


*    Footnotes
 
The online-only Data Supplement, consisting of a table and a figure, is available with this article at http://circ.ahajournals.org/cgi/content/full/CIRCULATIONAHA.106.642801/DC1.




This article has been cited by other articles:


Home page
haematolHome page
F. Angelot, E. Seilles, S. Biichle, Y. Berda, B. Gaugler, J. Plumas, L. Chaperot, F. Dignat-George, P. Tiberghien, P. Saas, et al.
Endothelial cell-derived microparticles induce plasmacytoid dendritic cell maturation: potential implications in inflammatory diseases
Haematologica, November 1, 2009; 94(11): 1502 - 1512.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. J. Schulte, A. Yilmaz, K. Shimada, M. C. Fishbein, E. L. Lowe, S. Chen, M. Wong, T. M. Doherty, T. Lehman, T. R. Crother, et al.
Involvement of Innate and Adaptive Immunity in a Murine Model of Coronary Arteritis Mimicking Kawasaki Disease
J. Immunol., October 15, 2009; 183(8): 5311 - 5318.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
L. Shao, H. Fujii, I. Colmegna, H. Oishi, J. J. Goronzy, and C. M. Weyand
Deficiency of the DNA repair enzyme ATM in rheumatoid arthritis
J. Exp. Med., June 8, 2009; 206(6): 1435 - 1449.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
A. Niessner, P. J. Hohensinner, K. Rychli, S. Neuhold, G. Zorn, B. Richter, M. Hulsmann, R. Berger, D. Mortl, K. Huber, et al.
Prognostic value of apoptosis markers in advanced heart failure patients
Eur. Heart J., April 1, 2009; 30(7): 789 - 796.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Yilmaz and M. Arditi
Giant Cell Arteritis: Dendritic Cells Take Two T's to Tango
Circ. Res., February 27, 2009; 104(4): 425 - 427.
[Full Text] [PDF]


Home page
Circ. Res.Home page
J. Deng, W. Ma-Krupa, A. T. Gewirtz, B. R. Younge, J. J. Goronzy, and C. M. Weyand
Toll-Like Receptors 4 and 5 Induce Distinct Types of Vasculitis
Circ. Res., February 27, 2009; 104(4): 488 - 495.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Bobik
Secretory phospholipase A2 type IIA: a regulator of immune function in atherosclerosis?
Cardiovasc Res, January 1, 2009; 81(1): 9 - 10.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
I. E. Dumitriu, E. T. Araguas, C. Baboonian, and J. C. Kaski
CD4+CD28null T cells in coronary artery disease: when helpers become killers
Cardiovasc Res, January 1, 2009; 81(1): 11 - 19.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. M. Kavurma, N. Y. Tan, and M. R. Bennett
Death Receptors and Their Ligands in Atherosclerosis
Arterioscler Thromb Vasc Biol, October 1, 2008; 28(10): 1694 - 1702.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
O. Pryshchep, W. Ma-Krupa, B. R. Younge, J. J. Goronzy, and C. M. Weyand
Vessel-Specific Toll-Like Receptor Profiles in Human Medium and Large Arteries
Circulation, September 16, 2008; 118(12): 1276 - 1284.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. M. Kavurma, M. Schoppet, Y. V. Bobryshev, L. M. Khachigian, and M. R. Bennett
TRAIL Stimulates Proliferation of Vascular Smooth Muscle Cells via Activation of NF-{kappa}B and Induction of Insulin-like Growth Factor-1 Receptor
J. Biol. Chem., March 21, 2008; 283(12): 7754 - 7762.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. W. Han, K. Shimada, W. Ma-Krupa, T. L. Johnson, R. M. Nerem, J. J. Goronzy, and C. M. Weyand
Vessel Wall-Embedded Dendritic Cells Induce T-Cell Autoreactivity and Initiate Vascular Inflammation
Circ. Res., March 14, 2008; 102(5): 546 - 553.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. Niessner, M. S. Shin, O. Pryshchep, J. J. Goronzy, E. L. Chaikof, and C. M. Weyand
Synergistic Proinflammatory Effects of the Antiviral Cytokine Interferon-{alpha} and Toll-Like Receptor 4 Ligands in the Atherosclerotic Plaque
Circulation, October 30, 2007; 116(18): 2043 - 2052.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. F. Denny, S. Thacker, H. Mehta, E. C. Somers, T. Dodick, F. J. Barrat, W. J. McCune, and M. J. Kaplan
Interferon-{alpha} promotes abnormal vasculogenesis in lupus: a potential pathway for premature atherosclerosis
Blood, October 15, 2007; 110(8): 2907 - 2915.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
H. Methe and M. Weis
Atherogenesis and inflammation--was Virchow right?
Nephrol. Dial. Transplant., July 1, 2007; 22(7): 1823 - 1827.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
114/23/2482    most recent
CIRCULATIONAHA.106.642801v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Niessner, A.
Right arrow Articles by Weyand, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Niessner, A.
Right arrow Articles by Weyand, C. M.
Related Collections
Right arrow Apoptosis
Right arrow Pathophysiology
Right arrow Acute coronary syndromes
Right arrow Mechanism of atherosclerosis/growth factors