| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2006;113:1171-1179.)
© 2006 American Heart Association, Inc.
Arrhythmia/Electrophysiology |
From the Departments of Biology (K.P., G.B., A.L., A.V., G.A.D., A.R.) and Cardiothoracic-Vascular Sciences (A.N., B.B., G.F.) and the Institute of Pathology (C.B., M.V., G.T.), University of Padua Medical School, Padua, Italy; and Department of Pediatrics, Section of Cardiology, Baylor College of Medicine, Houston, Tex (J.T.).
Correspondence to Andrea Nava, MD, Department of Cardiothoracic-Vascular Sciences, University of Padua, Via Giustiniani 2, Padua, Italy. E-mail andrea.nava{at}unipd.it
Received August 19, 2005; revision received December 23, 2005; accepted December 28, 2005.
| Abstract |
|---|
|
|
|---|
Methods and Results In a series of 80 unrelated ARVC probands, 26 carried a mutation in DSP (16%), PKP2 (14%), and transforming growth factor-ß3 (2.5%) genes; the remaining 54 were screened for DSG2 mutations by denaturing high-performance liquid chromatography and direct sequencing. Nine heterozygous DSG2 mutations (5 missense, 2 insertion-deletions, 1 nonsense, and 1 splice site mutation) were detected in 8 probands (10%). All probands fulfilled task force criteria for ARVC. An endomyocardial biopsy was obtained in 5, showing extensive loss of myocytes with fibrofatty tissue replacement. In 3 patients, electron microscopy investigation was performed, showing intercalated disc paleness, decreased desmosome number, and intercellular gap widening.
Conclusions This is the first investigation demonstrating DSG2 gene mutations in a significant number of ARVC-unrelated probands. Cardiac phenotype is characterized clinically by typical ARVC features with frequent left ventricular involvement and morphologically by fibrofatty myocardial replacement and desmosomal remodeling. The presence of mutations in desmosomal encoding genes in 40% of cases confirms that many forms of ARVC are due to alterations in the desmosome complex.
Key Words: arrhythmogenic right ventricular dysplasia cell adhesion molecules genetics pathology sudden death
| Introduction |
|---|
|
|
|---|
Clinical Perspective p 1179
We report here for the first time mutations of the DSG2 gene associated with ARVC and clinicopathological data of the 8 probands in whom such mutations were detected in the course of a systematic mutation screening.
| Methods |
|---|
|
|
|---|
Mutation Screening
The coding region of DSP, PKP2, and TGFß3 genes was screened for mutations in all study subjects. Because none of the subjects had effort-induced polymorphic ventricular arrhythmias or gross skin and hair abnormalities, we chose not to screen RyR2 or plakoglobin. Thirteen probands (16%) carried a DSP mutation, 11 (14%) a PKP2 mutation, and 2 (2.5%) a TGFß3 mutation. Fifty-four probands (33 males and 21 females) negative for mutations of these genes were considered for further investigation.
On the basis of previous findings on desmosomal genes involved in ARVC and on DSG2 expression in myocardial tissue,21 we hypothesized that mutations in human DSG2 could account for ARVC. The 54 ARVC probands were screened for DSG2 mutations by denaturing high-performance liquid chromatography (DHPLC) and direct sequencing. Polymerase chain reaction (PCR) primers flanking each exon of the human DSG2 gene were designed by PRIMER3. PCR amplifications were performed in a final volume of 25 µL, containing 50 ng of genomic DNA, 1x PCR buffer II (Applied Biosystems), 1.5 mmol/L MgCl2 (Applied Biosystems), 400 nmol/L each primer (Sigma Genosys), 100 µmol/L deoxynucleotide triphosphates (Invitrogen), and 0.8 U of Taq DNA polymerase (Taq Gold, Applied Biosystems). Cycling conditions (denaturation at 94°C for 30 sec, annealing at 60°C for 30 seconds, and extension at 72°C for 45 seconds) were repeated for 35 cycles. PCR primers and DHPLC conditions are reported in Table 1. DHPLC analysis was performed with the use of WAVE Nucleic Acid Fragment Analysis System 3500HT with DNASep HT cartridge (Transgenomic Ltd NE). Temperatures for sample analysis were selected with the use of WAVEMAKER software. The gradient mobile phase consisted of buffer A (0.1 mol/L triethyl ammonium acetate, pH 7, Transgenomic Ltd) and buffer B (0.1 mol/L triethyl ammonium acetate, pH 7, and 25% acetonitrile). Buffers were mixed to produce a linear gradient varying buffer B over a 2-minute period at 1.5 mL/min. After each analysis the cartridge was cleaned for 0.2 minutes with 75% acetonitrile and equilibrated at 5% buffer B below the gradient starting concentration to allow for sample loading. Samples showing a change in DHPLC pattern were directly sequenced with the use of the BIG DYE dideoxy-terminator chemistry (Perkin Elmer) on an ABI 3730XL DNA sequencer (PE Applied Biosystems). Chromas 1.5 software (Technelysium) and LASERGENE package computer programs (DNASTAR) were used to edit, assemble, and translate sequence. DSG2 sequences were compared with reference sequence BC099656.
|
A control group of 280 healthy and unrelated subjects (560 alleles) from the Italian population was used to exclude that detected mutations could be common DNA polymorphisms. All the controls were matched to the probands by ancestry.
Mutation screening was performed in all available family members of index cases in which a DSG2 mutation was detected. For further analysis of the splice site mutation, mRNA was isolated from 2.5 mL whole blood of the patient, with the use of the PAXgene Blood RNA kit (Qiagen) following the suppliers protocol. The corresponding cDNA was obtained from a reverse transcriptase (RT)PCR reaction with the use of 1 µg total RNA. The following primers were used in the first-round PCR to amplify the fragment corresponding to exons 12 to 15: 5'CAGTTTGTGAGTGTCTGCATGG3' and 5'ACTGGGAAGCTACTGCCAGA3'. DSG2 cDNA products were amplified by the use of nested PCR oligonucleotides (5'CACAGCATGACTCCTATGTGG3' and 5'GCGGTCATCTAGCTCTCCTT3'). The nested PCR products were size separated by agarose gel electrophoresis, gel isolated, and directly sequenced.
Identified mutations altering restriction sites were confirmed by restriction digest, accordingly to the manufacturers protocol (New England Biolabs).
Light Microscopy
A right ventricular endomyocardial biopsy was obtained in 5 probands via the femoral vein, by the long sheath technique (disposable Cordis bioptome). The samples were obtained at the junction between the ventricular septum and the anterior right ventricular free wall. Biopsy specimens were fixed in 10% phosphate-buffered formalin (pH 7.35) and then processed for histology. Seven-micrometer-thick paraffin-embedded sections were serially cut and stained by hematoxylin-eosin and Heidenhain trichrome. Histomorphometric analysis was performed on samples stained with Heidenhain trichrome with the use of an image analyzer system and commercially available software (Image-Pro Plus Version 4.0) accordingly to a previously described method.22 A diagnosis of ARVC was made on the basis of a significant amount of myocardial atrophy and fibrofatty tissue replacement.
Ultrastructural Investigation
In 3 patients, an endomyocardial biopsy sample was routinely fixed in 2.5% glutaraldehyde in 0.1 mmol/L phosphate buffer (pH 7.3) and postfixed in buffered 1% osmium tetroxide for 1 hour. Samples were then dehydrated in a series of ethanol and embedded in Epon. Semithin sections were first evaluated under light microscopy before we proceeded with the ultrathin sections. Thin sections were stained with uranyl acetate and lead citrate and examined under a Hitachi H-7000 electron microscope equipped with a digital camera.
Intercalated discs were assessed at a final magnification of x30 000 and x60 000 accordingly to a standardized method.23 By histomorphometric analysis, intercalated disc convolution index, desmosome length, desmosome number per 10 µm unity length of intercalated disc, and gap sizes were calculated. Values were compared with those obtained in endomyocardial biopsies from 10 sex- and age-matched donor hearts before cardiac transplantation.
The authors had full access to the data and take full responsibility for its integrity. All authors have read and agree to the manuscript as written.
| Results |
|---|
|
|
|---|
|
Mutations in Desmoglein-2
Nine DSG2 mutations have been identified in 8 (5 males and 3 females; mean age at diagnosis/symptom onset, 38±20 years; range, 11 to 63 years) of 80 ARVC index cases (10%). Overall, DSP, PKP2, TGFß3, and DSG2 account for 42.5% of genotyped ARVC probands.
Of the 9 DSG2 mutations, 5 were missense, 2 insertion-deletions, 1 a nonsense, and 1 a splice site mutation (Figure 1). None of the detected nucleotide changes was found in 560 control chromosomes. Identified mutations altering restriction sites were confirmed by restriction digest. The PCR products were submitted to digestion with the following restriction enzymes: HpyCH4V for the Tyr87Cys, PflmI for Gly100Arg, HpyAV for Glu331Lys, AlwNI for Gln557Ter, and BsmAI for 1253_1257insATGA.
|
Missense mutations Y87C, G100R, N266S, K294E, and E331K occurred in residues that are highly conserved among species. Mutations Y87C, G100R, and N266S, which are also conserved in all the desmogleins, and K294E and E331K are located in the extracellular cadherin (EC) domains. Cadherin domains are important for homophilic intercellular associations and form Ca2+-dependent rodlike structures. All the inherent amino acid changes may destabilize the rod structure and influence the homophilic binding. Moreover, mutation N266S is localized in a putative calcium binding site (DXNDN).
The 4-bp insertion in exon 9 (1253_1257insATGA) causes the addition of an amino acid residue before a premature stop signal is introduced (E418fsX419); the predicted truncated DSG2 molecule would lack transmembrane and cytoplasmic components.
The single base pair deletion in exon 14 (2036delG) results in a frameshift mutation that would leave the first 678 amino acids of the DSG2 protein intact, followed by addition of 2 novel amino acids (G678fsX681). The predicted truncated protein should maintain the transmembrane domain, but it would lack the intracellular cadherin-typical segment, thus precluding normal interaction with plakoglobin.
Mutation 1672C
T generates a termination codon (Q558X); therefore, the mutant should encode a short DSG2 molecule lacking transmembrane and cytoplasmic domains.
Mutation 1881 to 2A
G affects the acceptor splice site of intron 12. Sequencing analysis of the aberrant DSG2 transcript obtained from lymphocyte RNA of the proband showed that this mutation activates an alternative cryptic splice site in exon 13, located 38 bp downstream from the authentic 3' splice acceptor site. This aberrant spliced mRNA contains a 38-bp deletion (Figure 2) and should code for a truncated protein of 646 amino acids in length, missing the cytoplasmic domain.
|
In 1 patient (patient 5), 2 different mutations (E331K and 1881 to 2A
G) were detected. Family members were available for molecular analysis (Figure 3, family 172). Subject II,1 carried both mutations, subjects I,2 and III,2 carried the missense mutation, and subject III,1 carried the splice site mutation, thus demonstrating that the 2 mutations are in trans orientation. Although both mutations are potentially pathogenic, the possibility that the missense mutation is a rare polymorphism cannot be ruled out.
|
Clinical Findings
Clinical Presentation
The first symptom consisted of sustained ventricular tachycardia (VT) in 3 patients, palpitations in 3, and chest pain with increased serum markers of myocardial necrosis (creatine phosphokinase/MB 363/45 U/L and troponin I 11.9 µg/L) in 1 who had angiographically normal coronary arteries. One patient was asymptomatic and was examined because ECG abnormalities were detected at preparticipation screening for sport activity. Skin and hair were grossly normal at physical examination in all. Mean age at symptom onset/diagnosis was 26±13 years in males versus 58±4 years in females (P=0.001).
ECG/SAECG Findings
All patients showed ECG abnormalities (Table 2) (Figure 4A), consisting of complete right bundle-branch block in 1, incomplete right bundle-branch block in 3, negative T waves in the precordial leads in 7, negative T waves in inferior leads in 3, QS aspect in inferior leads in 1, epsilon wave in 3, low voltages of QRS in 1, and ST segment elevation in 1. Moreover, 3 patients showed a PQ prolongation (PQ >200 ms).
|
Late potentials were detected in 7 subjects and were evidenced with 25-, 40-, and 80-Hz filters in 4 cases and with 40- and 80-Hz filters in 3 cases.
Ventricular Arrhythmias
Ventricular arrhythmias were recorded in all probands and ranged from sustained VT with left bundle-branch block morphology (3 cases) to nonsustained VT (3 cases) and isolated monomorphic PVCs (2 cases).
Echocardiographic Findings
Abnormal echocardiographic findings were present in all probands, with right ventricular kinetic abnormalities involving only 1 region in 1 patient and
2 regions in the remaining 7 (Figure 4B). A left ventricular involvement was present in 4 patients, with normal left ventricular ejection fraction in 1 (57%) and mildly decreased left ventricular ejection fraction in 3 (ranging from 45% to 48%); left ventricular kinetic abnormalities were localized in 1 and diffuse in 3 patients.
Familial Study
A family history of premature sudden death due to suspected ARVC was present in 1 proband and of clinically proven ARVC (based on diagnostic criteria) in 3 probands.
Family members of 2 index cases (patient 5, family 172 and patient 6, family 169) were available for clinical and genetic testing (Figure 3). In family 172, subject II,1, who was found to carry both mutations, showed negative T waves in V1 through V4 on 12-lead ECG, right ventricular enlargement and kinetic alterations on 2D echocardiogram, and premature ventricular beats (>1000/24 h) with left bundle-branch block morphology. Clinical investigation in subjects I,2 and III,2 was negative, whereas it was not feasible in subject III,1.
In family 169, the DSG2 mutation N266S was found in a daughter (subject II,1) and a son (subject II,4) of the index case. Clinical findings were negative in the former, whereas subject II,4 showed negative T waves in V1 through V2 on 12-lead ECG, right ventricular dilation together with kinetic abnormalities on 2D echo, and nonsustained ventricular arrhythmias.
All family members not carrying DSG2 mutations were negative at clinical investigation.
Light Microscopy and Electron Microscopy Findings
In the 5 patients who underwent endomyocardial biopsy (patients 1, 2, 5, 8, 9), histomorphometric evaluation revealed a mean area of residual myocardium 47±8%, fibrous tissue 24±11%, and fatty tissue 20±13%. Moreover, dysmetric and dysmorphic nuclei and prominent cytoplasmic vacuolization were evidenced in all (Figure 4C and 4D).
In 3 patients (patients 1, 2, 8), electron microscopy investigation was also performed. At the ultrastructural level, we found a decreased desmosome number per 10 µm unity length of intercalated disc (3.1±0.4 versus 5.5±3 in controls) and an increased desmosome gap (31.7±17.8 versus 21.7±3.4 nm in controls). Moreover, abnormal small junctions composed of series of repeating couplings, abnormally located desmosomes, and pale internal plaques were visible compared with controls (Figure 5).
|
| Discussion |
|---|
|
|
|---|
Among the 9 mutations herein reported, 7 are located in the EC amino terminal domain, which directly participates in the adhesive interaction. Crystallographic and biochemical studies of classic cadherin ectodomains suggest that they form homophilic dimers in cis and in trans orientations.26 Calcium binding to the EC domains is important for stabilizing their structure and function. Whereas trans-dimerization is likely required to form the adhesive interface in adjacent cells, it has been proposed that cis-dimerization is important for promoting adhesion via molecular clustering.26 It is possible that even a single amino acid change could result in differences in molecular affinity and possibly in the abolition of the adhesive capacity of cadherins. In vitro functional studies are needed to evaluate this.
Effect of the DSG2 Mutations at the Cellular Level
Unlike PKP2 and plakoglobin, no data are available on cardiac abnormalities in the DSG2 knockout mouse because loss of DSG2 resulted in early embryonic lethality.27 In vitro antisense experiments against DSC2,28 expression of truncated DSG3 and DSG1 proteins,29,30 and knockout mice of the DSG3 gene31 all resulted in a decreased number of desmosomes, associated with increased asymmetry and detachment. These electron microscopy observations are in agreement with those obtained in 3 DSG2 mutations carriers herein reported, which show a decreased number of desmosomes as well as a widening of intercalated disc gap. On the basis of these ultrastructural findings and of the histological demonstration of myocardial atrophy in patients who underwent endomyocardial biopsy, we can postulate that in desmosomal cardiomyopathies (ie, Naxos syndrome, Carvajal syndrome, and ARVC),8,1012,1416 impaired cell-to-cell adhesion leads to myocyte detachment, cell death, and fibrofatty repair.17,32 Moreover, because TGFß3 could modulate expression of genes encoding desmosomal proteins in different cell types,33 the same pathogenic mechanism could be advocated in ARVD1 patients.12
From the clinical point of view, in our series of unrelated DSG2 mutation carriers, a typical form of ARVC was documented with left ventricular involvement in almost half of the cases. Genotyping of available family members of 2 index cases allowed us to demonstrate the transmission of the disease allele in all affected relatives. However, prospective studies of a larger number of family members are needed to evaluate the penetrance of DSG2 mutations and the entire clinical spectrum of the disease from the concealed to the overt forms. It is noteworthy that both sexes are represented equally, although the mean age at symptom onset/diagnosis was significantly higher in female than in male mutation carriers. These data confirm previous observations from clinical series and could be interpreted either as a gender-related penetrance or as the consequence of additional acquired and/or genetic factors involved in disease expression.13
None of the 8 probands carrying the pathogenic mutations showed gross skin/hair abnormalities. All DSG isoforms are expressed in the epidermal tissues, whereas DSG2 is the only one expressed in the myocardium.21 We may hypothesize that compensation by other DSG isoforms might take place in the epidermis but not in the myocardium of DSG2 mutation carriers, thus accounting for the cardiac-specific phenotype.
Clinical diagnosis of ARVC is challenging, and the currently available diagnostic criteria, although acknowledged to be specific, are lacking in sensitivity. Because mutation detection is feasible in a significant proportion of patients, genetic screening could assume a pivotal role in the clinical evaluation of familial forms. In this setting, the benefits of detection of disease-gene mutations would include identification of asymptomatic carriers among family members and interpretation of borderline clinical phenotypes.
In conclusion, this is the first demonstration that mutations in DSG2 gene are associated with ARVC. On the basis of our data showing that 40% of ARVC probands carry a mutation in desmosomal proteins encoding genes, we confirm that many forms of ARVC are due to alterations in the desmosome complex.
| Acknowledgments |
|---|
Disclosures
None.
| References |
|---|
|
|
|---|
2. Marcus FI, Fontaine GH, Guiraudon G, Frank R, Laurenceau JL, Malergue C, Grosgogeat Y. Right ventricular dysplasia: a report of 24 adult cases. Circulation. 1982; 65: 384398.
3. Thiene G, Nava A, Corrado D, Rossi L, Pennelli N. Right ventricular cardiomyopathy and sudden death in young people. N Engl J Med. 1988; 318: 129133.[Abstract]
4. Basso C, Thiene G, Corrado D, Angelini A, Nava A, Valente M. Arrhythmogenic right ventricular cardiomyopathy: dysplasia, dystrophy or myocarditis? Circulation. 1996; 94: 983991.
5. Corrado D, Basso C, Rizzoli G, Schiavon M, Thiene G. Does sports activity enhance the risk of sudden death in adolescents and young adults? J Am Coll Cardiol. 2003; 42: 19591963.
6. Nava A, Thiene G, Canciani B, Scognamiglio R, Daliento L, Buja G, Martini B, Stritoni P, Fasoli G. Familial occurrence of right ventricular dysplasia: a study involving nine families. J Am Coll Cardiol. 1988; 12: 12221228.[Abstract]
7. Nava A, Bauce B, Basso C, Muriago M, Rampazzo A, Villanova C, Daliento L, Buja G, Corrado D, Danieli GA, Thiene G. Clinical profile and long term follow-up of 37 families with arrhythmogenic right ventricular cardiomyopathy. J Am Coll Cardiol. 2000; 36: 22262233.
8. McKoy G, Protonotarios N, Crosby A, Tsatsopoulou A, Anastasakis A, Coonar A, Norman M, Baboonian C, Jeffery S, McKenna WJ. Identification of a deletion in plakoglobin in arrhythmogenic right ventricular cardiomyopathy with palmoplantar keratoderma and woolly hair (Naxos disease). Lancet. 2000; 355: 21192124.[CrossRef][Medline] [Order article via Infotrieve]
9. Tiso N, Stephan DA, Nava A, Bagattin A, Devaney JM, Stanchi F, Larderet G, Brahmbhatt B, Brown K, Bauce B, Muriago M, Basso C, Thiene G, Danieli GA, Rampazzo A. Identification of mutations in the cardiac ryanodine receptor gene in families affected with arrhythmogenic right ventricular cardiomyopathy type 2 (ARVD2). Hum Mol Genet. 2001; 10: 189194.
10. Rampazzo A, Nava A, Malacrida S, Beffagna G, Bauce B, Rossi V, Zimbello R, Simionati B, Basso C, Thiene G, Towbin JA, Danieli GA. Mutation in human desmoplakin domain binding to plakoglobin causes a dominant form of arrhythmogenic right ventricular cardiomyopathy. Am J Hum Genet. 2002; 71: 12001206.[CrossRef][Medline] [Order article via Infotrieve]
11. Gerull B, Heuser A, Wichter T, Paul M, Basson CT, McDermott DA, Lerman BB, Markowitz SM, Ellinor PT, MacRae CA, Peters S, Grossmann KS, Drenckhahn J, Michely B, Sasse-Klaassen S, Birchmeier W, Dietz R, Breithardt G, Schulze-Bahr E, Thierfelder L. Mutations in the desmosomal protein plakophilin-2 are common in arrhythmogenic right ventricular cardiomyopathy. Nat Genet. 2004; 36: 11621164.[CrossRef][Medline] [Order article via Infotrieve]
12. Beffagna G, Occhi G, Nava A, Vitiello L, Ditadi A, Basso C, Bauce B, Carraro G, Thiene G, Towbin JA, Danieli GA, Rampazzo A. Regulatory mutations in transforming growth factor-beta 3 gene cause arrhythmogenic right ventricular cardiomyopathy type 1. Cardiovasc Res. 2005; 65: 366373.
13. Bauce B, Basso C, Rampazzo A, Beffagna G, Daliento L, Frigo G, Malacrida S, Settimo L, Danieli G, Thiene G, Nava A. Clinical profile of four families with arrhythmogenic right ventricular cardiomyopathy caused by dominant desmoplakin mutations. Eur Heart J. 2005; 26: 16661675.
14. Norman M, Simpson M, Mogensen J, Shaw A, Hughes S, Syrris P, Sen-Chowdhry S, Rowland E, Crosby A, McKenna WJ. Novel mutation in desmoplakin causes arrhythmogenic left ventricular cardiomyopathy. Circulation. 2005; 112: 636642.
15. Norgett EE, Hatsell SJ, Carvajal-Huerta L, Cabezas JC, Common J, Purkis PE, Whittock N, Leigh IM, Stevens HP, Kelsell DP. Recessive mutation in desmoplakin disrupts desmoplakin-intermediate filament interactions and causes dilated cardiomyopathy, woolly hair and keratoderma. Hum Mol Genet. 2000; 9: 27612766.
16. Kaplan SR, Gard JJ, Carvajal-Huerta L, Ruiz-Cabezas JC, Thiene G, Saffitz JE. Structural and molecular pathology of the heart in Carvajal syndrome. Cardiovasc Pathol. 2004; 13: 2632.[Medline] [Order article via Infotrieve]
17. Thiene G, Corrado D, Basso C. Cardiomyopathies: time for molecular classification? Eur Heart J. 2004; 25: 17721775.
18. Troyanovsky SM, Leube RE. Molecular dissection of desmosomal assembly and intermediate filament anchorage. Subcell Biochem. 1998; 31: 263289.[Medline] [Order article via Infotrieve]
19. Ishii K, Green KJ. Cadherin function: breaking the barrier. Curr Biol. 2001; 11: R569R572.[CrossRef][Medline] [Order article via Infotrieve]
20. McKenna WJ, Thiene G, Nava A, Fontaliran F, Blomstrom-Lundqvist C, Fontaine G, Camerini F. Diagnosis of arrhythmogenic right ventricular dysplasia/cardiomyopathy: Task Force of the Working Group Myocardial and Pericardial Disease of the European Society of Cardiology and of the Scientific Council on Cardiomyopathies of the International Society and Federation of Cardiology. Br Heart J. 1994; 71: 215218.
21. Schäfer S, Koch PJ, Franke WW. Identification of the ubiquitous human desmoglein, DSG2, and the expression catalogue of the desmoglein subfamily of the desmosomal cadherins. Exp Cell Res. 1994; 211: 391399.[CrossRef][Medline] [Order article via Infotrieve]
22. Angelini A, Basso C, Nava A, Thiene G. Endomyocardial biopsy in arrhythmogenic right ventricular cardiomyopathy. Am Heart J. 1996; 132: 203206.[CrossRef][Medline] [Order article via Infotrieve]
23. Basso C, Della Barbera M, Valente M, Wlodarska EK, Bauce B, Daliento L, Rampazzo A, Nava A, Thiene G, Czarnowska E. Arrhythmogenic right ventricular cardiomyopathy: ultrastructural evidence of myocyte intercalated disc remodeling. Circulation. 2005; 112: II-407II-408.
24. Nagafuchi A, Takeichi M. Cell binding function of E-cadherin is regulated by the cytoplasmic domain. EMBO J. 1988; 7: 36793684.[Medline] [Order article via Infotrieve]
25. Ozawa M, Kemler R. The membrane-proximal region of the E-cadherin cytoplasmic domain prevents dimerization and negatively regulates adhesion activity. J Cell Biol. 1998; 142: 16051613.
26. Pertz O, Bozic D, Koch AW, Fauser C, Brancaccio A, Engel J. A new crystal structure, Ca2+ dependence and mutational analysis reveal molecular details of E-cadherin homoassociation. EMBO J. 1999; 18: 17381747.[CrossRef][Medline] [Order article via Infotrieve]
27. Eshkind L, Tian Q, Schmidt A, Franke WW, Windoffer R, Leube RE. Loss of desmoglein 2 suggests essential functions for early embryonic development and proliferation of embryonal stem cells. Eur J Cell Biol. 2002; 81: 592598.[CrossRef][Medline] [Order article via Infotrieve]
28. Roberts GA, Burdett ID, Pidsley SC, King IA, Magee AI, Buxton RS. Antisense expression of a desmocollin gene in MDCK cells alters desmosome plaque assembly but does not affect desmoglein expression. Eur J Cell Biol. 1998; 76: 192203.[Medline] [Order article via Infotrieve]
29. Allen E, Yu QC, Fuchs E. Mice expressing a mutant desmosomal cadherin exhibit abnormalities in desmosomes, proliferation, and epidermal differentiation. J Cell Biol. 1996; 133: 13671382.
30. Serpente N, Marcozzi C, Roberts GA, Bao Q, Angst BD, Hirst EM, Burdett ID, Buxton RS, Magee AI. Extracellularly truncated desmoglein 1 compromises desmosomes in MDCK cells. Mol Membr Biol. 2000; 17: 175183.[CrossRef][Medline] [Order article via Infotrieve]
31. Koch PJ, Mahoney MG, Ishikawa H, Pulkkinen L, Uitto J, Shultz L, Murphy GF, Whitaker-Menezes D, Stanley JR. Targeted disruption of the pemphigus vulgaris antigen (desmoglein 3) gene in mice causes loss of keratinocyte cell adhesion with a phenotype similar to pemphigus vulgaris. J Cell Biol. 1997; 137: 10911102.
32. Protonotarios N, Tsatsopoulou A. Naxos disease and Carvajal syndrome: cardiocutaneous disorders that highlight the pathogenesis and broaden the spectrum of arrhythmogenic right ventricular cardiomyopathy. Cardiovasc Pathol. 2004; 13: 185194.[Medline] [Order article via Infotrieve]
33. Yoshida M, Romberger DJ, Illig MG, Takizawa H, Sacco O, Spurzem JR, Sisson JH, Rennard SI, Beckmann JD. Transforming growth factor-beta stimulates the expression of desmosomal proteins in bronchial epithelial cells. Am J Respir Cell Mol Biol. 1992; 6: 439445.[Medline] [Order article via Infotrieve]
![]() |
M. G.P.J. Cox, J. J. van der Smagt, A. A.M. Wilde, A. C.P. Wiesfeld, D. E. Atsma, M. R. Nelen, L.-M. Rodriguez, P. Loh, M. J. Cramer, P. A. Doevendans, et al. New ECG Criteria in Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy Circ Arrhythm Electrophysiol, October 1, 2009; 2(5): 524 - 530. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. den Haan, B. Y. Tan, M. N. Zikusoka, L. I. Llado, R. Jain, A. Daly, C. Tichnell, C. James, N. Amat-Alarcon, T. Abraham, et al. Comprehensive Desmosome Mutation Analysis in North Americans With Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy Circ Cardiovasc Genet, October 1, 2009; 2(5): 428 - 435. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. A. Bhuiyan, J. D.H. Jongbloed, J. van der Smagt, P. M. Lombardi, A. C.P. Wiesfeld, M. Nelen, M. Schouten, R. Jongbloed, M. G.P.J. Cox, M. van Wolferen, et al. Desmoglein-2 and Desmocollin-2 Mutations in Dutch Arrhythmogenic Right Ventricular Dysplasia/Cardiomypathy Patients: Results From a Multicenter Study Circ Cardiovasc Genet, October 1, 2009; 2(5): 418 - 427. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Pilichou, C. A. Remme, C. Basso, M. E. Campian, S. Rizzo, P. Barnett, B. P. Scicluna, B. Bauce, M. J.B. van den Hoff, J. M.T. de Bakker, et al. Myocyte necrosis underlies progressive myocardial dystrophy in mouse dsg2-related arrhythmogenic right ventricular cardiomyopathy J. Exp. Med., August 3, 2009; 206(8): 1787 - 1802. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Delva, D. K. Tucker, and A. P. Kowalczyk The Desmosome Cold Spring Harb Perspect Biol, August 1, 2009; 1(2): a002543 - a002543. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. F. Tops, K. Prakasa, H. Tandri, D. Dalal, R. Jain, V. L. Dimaano, D. Dombroski, C. James, C. Tichnell, A. Daly, et al. Prevalence and pathophysiologic attributes of ventricular dyssynchrony in arrhythmogenic right ventricular dysplasia/cardiomyopathy. J. Am. Coll. Cardiol., July 28, 2009; 54(5): 445 - 451. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Corrado, C. Basso, and G. Thiene Arrhythmogenic right ventricular cardiomyopathy: an update Heart, May 1, 2009; 95(9): 766 - 773. [Full Text] [PDF] |
||||
![]() |
D. Dalal, H. Tandri, D. P. Judge, N. Amat, R. Macedo, R. Jain, C. Tichnell, A. Daly, C. James, S. D. Russell, et al. Morphologic variants of familial arrhythmogenic right ventricular dysplasia/cardiomyopathy a genetics-magnetic resonance imaging correlation study. J. Am. Coll. Cardiol., April 14, 2009; 53(15): 1289 - 1299. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Severs The Carboxy Terminal Domain of Connexin43: From Molecular Regulation of the Gap Junction Channel to Supramolecular Organization of the Intercalated Disk Circ. Res., December 7, 2007; 101(12): 1213 - 1215. [Full Text] [PDF] |
||||
![]() |
S. Sen-Chowdhry, P. Syrris, and W. J. McKenna Role of Genetic Analysis in the Management of Patients With Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy J. Am. Coll. Cardiol., November 6, 2007; 50(19): 1813 - 1821. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Gustafson-Wagner, H. W. Sinn, Y.-L. Chen, D.-Z. Wang, R. S. Reiter, J. L.-C. Lin, B. Yang, R. A. Williamson, J. Chen, C.-I. Lin, et al. Loss of mXin{alpha}, an intercalated disk protein, results in cardiac hypertrophy and cardiomyopathy with conduction defects Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H2680 - H2692. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rohr Molecular Crosstalk Between Mechanical and Electrical Junctions at the Intercalated Disc Circ. Res., September 28, 2007; 101(7): 637 - 639. [Full Text] [PDF] |
||||
![]() |
D. Dalal, R. Jain, H. Tandri, J. Dong, S. M. Eid, K. Prakasa, C. Tichnell, C. James, T. Abraham, S. D. Russell, et al. Long-Term Efficacy of Catheter Ablation of Ventricular Tachycardia in Patients With Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy J. Am. Coll. Cardiol., July 31, 2007; 50(5): 432 - 440. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Goossens, B. Janssens, S. Bonne, R. De Rycke, F. Braet, J. van Hengel, and F. van Roy A unique and specific interaction between {alpha}T-catenin and plakophilin-2 in the area composita, the mixed-type junctional structure of cardiac intercalated discs J. Cell Sci., June 15, 2007; 120(12): 2126 - 2136. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Merle, E. Fein, S. G. Gehrke, W. Stremmel, and H. Kulaksiz The Iron Regulatory Peptide Hepcidin Is Expressed in the Heart and Regulated by Hypoxia and Inflammation Endocrinology, June 1, 2007; 148(6): 2663 - 2668. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Frigo, A. Rampazzo, B. Bauce, K. Pilichou, G. Beffagna, G. A. Danieli, A. Nava, and B. Martini Homozygous SCN5A mutation in Brugada syndrome with monomorphic ventricular tachycardia and structural heart abnormalities Europace, June 1, 2007; 9(6): 391 - 397. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Moric-Janiszewska and G. Markiewicz-Loskot Review on the genetics of arrhythmogenic right ventricular dysplasia Europace, May 1, 2007; 9(5): 259 - 266. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sen-Chowdhry, P. Syrris, D. Ward, A. Asimaki, E. Sevdalis, and W. J. McKenna Clinical and Genetic Characterization of Families With Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy Provides Novel Insights Into Patterns of Disease Expression Circulation, April 3, 2007; 115(13): 1710 - 1720. [Abstract] [Full Text] [PDF] |
||||
![]() |
A A Tsatsopoulou, N I Protonotarios, and W J McKenna Arrhythmogenic right ventricular dysplasia, a cell adhesion cardiomyopathy: insights into disease pathogenesis from preliminary genotype--phenotype assessment Heart, December 1, 2006; 92(12): 1720 - 1723. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sen-Chowdhry, S. K. Prasad, P. Syrris, R. Wage, D. Ward, R. Merrifield, G. C. Smith, D. N. Firmin, D. J. Pennell, and W. J. McKenna Cardiovascular Magnetic Resonance in Arrhythmogenic Right Ventricular Cardiomyopathy Revisited: Comparison With Task Force Criteria and Genotype J. Am. Coll. Cardiol., November 21, 2006; 48(10): 2132 - 2140. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kirchhof, L. Fabritz, M. Zwiener, H. Witt, M. Schafers, S. Zellerhoff, M. Paul, T. Athai, K.-H. Hiller, H. A. Baba, et al. Age- and Training-Dependent Development of Arrhythmogenic Right Ventricular Cardiomyopathy in Heterozygous Plakoglobin-Deficient Mice Circulation, October 24, 2006; 114(17): 1799 - 1806. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Dalal, C. James, R. Devanagondi, C. Tichnell, A. Tucker, K. Prakasa, P. J. Spevak, D. A. Bluemke, T. Abraham, S. D. Russell, et al. Penetrance of Mutations in Plakophilin-2 Among Families With Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy J. Am. Coll. Cardiol., October 3, 2006; 48(7): 1416 - 1424. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yang, N. E. Bowles, S. E. Scherer, M. D. Taylor, D. L. Kearney, S. Ge, V. V. Nadvoretskiy, G. DeFreitas, B. Carabello, L. I. Brandon, et al. Desmosomal Dysfunction due to Mutations in Desmoplakin Causes Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy Circ. Res., September 15, 2006; 99(6): 646 - 655. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Antoniades, A. Tsatsopoulou, A. Anastasakis, P. Syrris, A. Asimaki, D. Panagiotakos, C. Zambartas, C. Stefanadis, W. J. McKenna, and N. Protonotarios Arrhythmogenic right ventricular cardiomyopathy caused by deletions in plakophilin-2 and plakoglobin (Naxos disease) in families from Greece and Cyprus: genotype-phenotype relations, diagnostic features and prognosis Eur. Heart J., September 2, 2006; 27(18): 2208 - 2216. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Basso, E. Czarnowska, M. D. Barbera, B. Bauce, G. Beffagna, E. K. Wlodarska, K. Pilichou, A. Ramondo, A. Lorenzon, O. Wozniek, et al. Ultrastructural evidence of intercalated disc remodelling in arrhythmogenic right ventricular cardiomyopathy: an electron microscopy investigation on endomyocardial biopsies Eur. Heart J., August 1, 2006; 27(15): 1847 - 1854. [Abstract] [Full Text] [PDF] |
||||
![]() |
Another Gene Implicated in Arrhythmogenic RV Dysplasia Journal Watch Cardiology, April 27, 2006; 2006(427): 2 - 2. [Full Text] |
||||
![]() |
D. Corrado and G. Thiene Arrhythmogenic Right Ventricular Cardiomyopathy/Dysplasia: Clinical Impact of Molecular Genetic Studies Circulation, April 4, 2006; 113(13): 1634 - 1637. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2006 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |