| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2006;113:1203-1212.)
© 2006 American Heart Association, Inc.
Heart Failure |
From the Departments of Cardiology, Campus Virchow Clinic, Charité, Humboldt University, and Franz-Volhard Clinic, HELIOS GmbH, Berlin, Germany (S.D., P.L., N.A., R.D., R.v.H.); Max-Delbrück Center for Molecular Medicine, Berlin, Germany (S.D., V.G., T.W., M.B., R.v.H.); Department of Cardiology and Angiology, Hannover Medical School, Hannover, Germany (C.W., K.C.W.); Leibniz Research Laboratories for Biotechnology and Artificial Organs, Department of Thoracic and Cardiovascular Surgery, Hannover Medical School, Hannover, Germany (U.M.); and Department of Internal Medicine I, Julius-Maximilians University, Würzburg, Germany (J.B.).
Correspondence to Rüdiger von Harsdorf, MD, FRCPS, Associate Professor of Medicine, Division of Cardiology, University Health Network, 200 Elizabeth St, MaRS 3-908, Toronto, ON, M5G 2C4, Canada. E-mail rudiger.vonharsdorf{at}uhn.on.ca
Received July 19, 2005; revision received December 3, 2005; accepted December 21, 2005.
| Abstract |
|---|
|
|
|---|
Methods and Results We generated ARC-deficient mice, which developed normally to adulthood and had no abnormality in cardiac morphology and function under resting conditions. On biomechanical stress induced by aortic banding, ARC-deficient mice developed accelerated cardiomyopathy compared with littermate controls, which was characterized by reduced contractile function, cardiac enlargement, and myocardial fibrosis. Likewise, ischemia/reperfusion injury of ARC-deficient mice resulted in markedly increased myocardial infarct sizes. Although in both instances a significant increase in apoptotic cardiomyocytes could be observed in ARC-deficient mice, neither in vitro nor in vivo studies revealed any effect of ARC on classic hypertrophic cardiomyocyte growth responses. The pathophysiological relevance of downregulated ARC levels was underscored by specimens from failing human hearts showing markedly reduced ARC protein levels.
Conclusions Our study identifies a tissue-specific antiapoptotic factor that is downregulated in human failing myocardium and that is required for cardioprotection in pressure overload and ischemia.
Key Words: apoptosis heart failure hypertrophy ischemia myocardial infarction
| Introduction |
|---|
|
|
|---|
Clinical Perspective p 1212
When the limited capacity of terminally differentiated cardiac myocytes for proliferation is considered, however, it is important to understand how these cell death-promoting and inhibiting signaling mechanisms are activated in heart disease to establish interventions that can effectively prevent cardiac cell loss and thereby preserve cardiac performance.8
Apoptosis repressor with caspase recruitment domain (ARC) is highly and predominantly expressed in long-lived tissues like heart, skeletal muscle, and brain.9 ARC selectively interacts with the initiator caspases-2 and -8 and thereby attenuates death receptor-induced (CD95, TNFR1, DR3) or adaptor-induced (FADD, TRADD, CLARP) apoptosis.9 Gustafsson et al10 demonstrated that ARC also prevents cytochrome c release and subsequent cell death independently of caspase inhibition by interfering with Bax activation. Inhibition of both the extrinsic and intrinsic death pathways is mediated through nonhomotypic deathfold interactions.11 We have recently shown that the antiapoptotic effect of ARC depends on its phosphorylation at T149 by CK2.12 Notably, under physiological conditions ARC is predominantly phosphorylated, indicating the biological relevance of functional antiapoptotic ARC.12 Hence, the specific interference with both the death receptor and mitochondrial death pathway, as well as its high cardiac expression, makes ARC a unique and central cardiac death repressor. This is supported by the observation that exogenous ARC reduces infarct size after ischemia/reperfusion (I/R) injury of isolated perfused rat hearts and blocks the development of postischemic cardiomyopathy.13,14 Despite several overexpression studies on ARC, little is known about its endogenous function. However, this is of particular significance because exposure of cardiomyocytes to ischemia, hypoxia, or oxidative stress leads to a rapid downregulation of ARC protein levels with subsequent cell death in vitro, suggesting that decreasing ARC levels may function as a critical switch of cardiomyocyte survival.11
In this study we attempted to elucidate the physiological role of ARC and to understand pathophysiological consequences resulting from its deletion in the ARC knockout mouse model.
| Methods |
|---|
|
|
|---|
Human Heart Samples
Cardiac specimens are derived from patients who underwent cardiac transplantation for terminal heart failure of ischemic and nonischemic origin. Control samples came from unused donor hearts without evidence of cardiac disease. All human heart samples were snap-frozen from explanted hearts. All procedures were approved by government authorities.
Histological Examination and Immunohistochemistry
In brief, hearts were arrested in diastole by injection of 0.15 mL cadmium chloride (100 mmol/L), fixed in 4% paraformaldehyde overnight, and immersed in 30% sucrose for cytoprotection. Sections were stained with hematoxylin-eosin or Massons trichrome to detect fibrosis in heart sections. Myocyte cross-sectional area was measured by tracing the outline of 150 to 200 myocytes per 1-µm-thick silver-stained methacrylate section. Activated Bax (1:50 dilution, anti-Bax NT, rabbit polyclonal, Upstate) was detected with the use of diaminobenzidine substrate and horseradish peroxidase.
Evaluation of Apoptosis
To determine the frequency of cardiac myocyte apoptosis, we used an in situ DNA ligase method.15 Briefly, fixed myocardial sections were incubated overnight with a ligation buffer containing biotin-labeled hairpin oligonucleotides. Apoptotic DNA strand breaks were detected with the use of a fluorescein isothiocyanate (FITC)avidin conjugate. Sections were counterstained with the nucleic acid-binding dye DAPI. To distinguish cardiac myocytes from nonmyocyte cell types, we labeled the sections with a primary anti-sarcomeric
-actinin antibody (1:500 dilution; Sigma) and subsequently with a TRITC-conjugated secondary antibody (1:100 dilution; Sigma). Sections were analyzed with a x40 objective with the use of fluorescence microscopy. Only those nuclei that were labeled with the ligase technique and were identified as cardiac myocytes were included in our quantification of cardiac myocyte apoptosis. Three transverse sections spaced through the heart were analyzed for each animal. Results were confirmed by a nonfluorescent terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay.
Echocardiographic Assessment
A 2-dimensional short-axis view of the left ventricle (LV) was obtained with a 12-MHz transducer (Acuson Sequoia, Erlangen, Germany) in anesthetized mice. M-mode tracings were recorded and used to determine LV end-diastolic (LVEDD) and LV end-systolic (LVESD) internal dimensions and interventricular septum thickness in diastole (IVSD) and posterior wall thickness in diastole (PWD). Fractional shortening was calculated by the following equation: [(LVEDDLVESD)/LVEDD]x100. M-mode tracings were recorded and analyzed by a sample-blinded investigator.
Animal Models of Myocardial Infarction and Pressure Overload
I/R injury and evaluation of the infarct size were done as described.16 Transverse aortic banding (TAB) and pressure gradient measurements were performed with minor modifications as described.17 In brief, male 8-week-old mice were anesthetized and intubated. Mice were artificially ventilated with a mixture of oxygen and isoflurane (1.5% to 2.0%) with the use of a rodent ventilator (UB 7025 rodent ventilator, Hugo Sachs Elektronik, March, Germany). A nylon suture was placed around a 27-gauge hypodermic needle to constrict the aortic arch. Three weeks after TAB, mice were anesthetized, intubated, and artificially ventilated. To measure arterial pressure, a high-fidelity catheter tip transducer (1.4F; Millar Instruments Inc, Houston, Tex) was first inserted into the right carotid artery and then left carotid artery. The pressure in both carotid arteries was measured, and the pressure gradient between carotid arteries was calculated.
Quantitative Real-Time PCR
RNA was isolated from LV apexes with the use of TRIzol reagent (Invitrogen). After DNase I treatment, 0.5 µg RNA was reverse-transcribed with the use of Superscript III (Invitrogen). A hot start real-time PCR with the use of QuantiTect SYBR Green PCR Master Mix (Qiagen) was performed in triplicate on an iCycler (BioRad). Specific primers for fetal cardiac genes were designed as published.18 The sequences of ARC primers were 5'TCTAAAGAGGCTGAACCGGAGCC3' and 5'CTTCAGGAATCTTCGGACTCGTC3'. All reverse transcriptase-PCR reactions gave a single band when analyzed by gel electrophoresis. The specific mRNA content for each gene was normalized to the mRNA content of GAPDH (fetal genes) or 28S (ARC) and expressed relative to the healthy control.
Statistical Analysis
Results are presented as mean±SEM. Statistical comparisons were performed with 1-way or 2-way ANOVA or ANOVA on ranks with Tukey or Dunn posttest. A probability value of <0.05 was considered significant.
The authors had full access to the data and take responsibility for its integrity. All authors have read and agree to the manuscript as written.
| Results |
|---|
|
|
|---|
|
Under resting conditions, there were no significant differences in heart weight, body weight, heart weight/body weight ratio, and single LV cardiomyocyte cross-sectional area of 12-week-old ARC/ and WT animals (Figures 2B and 3
B). ARC/ hearts showed no cardiac morphological defects, nor did a histological examination with hematoxylin/eosin or Massons trichrome staining demonstrate evidence of myofibrillar disarray, necrosis, or ventricular fibrosis (Figure 4B and 4C). Other tissues with abundant ARC expression like skeletal muscle and brain appeared also morphologically and histologically indistinguishable between ARC/ and WT mice (data not shown). Finally, under normal living conditions, ARC/ mice displayed neither hypertrophy nor failure of the heart after a 9-month follow-up.
|
|
|
Mice Lacking ARC Are Prone to Cardiac Decompensation After Biomechanical Stress of Pressure Overload
In the myocardium, chronic ischemic or mechanical stress results in the activation of maladaptive signaling events, leading to cardiomyocyte hypertrophy, myocardial fibrosis, and eventually heart failure.19 To analyze whether ARC contributes to a preservation of the cardiac phenotype during the biomechanical stress response, we used a microsurgical approach to induce cardiac hypertrophy in vivo by pressure overload after TAB.17
At 4 weeks of TAB, myocardial enlargement was more pronounced in ARC/ mice than in WT littermates (Figure 2A and 2D). On the basis of LV wall thickness, a comparable degree of LV hypertrophy was seen 2 weeks after TAB in WT and ARC/ banded hearts (data not shown). However, at 4 weeks after TAB, hearts from ARC/ mice displayed accelerated LV dilatation compared with only modestly dilated LV of WT banded hearts (Figure 2A and 2D). There was no significant difference between ARC/ mice and WT controls in the heart weight/body weight ratio after TAB (Figure 2B). However, the lung weight/body weight ratio, an index of pulmonary congestion and LV dysfunction, was significantly elevated in hearts from ARC/ banded mice compared with unbanded controls and knockouts, whereas hearts from banded WT mice showed no significant change (ARC/ TAB versus WT sham or ARC/ sham, P<0.05; Figure 2B). Dilated cardiomyopathy is characterized by the reinduction of a fetal gene profile in the ventricular myocardium.20 In this regard, natriuretic peptides are considered highly sensitive markers of cardiac stress and often correlate with the degree of cardiac dysfunction.20 Banded hearts from WT mice showed a moderate induction of atrial natriuretic peptide (ANP) and B-type natriuretic peptide (BNP) after TAB (by a factor of 11.2 and 2.3, respectively; Figure 2C). In contrast, the gene induction was markedly more pronounced in banded hearts from ARC/ mice (by a factor of 15.4 and 6.2, respectively), showing statistical significance for BNP (ARC/ TAB versus WT TAB, P<0.01; Figure 2C). Other fetal genes implicated in hypertrophy such as
-myosin heavy chain and skeletal actin showed no differential regulation (Figure 2C). Because a defining character of the pathophysiological transition from hypertrophy to heart failure is decreased cardiac contractility, we measured fractional shortening, an echocardiographic index of LV systolic function. Even though the aortic gradients were comparable between banded WT and ARC/ mice (66±11 mm Hg for WT, 68±10 mm Hg for ARC/), fractional shortening measured 4 weeks after TAB was significantly reduced in ARC/ banded mice compared with WT banded mice (ARC/ TAB versus WT TAB, P<0.01; Figure 2D). In addition, hearts from ARC/ mice displayed a significantly greater dilatation than WT mice, as shown by significant increases in LVESD and LVEDD (ARC/ TAB versus WT TAB, P<0.05; Figure 2D). Collectively, these findings indicate that ARC is needed to prevent pressure overload-induced deterioration of LV remodeling with cardiac dysfunction and overt heart failure.
ARC Does Not Affect Classic Hypertrophic Growth Responses
To evaluate whether the decompensation of ARC/ mice after TAB resulted from an altered cardiac growth response, we analyzed cardiac hypertrophy at the cellular level. Neither the change in myocyte cross-sectional area in hearts from ARC/ mice at 4 weeks of TAB (108±15 to 210±8 µm2 for WT and 99±13 to 223±2 µm2 for ARC/; WT versus ARC/, P>0.05; Figure 3A and 3B) nor single cardiomyocyte length differed from that seen in WT mice (95±1 µm for WT sham, 98±2 µm for ARC/ sham, 107±3 µm for WT TAB, 111±2 µm for ARC/ TAB; WT versus ARC/, P>0.05; Figure 3C). Furthermore, neonatal rat cardiomyocytes transfected with AdARC or control virus showed no differences in terms of sarcomere organization, surface area, and protein synthesis in a model of angiotensin II-induced hypertrophy (Figure 3D to 3F). Functional ARC levels were confirmed by an in vitro model of ischemia-induced cardiomyocyte death (Figure 3G).
Loss of ARC Mediates Progression to Overt Heart Failure by Apoptosis and Myocardial Fibrosis After Mechanical Stress
It has been reported that LV remodeling is associated with increased cardiac myocyte death.21 We examined the effect of ARC ablation on apoptosis induced by TAB (Figure 4A). Two weeks after TAB, the frequency of myocyte apoptosis was significantly increased in ARC/ banded hearts compared with WT banded hearts (WT, 10.2±2.8; ARC/, 25.5±3.8; P<0.01). The fact that increases in apoptotic myocytes were observed even before the animals manifest signs of heart failure suggests that increases in cardiac myocyte death may contribute at least in part to the deterioration of heart failure.
Acute or chronic loss of cardiac myocytes can result in LV replacement fibrosis. Histological analysis demonstrated marked intermuscular fibrosis in ARC/ banded hearts compared with banded WT animals (Figure 4B and 4C). These histological findings were supported by a significant increase in the expression level of transforming growth factor-ß (TGF-ß), a cytokine of major importance in the pathogenesis of myocardial fibrosis, in ARC/ hearts after TAB (Figure 4D).
Loss of ARC Increases Myocardial Infarctions After I/R Injury
Next, we evaluated the pathophysiological consequences of ARC ablation on infarct size and myocardial viability after ischemic stress. At the conclusion of reperfusion, the sizes of the area at risk and myocardial infarction were quantified with the use of Evans blue and 2,3,5-triphenyltetrazolium chloride staining. Figure 5A depicts representative stained sections from WT and ARC/ mice after I/R in vivo. Despite similar regions at risk, ARC/ hearts showed a markedly enlarged area of infarction compared with WT hearts (WT, 24.9±2.3%; ARC/, 37.8±1.8%; P<0.01). The mean infarct size of ARC/ mice was increased by 52.2% compared with WT animals.
|
ARC Exerts Cardioprotection by Inhibition of the Mitochondrial Death Pathway During I/R
We investigated whether ARC signaling is important to protect cardiomyocytes from apoptosis and thereby contributes to a smaller infarct size after I/R. Animals of both genotypes subjected to I/R show a typical DNA laddering (Figure 5B). However, DNA ladders of ARC/ mice were more intense, indicating a higher amount of apoptosis. Quantification of apoptosis was performed by the in situ DNA ligase method (Figure 5C and 5D). Consistent with the DNA ladder assay, no apoptosis was seen in WT and ARC/ mice under basal conditions. In both genotypes I/R was followed by a marked increase of apoptotic cardiomyocytes. Notably, myocardial sections from ARC/ mice showed a 2.5-times higher frequency of apoptosis than those of WT animals (WT, 92.5±19.2; ARC/, 249.5±46.5; P=0.018).
During exposure to ischemia and/or reperfusion, cellular fate ultimately depends on mitochondrial signaling. Bax is a crucial mediator of the mitochondrial apoptotic pathway, and its conformational activation is inhibited by several proteins, including ARC.10,11 We assessed activation of Bax using an antibody that preferentially recognizes the active conformation of Bax.10 Consistent with larger myocardial infarctions and increased apoptotic frequencies, immunohistochemistry from ARC/ hearts showed a marked activation of Bax compared with WT hearts after I/R (Figure 5E). Thus, endogenous ARC exerts cardioprotection by its antiapoptotic function that is mediated at least in part by inhibition of Bax activation during I/R.
ARC Protein Is Downregulated in End-Stage Human Heart Failure
To obtain a better understanding of the pathophysiological role of ARC in heart disease, protein and mRNA from healthy controls with normal LV function and patients with end-stage heart failure were analyzed for ARC expression. As depicted in Figure 6A and 6B, Western blot analysis demonstrated a 36.7% decrease of ARC protein expression in hearts from human heart failure patients (control, 151.8±3.2 OD; heart failure, 96.3±8.6 OD; P=0.012). Because of the limited number of heart failure samples, a subdivision in ischemic (n=1), nonischemic (n=4), and unknown (n=1) etiology did not allow a valid subgroup analysis for differences in ARC expression. In contrast, ARC mRNA expression did not differ between healthy and terminal heart failure patients, indicating posttranscriptional regulation (Figure 6C).
|
| Discussion |
|---|
|
|
|---|
Previous reports have documented the antiapoptotic function of exogenous ARC in vitro and in vivo.914 Because ARC also inhibits oncotic cell death, apoptosis was detected by DNA ladder assay and in situ DNA ligase assay, which is thought to be more specific for apoptosis than TUNEL assay.15 Notably, no spontaneous apoptosis was detected in ARC/ mice under physiological conditions. In contrast, biomechanical and ischemic stress led to markedly increased numbers of apoptotic cardiac nuclei in hearts from ARC/ compared with WT controls. Although the frequency of cardiac cell death detected in banded hearts from ARC/ mice is quite low, it is 2.5-fold higher than that observed in banded WT hearts and 100-fold higher than in healthy WT hearts. Similar apoptotic rates were measured in the decompensated human heart.4 Furthermore, Wencker et al5 reported that apoptotic rates of 23 cardiac nuclei per 105 nuclei are sufficient to induce lethal, dilated cardiomyopathy. The fact that increases in apoptotic myocytes were observed even before the animals manifest overt signs of heart failure implies that augmented cardiomyocyte death mediated the progression to cardiac dysfunction and failure seen in ARC/ mice. This hypothesis is supported by studies that document progressive cardiomyocyte apoptosis before the development of adaptive hypertrophy in early pressure overload.22,23 Two other studies linked cardiomyocyte apoptosis to the development of decompensated heart failure.7,24 Biomechanical stress of gp130 knockouts resulted in rapid-onset dilated cardiomyopathy, and female mice overexpressing G
q developed lethal, dilated cardiomyopathy within 1 week after delivery.7,24 Because both gp130- and G
q-dependent signaling also affects cardiac growth pathways, the role of cardiomyocyte apoptosis in heart failure has been a matter of debate.25,26 The results of the present study shed new light on this discussion. Although we cannot fully exclude the possibility that ARC may affect adaptive growth responses in the heart, according to our in vivo and in vitro results, ARC appears to have no effect on classic cardiac hypertrophic signaling. The combined effects on compensatory growth mechanisms and antiapoptotic signaling may explain the severe and lethal cardiomyopathies observed with the gp130- and G
q-manipulated mice compared with the rather moderate heart failure phenotype of the ARC/ mouse. Our results indicate that loss of antiapoptotic signaling itself can result in progressive cardiac myocyte apoptosis, which in turn leads to accelerated ventricular dilatation, replacement fibrosis, and failure in response to pressure overload. We can only speculate on the mechanism by which increased susceptibility to apoptosis leads to increased expression of natriuretic peptides. As stated in the review by Dorn et al,20 natriuretic peptides such as ANP and BNP do not necessarily represent hypertrophy markers but rather are markers of cardiac dysfunction. We hypothesize that increased wall stress resulting from enhanced apoptosis and ventricular dilatation in ARC-null mice after TAB might lead to forced transcription of natriuretic peptides. Importantly, not all cells showing apoptotic changes die immediately. Evidence was found that during the apoptotic process deterioration in systolic function may precede any breakdown of DNA or irreversible cell death.27 This phenomenon could explain upregulated cardiac stress markers in myocardial tissues with increased susceptibility to apoptosis.
I/R-induced cardiomyocyte apoptosis has been shown in both human heart disease and experimental animal models.3,28,29 The experimental findings here show a correlation between an increase in the frequency of apoptosis and the extent of myocardial infarct size. Accordingly, we speculate that in our model, enhanced cardiac myocyte apoptosis contributed significantly to markedly increased infarct size in ARC knockout mice compared with infarcts of WT control mice. Quantification of apoptosis and oncosis 2 hours after ongoing ischemia by Anversa et al29 yielded 30-fold higher levels of apoptosis. Reperfusion greatly enhances the occurrence of apoptosis.28 Ultimately, cellular fate depends on mitochondrial signaling during exposure to ischemia and/or reperfusion. Depending on conditions, mitochondria promote both apoptosis by the mitochondrial death pathway and oncosis by irreversible damage to mitochondria in association with mitochondrial permeability transition. Sustained Bax activation in ARC-depleted mice detected after reperfusion suggests the activation of the mitochondrial death pathway. Bax plays a critical role in I/R injury, as illustrated by a 50% reduction in infarct size and a 10-fold decrease in myocyte apoptosis exhibited by hearts from Bax knockout mice.30
Unexpectedly, but similar to the results from knockout mice of other ubiquitously expressed antiapoptotic factors, ARC-null mice developed no basal cardiac phenotype during 9 months of follow-up.31,32 Furthermore, gross behavioral observations and histological analyses of sections from brain and skeletal muscle yielded no significant differences between both genotypes. This suggests that either ARC plays no role under resting conditions or loss of ARC is compensated by other mechanisms, which may suffice for basal but not for stress conditions. Thus, substantially reduced ARC protein levels in human failing hearts may be an initiating event rather than a consequence of the resulting cell death. Despite the fact that both gene-targeted animal and cell culture models have obvious limitations, it is tempting to speculate that reduced ARC protein levels detected in end-stage heart failure patients might represent a causal component of pathogenesis. Further investigation will be necessary for a precise molecular characterization of the role of ARC during the development of heart failure. Future studies will also have to test the role of the splice variants of ARC on growth signaling and apoptosis in more detail.
The critical role of endogenous ARC during biomechanical and ischemic stress provides a strong rationale for therapeutic interventions that focus on the central death pathways. The possibility exists that manipulation of ARC-mediated myocyte survival pathways represents a novel therapeutic strategy for promoting and maintaining cardiac myocyte function in response to myocardial stress.
| Acknowledgments |
|---|
Disclosures
None.
| References |
|---|
|
|
|---|
2. Benjamin IJ, Schneider MD. Learning from failure: congestive heart failure in the postgenomic age. J Clin Invest. 2005; 115: 495499.[CrossRef][Medline] [Order article via Infotrieve]
3. Olivetti G, Abbi R, Quaini F, Kajstura J, Cheng W, Nitahara JA, Quaini E, Di Loreto C, Beltrami CA. Krajewski S, Reed JC, Anversa P. Apoptosis in the failing human heart. N Engl J Med. 1997; 336: 11311141.
4. Kostin S, Pool L, Elsasser A, Hein S, Drexler HC, Arnon E, Hayakawa Y, Zimmermann R, Bauer E, Klovekorn WP, Schaper J. Myocytes die by multiple mechanisms in failing human hearts. Circ Res. 2003; 92: 715724.
5. Wencker D, Chandra M, Nguyen K, Miao W, Garantziotis S, Factor SM, Shirani J, Armstrong RC, Kitsis RN. A mechanistic role for cardiac myocyte apoptosis in heart failure. J Clin Invest. 2003; 111: 14971504.[CrossRef][Medline] [Order article via Infotrieve]
6. Yamamoto S, Yang G, Zablocki D, Liu J, Hong C, Kim SJ, Soler S, Odashima M, Thaisz J, Yehia G, Molina CA, Yatani A, Vatner DE, Vatner SF, Sadoshima J. Activation of Mst1 causes dilated cardiomyopathy by stimulating apoptosis without compensatory ventricular myocyte hypertrophy. J Clin Invest. 2003; 111: 14631474.[CrossRef][Medline] [Order article via Infotrieve]
7. Hirota H, Chen J, Betz UA, Rajewsky K, Gu Y, Ross J Jr, Muller W, Chien KR. Loss of a gp130 cardiac muscle cell survival pathway is a critical event in the onset of heart failure during biomechanical stress. Cell. 1999; 97: 189198.[CrossRef][Medline] [Order article via Infotrieve]
8. von Harsdorf R, Poole-Wilson PA, Dietz R. Regenerative capacity of the myocardium: implications for treatment of heart failure. Lancet. 2004; 363: 13061313.[CrossRef][Medline] [Order article via Infotrieve]
9. Koseki T, Inohara N, Chen S, Nunez G. ARC, an inhibitor of apoptosis expressed in skeletal muscle and heart that interacts selectively with caspases. Proc Natl Acad Sci U S A. 1998; 95: 51565160.
10. Gustafsson AB, Tsai JG, Logue SE, Crow MT, Gottlieb RA. Apoptosis repressor with caspase recruitment domain protects against cell death by interfering with Bax activation. J Biol Chem. 2004; 279: 2123321238.
11. Nam YJ, Mani K, Ashton AW, Peng CF, Krishnamurthy B, Hayakawa Y, Lee P, Korsmeyer SJ, Kitsis RN. Inhibition of both the extrinsic and intrinsic death pathways through nonhomotypic death-fold interactions. Mol Cell. 2004; 15: 901912.[CrossRef][Medline] [Order article via Infotrieve]
12. Li PF, Li J, Muller EC, Otto A, Dietz R, von Harsdorf R. Phosphorylation by protein kinase CK2: a signaling switch for the caspase-inhibiting protein ARC. Mol Cell. 2002; 10: 247258.[CrossRef][Medline] [Order article via Infotrieve]
13. Gustafsson AB, Sayen MR, Williams SD, Crow MT, Gottlieb RA. TAT protein transduction into isolated perfused hearts: TAT-apoptosis repressor with caspase recruitment domain is cardioprotective. Circulation. 2002; 106: 735739.
14. Chatterjee S, Bish LT, Jayasankar V, Stewart AS, Woo YJ, Crow MT, Gardner TJ, Sweeney HL. Blocking the development of postischemic cardiomyopathy with viral gene transfer of the apoptosis repressor with caspase recruitment domain. J Thorac Cardiovasc Surg. 2003; 125: 14611469.
15. Didenko VV, Hornsby PJ. Presence of double-strand breaks with single-base 3' overhangs in cells undergoing apoptosis but not necrosis. J Cell Biol. 1996; 135: 13691376.
16. Hilfiker-Kleiner D, Hilfiker A, Fuchs M, Kaminski K, Schaefer A, Schieffer B, Hillmer A, Schmiedl A, Dingm Z, Podewski E, Podewski E, Poli V, Schneider MD, Schulz R, Park JK, Wollert KC, Drexler H. Signal transducer and activator of transcription 3 is required for myocardial capillary growth, control of interstitial matrix deposition, and heart protection from ischemic injury. Circ Res. 2004; 95: 187195.
17. Rockman HA, Ross RS, Harris AN, Knowlton KU, Steinhelper ME, Field LJ, Ross J Jr, Chien KR. Segregation of atrial-specific and inducible expression of an atrial natriuretic factor transgene in an in vivo murine model of cardiac hypertrophy. Proc Natl Acad Sci U S A. 1991; 88: 82778281.
18. Schoenfeld JR, Vasser M, Jhurani P, Ng P, Hunter JJ, Ross J Jr, Chien KR, Lowe DG. Distinct molecular phenotypes in murine cardiac muscle development, growth, and hypertrophy. J Mol Cell Cardiol. 1998; 30: 22692280.[CrossRef][Medline] [Order article via Infotrieve]
19. Chien KR. Stress pathways and heart failure. Cell. 1999; 98: 555558.[CrossRef][Medline] [Order article via Infotrieve]
20. Dorn GW II, Robbins J, Sugden PH. Phenotyping hypertrophy: eschew obfuscation. Circ Res. 2003; 92: 11711175.
21. Nadal-Ginard B, Kajstura J, Leri A, Anversa P. Myocyte death, growth, and regeneration in cardiac hypertrophy and failure. Circ Res. 2003; 92: 139150.
22. Teiger E, Than VD, Richard L, Wisnewsky C, Tea BS, Gaboury L, Tremblay J, Schwartz K, Hamet P. Apoptosis in pressure overload-induced heart hypertrophy in the rat. J Clin Invest. 1996; 28: 755765.
23. Hikoso S, Yamaguchi O, Higuchi Y, Hirotani S, Takeda T, Kashiwase K, Watanabe T, Taniike M, Tsujimoto I, Asahi M, Matsumura Y, Nishida K, Nakajima H, Akira S, Hori M, Otsu K. Pressure overload induces cardiac dysfunction and dilation in signal transducer and activator of transcription 6deficient mice. Circulation. 2004; 110: 26312637.
24. Adams JW, Sakata Y, Davis MG, Sah, VP, Wang Y, Liggett SB, Chien KR, Brown JH, Dorn GW II. Enhanced Galphaq signaling: a common pathway mediates cardiac hypertrophy and apoptotic heart failure. Proc Natl Acad Sci U S A. 1998; 95: 1014010145.
25. Pradervand S, Yasukawa H, Muller OG, Kjekshus H, Nakamura T, St Amand TR, Yajima T, Matsumura K, Duplain H, Iwatate M, Woodard S, Pedrazzini T, Ross J Jr, Firsov D, Rossier BC, Hoshijima M, Chien KR. Small proline-rich protein 1A is a gp130 pathway- and stress-inducible cardioprotective protein. EMBO J. 2004; 23: 45174525.[CrossRef][Medline] [Order article via Infotrieve]
26. Wettschureck N, Rutten H, Zywietz A, Gehring D, Wilkie TM, Chen J, Chien KR, Offermanns S. Absence of pressure overload induced myocardial hypertrophy after conditional inactivation of Galphaq/Galpha11 in cardiomyocytes. Nat Med. 2001; 7: 12361240.[CrossRef][Medline] [Order article via Infotrieve]
27. Moretti A, Weig HJ, Ott T, Seyfarth M, Holthoff HP, Grewe D, Gillitzer A, Bott-Flugel L, Schomig A, Ungerer M, Laugwitz KL. Essential myosin light chain as a target for caspase-3 in failing myocardium. Proc Natl Acad Sci U S A. 2002; 99: 1186011865.
28. Gottlieb RA, Burleson KO, Kloner RA, Babior BM, Engler RL. Reperfusion injury induces apoptosis in rabbit cardiomyocytes. J Clin Invest. 1994; 94: 16211628.[Medline] [Order article via Infotrieve]
29. Anversa P, Cheng W, Liu Y, Leri A, Redaelli G, Kajstura J. Apoptosis and myocardial infarction. Basic Res Cardiol. 1998; 93 (suppl 3): 812.[CrossRef][Medline] [Order article via Infotrieve]
30. Hochhauser E, Kivity S, Offen D, Maulik N, Otani H, Barhum Y, Pannet H, Shneyvays V, Shainberg A, Goldshtaub V, Tobar A, Vidne BA. Bax ablation protects against myocardial ischemia-reperfusion injury in transgenic mice. Am J Physiol. 2003; 284: 23512359.
31. Veis DJ, Sorenson CM, Shutter JR, Korsmeyer SJ. Bcl-2deficient mice demonstrate fulminant lymphoid apoptosis, polycystic kidneys, and hypopigmented hair. Cell. 1993; 75: 229240.[CrossRef][Medline] [Order article via Infotrieve]
32. Harlin H, Reffey SB, Duckett CS, Lindsten T, Thompson CB. Characterization of XIAP-deficient mice. Mol Cell Biol. 2001; 21: 36043608.
| Footnotes |
|---|
This article has been cited by other articles:
![]() |
X. Yu and D. C. Kem Proteasome inhibition during myocardial infarction Cardiovasc Res, October 4, 2009; (2009) cvp309v2. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Defer, J. Wan, R. Souktani, B. Escoubet, M. Perier, P. Caramelle, S. Manin, V. Deveaux, M.-C. Bourin, A. Zimmer, et al. The cannabinoid receptor type 2 promotes cardiac myocyte and fibroblast survival and protects against ischemia/reperfusion-induced cardiomyopathy FASEB J, July 1, 2009; 23(7): 2120 - 2130. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L Kao, W. Browder, and C. Li Cellular Cardiomyoplasty: What Have We Learned? Asian Cardiovasc Thorac Ann, January 1, 2009; 17(1): 89 - 101. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. MacGowan Good news for mice with heart attacks: preventing acute myocardial injury by inhibiting apoptosis Cardiovasc Res, January 1, 2009; 81(1): 1 - 2. [Full Text] [PDF] |
||||
![]() |
C. C. Chua, J. Gao, Y.-S. Ho, X. Xu, I-C. Kuo, K.-Y. Chua, H. Wang, R. C. Hamdy, J. C. Reed, and B. H.L. Chua Over-expression of a modified bifunctional apoptosis regulator protects against cardiac injury and doxorubicin-induced cardiotoxicity in transgenic mice Cardiovasc Res, January 1, 2009; 81(1): 20 - 27. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Westermann, A. Riad, O. Lettau, A. Roks, K. Savvatis, P. M. Becher, F. Escher, A.H. Jan Danser, H.-P. Schultheiss, and C. Tschope Renin Inhibition Improves Cardiac Function and Remodeling After Myocardial Infarction Independent of Blood Pressure Hypertension, December 1, 2008; 52(6): 1068 - 1075. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-O. Pyo, J. Nah, H.-J. Kim, J.-W. Chang, Y.-W. Song, D.-K. Yang, D.-G. Jo, H.-R. Kim, H.-J. Chae, S.-W. Chae, et al. Protection of Cardiomyocytes from Ischemic/Hypoxic Cell Death via Drbp1 and pMe2GlyDH in Cardio-specific ARC Transgenic Mice J. Biol. Chem., November 7, 2008; 283(45): 30707 - 30714. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. C. Moss, R.-H. Tang, M. Willis, W. E. Stansfield, A. S. Baldwin, and C. H. Selzman Inhibitory kappa B kinase-beta is a target for specific nuclear factor kappa B-mediated delayed cardioprotection. J. Thorac. Cardiovasc. Surg., November 1, 2008; 136(5): 1274 - 1279. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Murtaza, H.-X. Wang, X. Feng, N. Alenina, M. Bader, B. S. Prabhakar, and P.-F. Li Down-regulation of Catalase and Oxidative Modification of Protein Kinase CK2 Lead to the Failure of Apoptosis Repressor with Caspase Recruitment Domain to Inhibit Cardiomyocyte Hypertrophy J. Biol. Chem., March 7, 2008; 283(10): 5996 - 6004. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. H. Chen, C. C. Jiang, R. Watts, R. F. Thorne, K. A. Kiejda, X. D. Zhang, and P. Hersey Inhibition of Endoplasmic Reticulum Stress-Induced Apoptosis of Melanoma Cells by the ARC Protein Cancer Res., February 1, 2008; 68(3): 834 - 842. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sanchis, M. Llovera, M. Ballester, and J. X. Comella An alternative view of apoptosis in heart development and disease Cardiovasc Res, February 1, 2008; 77(3): 448 - 451. [Full Text] [PDF] |
||||
![]() |
P. A. da Costa Martins and L. J. De Windt Nix: The Cardiac Styx Between Life and Death Circulation, January 22, 2008; 117(3): 338 - 340. [Full Text] [PDF] |
||||
![]() |
A. Diwan, J. Wansapura, F. M. Syed, S. J. Matkovich, J. N. Lorenz, and G. W. Dorn II Nix-Mediated Apoptosis Links Myocardial Fibrosis, Cardiac Remodeling, and Hypertrophy Decompensation Circulation, January 22, 2008; 117(3): 396 - 404. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-Z. Li, D.-Y. Lu, W.-Q. Tan, J.-X. Wang, and P.-F. Li p53 Initiates Apoptosis by Transcriptionally Targeting the Antiapoptotic Protein ARC Mol. Cell. Biol., January 15, 2008; 28(2): 564 - 574. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L.J.H. Kietselaer, C. P.M. Reutelingsperger, H. H. Boersma, G. A.K. Heidendal, I. H. Liem, H. J.G.M. Crijns, J. Narula, and L. Hofstra Noninvasive Detection of Programmed Cell Loss with 99mTc-Labeled Annexin A5 in Heart Failure J. Nucl. Med., April 1, 2007; 48(4): 562 - 567. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2006 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |