| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2006;113:1005-1014.)
© 2006 American Heart Association, Inc.
Molecular Cardiology |
From the Department of Radiology and Bio-X Program (F.C., S.L., X.X., P.R., M.P., X.Z., X.C., S.S.G., J.C.W.), the Department of Pathology and Developmental Biology (M.D., S.J.D., A.J.C., I.L.W.), the Department of Bioengineering (S.S.G.), and the Department of Medicine, Division of Cardiology (J.C.W.), Stanford University School of Medicine, Stanford, Calif.
Correspondence to Joseph C. Wu, MD, PhD, Stanford University School of Medicine, Edwards Bldg R354, Stanford, CA 94305-5344. E-mail joewu{at}stanford.edu
Received September 14, 2005; revision received November 17, 2005; accepted December 16, 2005.
| Abstract |
|---|
|
|
|---|
Methods and Results Murine embryonic stem (ES) cells were stably transduced with a lentiviral vector carrying a novel triple-fusion (TF) reporter gene that consists of firefly luciferase, monomeric red fluorescence protein, and truncated thymidine kinase (fluc-mrfp-ttk). ES cell viability, proliferation, and differentiation ability were not adversely affected by either reporter genes or reporter probes compared with nontransduced control cells (P=NS). Afterward, 1x107 of ES cells carrying the TF reporter gene (ES-TF) were injected into the myocardium of adult nude rats (n=20). Control animals received nontransduced ES cells (n=6). At day 4, the bioluminescence and positron emission tomography signals in study animals were 3.7x107±5.8x106 photons · s1 · cm2 per steradian (sr) and 0.08±0.03% injected dose/g, respectively (P<0.05 versus control). Both signals increased progressively from week 1 to week 4, which indicated ES cell survival and proliferation in the host. Histological analysis demonstrated the formation of intracardiac and extracardiac teratomas. Finally, animals (n=4) that were treated with intraperitoneal injection of ganciclovir (50 mg/kg) did not develop teratomas when compared with control animals (n=4) treated with saline (1 mL/kg).
Conclusion This is the first study to characterize ES cells that stably express fluorescence, bioluminescence, and positron emission tomography reporter genes and monitor the kinetics of ES cell survival, proliferation, and migration. This versatile imaging platform should have broad applications for basic research and clinical studies on stem cell therapy.
Key Words: heart diseases stem cells positron emission tomography nuclear medicine molecular imaging
| Introduction |
|---|
|
|
|---|
To understand the fate of stem cells in vivo, imaging techniques have recently been proposed and evaluated in a limited number of cell-delivery models. One technique is radionuclide imaging of stem cells labeled with F-18 fluorodeoxyglucose ([18F]-FDG); however, the short physical half-life of this radioisotope (T1/2 &110 minutes) limits the imaging protocol to within the first day of cell transplantation.7 Another technique is MRI of stem cells labeled with iron oxide particles8 or perfluoropolyether agents,9 which has the advantage of providing detailed anatomic location but is unable to quantify cell signal activity reliably because of dilutional effects during cellular division.8 In addition, the engulfment of labeled radioisotopes, iron oxide particles, or perfluoropolyether agents by neighboring macrophages after donor cell death limits the ability of both techniques to distinguish viable from nonviable cells.79 The third modality is based on the reporter gene imaging approach that our group has validated previously.10 Although this prior study was able to image transplanted rat embryonic cardiomyoblasts noninvasively, accurate monitoring of cell survival, proliferation, and migration was not feasible because of the transient nature of adenoviral transduction.
Clinical Perspective p 1014
Here, we report several significant improvements toward reporter gene imaging of stem cells. We first designed a versatile triple-fusion (TF) reporter gene construct carried by a self-inactivating lentiviral vector capable of stably transducing ES cells. We next showed that expression of reporter genes and their interaction with reporter probes did not adversely affect ES cell viability, proliferation, and differentiation. We then imaged ES cell fate in living rats and importantly confirmed that cell imaging signals correlated strongly with traditional ex vivo assays. Finally, we demonstrated that the positron emission tomography (PET) reporter gene (ttk, or truncated thymidine kinase) could also serve as a suicide gene, thus providing an extra safety mechanism against cellular misbehavior.
| Methods |
|---|
|
|
|---|
Construction of pUb-fluc-mrfp-ttk and Lentiviral Transduction of ES Cells
In our previous work, the TF reporter gene was downstream from a cytomegalovirus promoter.12 This gene fragment (3.3 kbp) was released from the plasmid with Not1 and BamH1 restriction enzymes before blunt-end ligation into the multiple cloning site of the lentiviral transfer vector, FUG, driven by the human ubiquitin-C promoter.13 A self-inactivating lentivirus was prepared by transient transfection of 293T cells as described previously.14 Briefly, pFUG-TF containing the TF reporter gene was cotransfected into 293T cells with HIV-1 packaging vector (
8.9) and vesicular stomatitis virus G glycoprotein-pseudotyped envelop vector (pVSVG). Lentivirus supernatant was concentrated by sediment centrifugation with SW29 rotor at 50 000 g for 2 hours. Concentrated virus was titrated on 293T cells. Murine ES cells were transduced with LV-pUb-fluc-mrfp-ttk at a multiplicity of infection (MOI) of 10. The infectivity was determined by monomeric red fluorescence protein (mrfp) expression as analyzed on FACScan (Becton Dickinson). For comparison, ES cells were also transduced with lipofectamine (Qiagen) and electroporation (Bio-Rad Gene Pulser) techniques according to manufacturers protocol.
Effect of Reporter Genes and Reporter Probes on ES Cell Viability and Proliferation
Cells were plated uniformly in 96-well plates at a density of 5000 cells per well. The control nontransduced ES and ES-TF cells were incubated with bioluminescence reporter probe D-luciferin (100 µmol/L) or PET reporter probe 9-(4-[18F]-fluoro-3hydroxymethylbutyl)guanine ([18F]-FHBG; 100 µCi) for 6 hours before the media were changed on a weekly basis. The CyQuant cell proliferation assay (Molecular Probes) was measured with a microplate spectrofluorometer (Gemini EM) at week 1, 2, 3, and 4 time points. Eight samples were assayed and averaged. The trypan blue exclusion assay was used to assess the viability and cytotoxicity under the same conditions.
Embryoid Body Formation and Cardiomyocyte Differentiation
ES cells were differentiated into beating cardiomyocytes in vitro by the "hanging drop" method as described previously.15 Briefly, the main steps included withdrawal of LIF and cultivation of 400 cells in 18-µL hanging drops to produce embryoid bodies for 3 days, followed by cultivation as a suspension in ultra-low-cluster 96-well flat-bottom plates for 2 days. Next, the embryoid bodies were seeded onto 48-well plates. Over the next 3 weeks, the beating rates (chronotropicity) of these embryoid bodies were compared between control ES and ES-TF cells.
Reverse-Transcription Polymerase Chain Reaction Analysis of Embryonic and Ventricular Specific Transcripts
Reverse-transcription polymerase chain reaction (RT-PCR) was used to compare the expression of embryonic marker (Oct4), cardiac transcription factor (Nkx2.5), ventricular-specific proteins (ß-MHC [myosin heavy chain] and MLC2v [myosin light chain 2]), and reporter genes (fluc, or firefly luciferase) between control nontransduced ES and ES-TF cells. Total RNA was prepared from ES-TF cells with Trizol reagent (Invitrogen) according to the manufacturers protocol. The primer sets used in the amplification reaction were as follow: Oct4 forward primer GGCGTTCTCTTTGCAAAGGTGTTC, reverse primer CTCGAACCACATCCTTCTCT; Nkx2.5 forward primer AGCAACTTCGTGAACTTTG, reverse primer CCGGTCCTAGTGTGGA; MLC2v forward primer CAGCAGGCTCCTCGAACTCT, reverse primer GTTTATTTGCGCACAGCCCT; and Fluc forward primer ATCTACTGGTCTGCCTAAAG, reverse primer CAGCTCTTCTTCAAATCTATAC. PCR products were separated on 1% agarose gel electrophoresis and quantified with Labworks 4.6 Image Acquisition and analysis software (UVP Bio-Imaging Systems).
Transplantation of Murine ES Cells Into Rat Myocardium
Adult female nude athymic rats (weight 200 to 250 g) underwent aseptic lateral thoracotomy. Animals received isoflurane (2%) for general anesthesia, banamine (2.5 mg/kg) for pain relief, and normal saline (2 to 3 mL) for volume replacement. Harvested control ES and ES-TF cells were kept on ice for <30 minutes for optimal viability before injection into the rat myocardium. Animals (n=20) were injected intramyocardially with 1x107 of ES-TF cells in 50 µL of PBS. Control animals (n=6) received 1x107 nontransduced ES cells instead. All animals recovered uneventfully and underwent bioluminescence and small-animal PET imaging later. Study protocols were approved by the Stanford Animal Research Committee.
Optical Bioluminescence Imaging of ES Cell Transplantation
Cardiac bioluminescence imaging was performed with the Xenogen In Vivo Imaging System. After intraperitoneal injection of the reporter probe D-luciferin (375 mg/kg body weight), animals were imaged for 30 minutes with 1-minute acquisition intervals. The same rats were scanned repetitively for a 4-week period according to the specific study design. Bioluminescence was quantified in units of maximum photons per second per centimeter squared per steradian (P · s1 · cm2 · sr1) as described previously.10
Small-Animal PET Imaging of ES Cell Transplantation
Cardiac PET imaging was acquired with the P4 Concorde MicroPET system. Animals were injected with the reporter probe [18F]-FHBG (0.92±0.19 mCi), and images from 60 to 75 minutes after injection were reconstructed by filtered back-projection algorithm as described. Regions of interest (ROIs) were drawn over the anterolateral wall (horizontal view). The counts per pixel per minute were converted to counts per milliliter per minute with a calibration constant obtained from scanning a cylindrical phantom. The ROI counts per milliliter per minute were converted to counts per gram per minute (assuming a tissue density of 1 g/mL) and divided by the injected dose to obtain an image ROI-derived [18F]-FHBG percentage injected dose per gram of heart (% ID/g) as described previously.10 With the animals kept in the same position, [18F]-FDG (1.06±0.32 mCi) was injected intravenously to acquire the myocardial image. Afterward, both the [18F]-FHBG and [18F]-FDG images were overlaid as a fusion image with ASIPro VM software.
Postmortem Immunohistochemical Stainings
After imaging, all animals were euthanized by protocols approved by the Stanford Animal Research Committee. Explanted hearts and extracardiac teratomas were routinely processed for hematoxylin-and-eosin staining. Slides were interpreted by an expert cardiac pathologist blinded to the study (A.J.C.).
Statistical Analysis
Data are given as mean±SD. For statistical analysis, the 2-tailed Student t test was used. Differences were considered significant at P<0.05. The authors had full access to the data and take full responsibility for its integrity. All authors have read and agree to the manuscript as written.
| Results |
|---|
|
|
|---|
|
Reporter Genes and Reporter Probes Do Not Affect ES Cell Viability and Proliferation
Reporter genes have been used to track tumor metastasis in the oncology literature,19 but few studies have addressed potential adverse cellular effects. To study this issue, we examined control ES and ES-TF cell viability and proliferation at several time points and observed no significant changes between the 2 populations (Figures 2a and 2b). We also incubated ES-TF cells with combined D-luciferin and [18F]-FHBG, which are reporter probes for fluc and ttk reporter genes, respectively. The ES-TF cells were exposed for 6 hours on a weekly basis over a month to simulate the longitudinal imaging protocol. Likewise, there were no significant adverse cellular effects (Figure 2c). By our estimate, the dosage of D-luciferin (100 µmol/L) and [18F]-FHBG (100 µCi) used for cell culture experiments would be equivalent to &5x peak serum levels of reporter probes used for in vivo imaging. Finally, we separately transduced 3 other cell lines (rat embryonic H9c2 cardiomyoblast, mouse C2C12 myoblast, and mouse H1 atrial myocyte) with the TF reporter gene and did not notice any significant cellular effects (data not shown).
|
TF Reporter Gene Expression Does Not Affect ES Cell Differentiation Into Cardiomyocytes
In the literature, both human and murine ES cells have well-documented differentiation and replication capacities.20,21 We examined whether the TF reporter gene could adversely affect ES cell differentiation. After 7 to 10 days of differentiation, beating cardiomyocytes were clearly visible in ES-TF cells (Data Supplement Movie). At day 12 and day 20, the beating rates per minute were similar between control ES (71±19 and 153±33 bpm) and ES-TF cells (64±17 and 143±54 bpm; P=NS), which suggests that the cardiomyocyte chronotropicity was not affected (Figure 3a). Next, we used RT-PCR analysis and showed that the TF reporter gene did not affect the expression of stem cell marker (Oct4), early cardiac-specific transcriptional factor (Nkx2.5), or ventricular chamberspecific genes (ß-MHC or MLC2v; Figure 3b). To confirm that the levels of reporter gene activities correlated with cell numbers, ES cells (1x105 to 2x107) were assayed for fluc and ttk enzyme activities. Overall, there was a robust relationship between cell number versus fluc (r2=0.93) and ttk (r2=0.90), as well as fluc versus ttk (r2=0.84; Figures 3c through 3f).
|
Imaging ES Cell Survival, Proliferation, and Migration in Living Mice
To assess ES cell engraftment, stably transduced ES-TF cells were transplanted into athymic nude rat hearts (n=12). Noninvasive imaging was performed for 4 weeks with the bioluminescence charge-coupled device (CCD) camera and small-animal PET scanner (Figure 4a). At day 4, the bioluminescence and PET signals in study animals were 3.7x107±5.8x106 P · s1 · cm2 · sr and 0.08±0.03% ID/g, respectively (P<0.05 versus control). Both signals increased progressively from week 1 to week 4, which indicated ES cell survival and proliferation in the host (Figure 4b). Cell proliferation was most robust from week 2 to 3, with a 295±11% increase in cell imaging signals. Quantification of cell signal activity showed a robust correlation between bioluminescence and PET imaging, which is expected because the 2 reporter genes are linked and expressed as fusion proteins with preserved fluc and ttk activities (r2=0.94; Figure 4c). Likewise, there was a robust correlation between in vivo bioluminescence and in vitro fluc enzyme assay (r2=0.95), as well as in vivo PET image and ex vivo ttk enzyme assay (r2=0.91). In contrast, background signals of 3.2x104±3.5x103 P · s1 · cm2 · sr and 0.03+0.01% ID/g were seen in control animals for all time points. To further define the location of ES cell survival within the myocardium, animals underwent [18F]-FHBG reporter probe imaging followed by [18F]-FDG myocardial viability imaging. Fusion of the 2 images allowed identification of transplanted ES cells in detailed anatomic and tomographic resolution (Figures 5a and 5b). Because the small-animal PET scanner is simply a miniaturized version of the clinical PET scanner, similar studies should be feasible in humans using PET or PET-CT studies in the future.
|
|
ES CellDerived Teratoma Formation Can Be Selectively Ablated by Ganciclovir Therapy
The possibility of teratoma formation after transplantation poses a daunting challenge for clinical application of ES cells. To date, no study has addressed this issue from an imaging standpoint. We hypothesized that a PET reporter gene (ttk) could also serve as a suicide gene using ganciclovir treatment. Longitudinal imaging was performed in another group of animals (n=8). Animals were randomized into an experimental group treated with intraperitoneal injection of ganciclovir (50 mg/kg twice daily; n=4) versus a control group treated with saline (1 mL/kg twice daily; n=4) starting at week 3 (Figure 6a). At week 5, none of the ganciclovir-treated animals developed teratomas, whereas all of the saline-treated animals showed intracardiac and extracardiac signals. These imaging signals were confirmed to be teratomas by postmortem histology (Figure 6b). The teratomas were predominately solid with intermixed areas of endodermal, mesodermal, and ectodermal differentiation.
|
| Discussion |
|---|
|
|
|---|
Taking advantage of the strengths and weaknesses of different modalities, we used a novel TF reporter gene with the following logic. The mrfp allows imaging at the single-cell level by fluorescence microscopy and isolation of stable clonal population by FACS. The fluc is used for high-throughput bioluminescence imaging of cell survival, proliferation, and migration in small animals at relatively low cost per scan. Both fluorescence and bioluminescence imaging are based on low-energy photons (2 to 3 electronvolts [ev]), which become attenuated within deep tissues. Therefore, PET imaging, with its high-energy photons (511 kev), is more suitable for future clinical application. The PET reporter gene (ttk) used in the present study is an improved version of the herpes simplex virus mutant thymidine kinase (HSV1-sr39tk).10 It has a deletion in the first 135 bp that contains the nuclear localization signal. The ttk enzyme accumulates more in the cytoplasm rather than the nucleus and results in less cellular toxicity and improved image-signal activity.12 Compared with MRI, the detection threshold of PET is &7 log order more sensitive (104 versus 1011 mol/L, respectively),19 which is one of the reasons why PET imaging of reporter gene expression has now been successfully translated into clinical trials involving patients with recurrent glioblastoma23 and hepatocellular carcinoma.24
Previously, we had used E1-deleted adenovirus carrying a single reporter gene to transiently transduce embryonic rat H9c2 cardiomyoblasts.10 This was not the ideal design for several reasons. Despite deletion of the E1 region, leaky expression of immunogenic adenoviral proteins occurs, which could lead to host immune response against H9c2 cells expressing the reporter gene.25 Second, the adenoviral transduction leads to episomal gene expression, because the reporter gene is not integrated into the chromatin of mother or daughter cells. This can be a severe limitation if the desired goal of noninvasive imaging is to track stem cell survival and proliferation longitudinally. Consequently, neither radiolabeling nor ferromagnetic imaging could achieve either purpose, because they are not genetic-based markers as discussed previously.79 Because of these drawbacks, we have now switched our delivery system from adenovirus- to lentivirus-based vectors in most of our molecular imaging applications. Lentiviral vectors have several advantages: They can stably integrate into the cell chromatin with minimal cytotoxicity, infect dividing and nondividing cells, and are not subjected to gene silencing.17
Another important question is whether reporter genes would affect cellular traits such that future clinical applications may be hampered. We examined ES cell proliferation and viability and observed no significant changes between control ES and ES-TF populations. Likewise, we confirmed that the TF reporter gene did not inhibit ES cell differentiation into cardiomyocytes based on RT-PCR analysis of cardiac-specific transcriptional factors and ventricular chamberspecific genes. We also documented that the reporter probes (D-luciferin for fluc and [18F]-FHBG for ttk) caused no negative effects on ES-TF cells. Whereas the D-luciferin is unlikely to be used clinically because the low-energy photons are subject to attenuation within deeper tissues, the radiotracer [18F]-FHBG has been shown to be safe and pharmacokinetically stable in human volunteer subjects.26 Importantly, the Food and Drug Administration has recently approved [18F]-FHBG as an investigational new drug submitted by our group. Ongoing studies involving proteomic and genomic analysis will further characterize these observations.
The potential value of transplanting any type of stem cells also carries with it inherent risks because some of the transplanted cells may misbehave over a lifetime. This misbehavior could take the form of malignant stem cells that retain an unchecked growth rate or hyperfunctioning stem cells that oversupply regulated levels of missing proteins, such as insulin for diabetes treatment. In the present study, we noted that all of the animals transplanted with murine ES cells eventually developed intracardiac or extracardiac teratomas. In contrast, several groups have recently reported that transplantation of murine ES cells can improve cardiac function in mice and rats after myocardial infarction without any evidence of graft rejection or teratoma formation.4,2729 Although the exact reason for the discrepancy is unclear, it is possible that conventional histological samplings may not have identified all the potential sites of cell survival, migration, and subsequent teratoma formation. Thus, the results of the present study caution against the use of undifferentiated ES cells for myocardial regeneration. In parallel, the concept of introducing a reporter-suicide gene into stem cells that serve as a safety mechanism against cellular misbehavior is an attractive option and warrant further investigation. In this case, the ttk acts as a PET reporter gene when the [18F]-FHBG reporter probe is used in the picomolar to nanomolar concentrations, but it behaves like a suicide gene when ganciclovir (a guanosine analog that inhibits DNA replication of HSV-tk) is administered in milligram amounts to animals.30,31
In conclusion, we report the first proof-of-principle study for lentivirus-transduced ES cells that stably express fluorescence, bioluminescence, and PET reporter genes. We demonstrated how this novel molecular imaging platform can be used to monitor the kinetics of stem cell survival, proliferation, migration, and ablation of teratoma sites. The same approach could also permit experiments to evaluate the contribution of stem cells to organ function at different time points after stem cell delivery. Future imaging studies will need to specifically address the temporal sequence of ES cell differentiation into various tissue types, which perhaps may be monitored with tissue-specific promoters driving reporter genes. Likewise, the kinetics of cell survival will need to be assessed in different myocardial milieus (eg, normal versus acute infarction versus chronic ischemia). If the clinical potential of stem cell therapy is to be realized, we believe detailed evaluation of stem cell biology and physiology will most likely need to be conducted in vivo. For these reasons, noninvasive molecular imaging such as the techniques described by the present study will play an important role as stem cell biology moves from histology-based to living subjectbased systems in the future.
| Acknowledgments |
|---|
Disclosures
None.
| References |
|---|
|
|
|---|
2. Orlic D, Kajstura J, Chimenti S, Jakoniuk I, Anderson SM, Li B, Pickel J, McKay R, Nadal-Ginard B, Bodine DM, Leri A, Anversa P. Bone marrow cells regenerate infarcted myocardium. Nature. 2001; 410: 701705.[CrossRef][Medline] [Order article via Infotrieve]
3. Kocher AA, Schuster MD, Szabolcs MJ, Takuma S, Burkhoff D, Wang J, Homma S, Edwards NM, Itescu S. Neovascularization of ischemic myocardium by human bone-marrow-derived angioblasts prevents cardiomyocyte apoptosis, reduces remodeling and improves cardiac function. Nat Med. 2001; 7: 430436.[CrossRef][Medline] [Order article via Infotrieve]
4. Hodgson DM, Behfar A, Zingman LV, Kane GC, Perez-Terzic C, Alekseev AE, Puceat M, Terzic A. Stable benefit of embryonic stem cell therapy in myocardial infarction. Am J Physiol Heart Circ Physiol. 2004; 287: H471H479.
5. Wollert KC, Drexler H. Clinical applications of stem cells for the heart. Circ Res. 2005; 96: 151163.
6. Reinlib L, Field L. Cell transplantation as future therapy for cardiovascular disease? A workshop of the National Heart, Lung, and Blood Institute. Circulation. 2000; 101: E182E187.[Medline] [Order article via Infotrieve]
7. Hofmann M, Wollert KC, Meyer GP, Menke A, Arseniev L, Hertenstein B, Ganser A, Knapp WH, Drexler H. Monitoring of bone marrow cell homing into the infarcted human myocardium. Circulation. 2005; 111: 21982202.
8. Bulte JW, Kraitchman DL. Iron oxide MR contrast agents for molecular and cellular imaging. NMR Biomed. 2004; 17: 484499.[CrossRef][Medline] [Order article via Infotrieve]
9. Ahrens ET, Flores R, Xu H, Morel PA. In vivo imaging platform for tracking immunotherapeutic cells. Nat Biotechnol. 2005; 23: 983987.[CrossRef][Medline] [Order article via Infotrieve]
10. Wu JC, Chen IY, Sundaresan G, Min JJ, De A, Qiao JH, Fishbein MC, Gambhir SS. Molecular imaging of cardiac cell transplantation in living animals using optical bioluminescence and positron emission tomography. Circulation. 2003; 108: 13021305.
11. Boheler KR, Czyz J, Tweedie D, Yang HT, Anisimov SV, Wobus AM. Differentiation of pluripotent embryonic stem cells into cardiomyocytes. Circ Res. 2002; 91: 189201.
12. Ray P, De A, Min JJ, Tsien RY, Gambhir SS. Imaging tri-fusion multimodality reporter gene expression in living subjects. Cancer Res. 2004; 64: 13231330.
13. Lois C, Hong EJ, Pease S, Brown EJ, Baltimore D. Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors. Science. 2002; 295: 868872.
14. De A, Lewis XZ, Gambhir SS. Noninvasive imaging of lentiviral-mediated reporter gene expression in living mice. Mol Ther. 2003; 7: 681691.[CrossRef][Medline] [Order article via Infotrieve]
15. Maltsev VA, Wobus AM, Rohwedel J, Bader M, Hescheler J. Cardiomyocytes differentiated in vitro from embryonic stem cells developmentally express cardiac-specific genes and ionic currents. Circ Res. 1994; 75: 233244.
16. Pannell D, Osborne CS, Yao S, Sukonnik T, Pasceri P, Karaiskakis A, Okano M, Li E, Lipshitz HD, Ellis J. Retrovirus vector silencing is de novo methylase independent and marked by a repressive histone code. EMBO J. 2000; 19: 58845894.[CrossRef][Medline] [Order article via Infotrieve]
17. Pfeifer A, Ikawa M, Dayn Y, Verma IM. Transgenesis by lentiviral vectors: lack of gene silencing in mammalian embryonic stem cells and preimplantation embryos. Proc Natl Acad Sci U S A. 2002; 99: 21402145.
18. Ma Y, Ramezani A, Lewis R, Hawley RG, Thomson JA. High-level sustained transgene expression in human embryonic stem cells using lentiviral vectors. Stem Cells. 2003; 21: 111117.
19. Massoud TF, Gambhir SS. Molecular imaging in living subjects: seeing fundamental biological processes in a new light. Genes Dev. 2003; 17: 545580.
20. Evans MJ, Kaufman MH. Establishment in culture of pluripotential cells from mouse embryos. Nature. 1981; 292: 154156.[CrossRef][Medline] [Order article via Infotrieve]
21. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM. Embryonic stem cell lines derived from human blastocysts. Science. 1998; 282: 11451147.
22. Frangioni JV, Hajjar RJ. In vivo tracking of stem cells for clinical trials in cardiovascular disease. Circulation. 2004; 110: 33783383.
23. Jacobs A, Voges J, Reszka R, Lercher M, Gossmann A, Kracht L, Kaestle C, Wagner R, Wienhard K, Heiss WD. Positron-emission tomography of vector-mediated gene expression in gene therapy for gliomas. Lancet. 2001; 358: 727729.[CrossRef][Medline] [Order article via Infotrieve]
24. Penuelas I, Mazzolini G, Boan JF, Sangro B, Marti-Climent J, Ruiz M, Ruiz J, Satyamurthy N, Qian C, Barrio JR, Phelps ME, Richter JA, Gambhir SS, Prieto J. Positron emission tomography imaging of adenoviral-mediated transgene expression in liver cancer patients. Gastroenterology. 2005; 128: 17871795.[CrossRef][Medline] [Order article via Infotrieve]
25. Yang Y, Nunes FA, Berencsi K, Furth EE, Gonczol E, Wilson JM. Cellular immunity to viral antigens limits E1-deleted adenoviruses for gene therapy. Proc Natl Acad Sci U S A. 1994; 91: 44074411.
26. Yaghoubi S, Barrio JR, Dahlbom M, Iyer M, Namavari M, Satyamurthy N, Goldman R, Herschman HR, Phelps ME, Gambhir SS. Human pharmacokinetic and dosimetry studies of [(18)F]FHBG: a reporter probe for imaging herpes simplex virus type-1 thymidine kinase reporter gene expression. J Nucl Med. 2001; 42: 12251234.
27. Min JY, Yang Y, Converso KL, Liu L, Huang Q, Morgan JP, Xiao YF. Transplantation of embryonic stem cells improves cardiac function in postinfarcted rats. J Appl Physiol. 2002; 92: 288296.
28. Min JY, Yang Y, Sullivan MF, Ke Q, Converso KL, Chen Y, Morgan JP, Xiao YF. Long-term improvement of cardiac function in rats after infarction by transplantation of embryonic stem cells. J Thorac Cardiovasc Surg. 2003; 125: 361369.
29. Behfar A, Zingman LV, Hodgson DM, Rauzier JM, Kane GC, Terzic A, Puceat M. Stem cell differentiation requires a paracrine pathway in the heart. FASEB J. 2002; 16: 15581566.
30. Phelps ME. Inaugural article: positron emission tomography provides molecular imaging of biological processes. Proc Natl Acad Sci U S A. 2000; 97: 92269233.
31. Wu JC, Tseng JR, Gambhir SS. Molecular imaging of cardiovascular gene products. J Nucl Cardiol. 2004; 11: 491505.[CrossRef][Medline] [Order article via Infotrieve]
| Footnotes |
|---|
This article has been cited by other articles:
![]() |
D. L. Kraitchman and J. W.M. Bulte In Vivo Imaging of Stem Cells and Beta Cells Using Direct Cell Labeling and Reporter Gene Methods Arterioscler. Thromb. Vasc. Biol., July 1, 2009; 29(7): 1025 - 1030. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Willmann, R. Paulmurugan, M. Rodriguez-Porcel, W. Stein, T. J. Brinton, A. J. Connolly, C. H. Nielsen, A. M. Lutz, J. Lyons, F. Ikeno, et al. Imaging Gene Expression in Human Mesenchymal Stem Cells: From Small to Large Animals Radiology, July 1, 2009; 252(1): 117 - 127. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Cao, D. Sun, C. Li, K. Narsinh, L. Zhao, X. Li, X. Feng, J. Zhang, Y. Duan, J. Wang, et al. Long-term myocardial functional improvement after autologous bone marrow mononuclear cells transplantation in patients with ST-segment elevation myocardial infarction: 4 years follow-up Eur. Heart J., June 9, 2009; (2009) ehp220v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Li, T. Y.Y. Lai, Z. Sun, M. Han, E. Moriyama, B. Wilson, S. Fazel, R. D. Weisel, T. Yau, J. C. Wu, et al. Tracking cardiac engraftment and distribution of implanted bone marrow cells: Comparing intra-aortic, intravenous, and intramyocardial delivery. J. Thorac. Cardiovasc. Surg., May 1, 2009; 137(5): 1225 - 33.e1. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Li, A. Lee, M. Huang, H. Chun, J. Chung, P. Chu, G. Hoyt, P. Yang, J. Rosenberg, R. C. Robbins, et al. Imaging survival and function of transplanted cardiac resident stem cells. J. Am. Coll. Cardiol., April 7, 2009; 53(14): 1229 - 1240. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Cao, Z. Li, A. Lee, Z. Liu, K. Chen, H. Wang, W. Cai, X. Chen, and J. C. Wu Noninvasive De novo Imaging of Human Embryonic Stem Cell-Derived Teratoma Formation Cancer Res., April 1, 2009; 69(7): 2709 - 2713. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Wang, J. E. Dennis, A. Awadallah, L. A. Solchaga, J. Molter, Y. Kuang, N. Salem, Y. Lin, H. Tian, J. A. Kolthammer, et al. Transcriptional profiling of human mesenchymal stem cells transduced with reporter genes for imaging Physiol Genomics, March 3, 2009; 37(1): 23 - 34. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Qiao, H. Zhang, Y. Zheng, D. E. Ponde, D. Shen, F. Gao, A. B. Bakken, A. Schmitz, H. F. Kung, V. A. Ferrari, et al. Embryonic Stem Cell Grafting in Normal and Infarcted Myocardium: Serial Assessment with MR Imaging and PET Dual Detection Radiology, March 1, 2009; 250(3): 821 - 829. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nahrendorf, D. E. Sosnovik, B. A. French, F. K. Swirski, F. Bengel, M. M. Sadeghi, J. R. Lindner, J. C. Wu, D. L. Kraitchman, Z. A. Fayad, et al. Multimodality Cardiovascular Molecular Imaging, Part II Circ Cardiovasc Imaging, January 1, 2009; 2(1): 56 - 70. [Full Text] [PDF] |
||||
![]() |
A. E. Conway, A. Lindgren, Z. Galic, A. D. Pyle, H. Wu, J. A. Zack, M. Pelligrini, M. A. Teitell, and A. T. Clark A Self-Renewal Program Controls the Expansion of Genetically Unstable Cancer Stem Cells in Pluripotent Stem Cell-Derived Tumors Stem Cells, January 1, 2009; 27(1): 18 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Huang, D. A. Chan, F. Jia, X. Xie, Z. Li, G. Hoyt, R. C. Robbins, X. Chen, A. J. Giaccia, and J. C. Wu Short Hairpin RNA Interference Therapy for Ischemic Heart Disease Circulation, September 30, 2008; 118(14_suppl_1): S226 - S233. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-C. Hung, Y. Suzuki, T. Urashima, A. Caffarelli, G. Hoyt, A. Y. Sheikh, A. C. Yeung, I. Weissman, R. C. Robbins, J. M. Bulte, et al. Multimodality Evaluation of the Viability of Stem Cells Delivered Into Different Zones of Myocardial Infarction Circ Cardiovasc Imaging, July 1, 2008; 1(1): 6 - 13. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Smart and P. R. Riley The Stem Cell Movement Circ. Res., May 23, 2008; 102(10): 1155 - 1168. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Li, Y. Suzuki, M. Huang, F. Cao, X. Xie, A. J. Connolly, P. C. Yang, and J. C. Wu Comparison of Reporter Gene and Iron Particle Labeling for Tracking Fate of Human Embryonic Stem Cells and Differentiated Endothelial Cells in Living Subjects Stem Cells, April 1, 2008; 26(4): 864 - 873. [Abstract] [Full Text] [PDF] |
||||
![]() |
J Knuuti and F M Bengel Positron emission tomography and molecular imaging Heart, March 1, 2008; 94(3): 360 - 367. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Parolini, F. Alviano, G. P. Bagnara, G. Bilic, H.-J. Buhring, M. Evangelista, S. Hennerbichler, B. Liu, M. Magatti, N. Mao, et al. Concise Review: Isolation and Characterization of Cells from Human Term Placenta: Outcome of the First International Workshop on Placenta Derived Stem Cells Stem Cells, February 1, 2008; 26(2): 300 - 311. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Zhang and J. C. Wu Comparison of Imaging Techniques for Tracking Cardiac Stem Cell Therapy J. Nucl. Med., December 1, 2007; 48(12): 1916 - 1919. [Full Text] [PDF] |
||||
![]() |
Z. Love, F. Wang, J. Dennis, A. Awadallah, N. Salem, Y. Lin, A. Weisenberger, S. Majewski, S. Gerson, and Z. Lee Imaging of Mesenchymal Stem Cell Transplant by Bioluminescence and PET J. Nucl. Med., December 1, 2007; 48(12): 2011 - 2020. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Ebert, D. G. Taylor, H.-L. Nguyen, D. P. Kodack, R. J. Beyers, Y. Xu, Z. Yang, and B. A. French Noninvasive Tracking of Cardiac Embryonic Stem Cells In Vivo Using Magnetic Resonance Imaging Techniques Stem Cells, November 1, 2007; 25(11): 2936 - 2944. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. Sheikh, S.-A. Lin, F. Cao, Y. Cao, K. E.A. van der Bogt, P. Chu, C.-P. Chang, C. H. Contag, R. C. Robbins, and J. C. Wu Molecular Imaging of Bone Marrow Mononuclear Cell Homing and Engraftment in Ischemic Myocardium Stem Cells, October 1, 2007; 25(10): 2677 - 2684. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Li, J. C. Wu, A. Y. Sheikh, D. Kraft, F. Cao, X. Xie, M. Patel, S. S. Gambhir, R. C. Robbins, J. P. Cooke, et al. Differentiation, Survival, and Function of Embryonic Stem Cell Derived Endothelial Cells for Ischemic Heart Disease Circulation, September 11, 2007; 116(11_suppl): I-46 - I-54. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Wu, F. M. Bengel, and S. S. Gambhir Cardiovascular Molecular Imaging Radiology, August 1, 2007; 244(2): 337 - 355. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nahrendorf, C. Badea, L. W. Hedlund, J.-L. Figueiredo, D. E. Sosnovik, G. A. Johnson, and R. Weissleder High-resolution imaging of murine myocardial infarction with delayed-enhancement cine micro-CT Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H3172 - H3178. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Ponomarev, M. Doubrovin, A. Shavrin, I. Serganova, T. Beresten, L. Ageyeva, C. Cai, J. Balatoni, M. Alauddin, and J. Gelovani A Human-Derived Reporter Gene for Noninvasive Imaging in Humans: Mitochondrial Thymidine Kinase Type 2 J. Nucl. Med., May 1, 2007; 48(5): 819 - 826. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. C. Cho, Y. Kashiwakura, and E. Marban Creation of a Biological Pacemaker by Cell Fusion Circ. Res., April 27, 2007; 100(8): 1112 - 1115. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Ray, R. Tsien, and S. S. Gambhir Construction and Validation of Improved Triple Fusion Reporter Gene Vectors for Molecular Imaging of Living Subjects Cancer Res., April 1, 2007; 67(7): 3085 - 3093. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L.M.A. Beeres, F. M. Bengel, J. Bartunek, D. E. Atsma, J. M. Hill, M. Vanderheyden, M. Penicka, M. J. Schalij, W. Wijns, and J. J. Bax Role of Imaging in Cardiac Stem Cell Therapy J. Am. Coll. Cardiol., March 20, 2007; 49(11): 1137 - 1148. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Behfar, C. Perez-Terzic, R. S. Faustino, D. K. Arrell, D. M. Hodgson, S. Yamada, M. Puceat, N. Niederlander, A. E Alekseev, L. V. Zingman, et al. Cardiopoietic programming of embryonic stem cells for tumor-free heart repair J. Exp. Med., February 19, 2007; 204(2): 405 - 420. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zhou, P. D. Acton, and V. A. Ferrari Imaging Stem Cells Implanted in Infarcted Myocardium J. Am. Coll. Cardiol., November 21, 2006; 48(10): 2094 - 2106. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2006 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |