Published online before print February 6, 2006, doi: 10.1161/CIRCULATIONAHA.105.568162
(Circulation. 2006;113:834-841.)
© 2006 American Heart Association, Inc.
Molecular Cardiology |
Extracellular Matrix Metalloproteinase Inducer Regulates Matrix Metalloproteinase Activity in Cardiovascular Cells
Implications in Acute Myocardial Infarction
From Deutsches Herzzentrum und Medizinische Klinik I, Klinikum rechts der Isar, Technische Universität München, München, Germany (R.S., N.J., Ö.B., S.T., A.S.); ProCorde GmbH, Martinsried, Germany (A.B., M.U.); Experimental Immunology Branch, National Cancer Institute, National Institutes of Health, Bethesda, Md (T.C.); Department of Cell Biology and Anatomy, Medical University of South Carolina, Charleston (B.P.T.); and Medizinische Klinik III, Eberhard-Karls Universität Tübingen, Tübingen, Germany (M.G., A.E.M.).
Correspondence to Andreas E. May, MD, Medizinische Klinik III, Otfried-Müller Strasse 10, Universität Tübingen, 72076 Tübingen, Germany. E-mail andreas.may{at}med.uni-tuebingen.de
Received June 30, 2005; revision received October 25, 2005; accepted December 9, 2005.
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Background— Matrix metalloproteinases (MMPs) are thought to promote progression of atherosclerosis and cardiovascular complications such as plaque rupture. It has been suggested that, on tumor cells, the extracellular MMP inducer (EMMPRIN) is involved in MMP synthesis by as yet unknown mechanisms. On cardiovascular cells, regulation of EMMPRIN in vivo or any functional relevance for MMP induction in vitro has not yet been studied. Thus, we studied EMMPRIN expression on monocytes in acute myocardial infarction (MI) and its potential relevance for MMP activation.
Methods and Results— In 20 patients with acute MI, surface expression of EMMPRIN was significantly enhanced on monocytes compared with in 20 patients with chronic stable angina. EMMPRIN upregulation was associated with increased expression of the membrane type 1 MMP (MT1-MMP) on monocytes (flow cytometry) as well as MMP-9 activity (gelatin zymography) in the plasma. At 6 months after successful revascularization, EMMPRIN, MT1-MMP, and MMP-9 had normalized. The secretion of MMP-9 by monocytes was induced by monocyte adhesion to immobilized recombinant EMMPRIN or to EMMPRIN-transfected Chinese hamster ovary cells. Moreover, adherent EMMPRIN-transfected monocytic cells stimulated MMP-2 activity of human vascular smooth muscle cells. Gene silencing of EMMPRIN by small-interfering RNA hindered lipopolysaccharide-induced monocyte secretion of MMP-9, indicating a predominant role of EMMPRIN in MMP-9 induction.
Conclusions— EMMPRIN and MT1-MMP are upregulated on monocytes in acute MI. During cellular interactions, EMMPRIN stimulates MMP-9 in monocytes and MMP-2 in smooth muscle cells, indicating that EMMPRIN may display a key regulatory role for MMP activity in cardiovascular pathologies.
Key Words: atherosclerosis • leukocytes • metalloproteinases • myocardial infarction • plaque
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Atherosclerosis is an inflammatory progressive disease of the vascular wall. The rupture of the atherosclerotic plaque represents a key process that initiates acute myocardial infarction (MI).1 The vulnerability of plaques is characterized by the accumulation of inflammatory cells and matrix metalloproteinases (MMPs) that degrade the fibrous cap of the plaque.2,3 Within vulnerable plaques, the membrane type 1 MMP (MT1-MMP, MMP-14), MMP-2, and MMP-9 seem to be the predominant MMPs.4 The major sources for these MMPs are immigrated monocytes/macrophages and vascular smooth muscle cells (SMCs).5
Clinical Perspective p 841
MMPs become activated by a complex activation cascade: the proforms of soluble MMPs become activated by soluble proteases such as plasmin or other MMPs or by binding to membrane-anchored MMPs (membrane-type MMPs [MT-MMPs]).6,7 For example, the MT1-MMP functions both as a protease and as a receptor and activator of MMP-2. Thereby, MT1-MMP facilitates cell-associated proteolysis with local protease activity; moreover, as recently shown, MT1-MMP facilitates monocyte migration and transmigration through activated endothelial cells.8 MMP-9 is highly expressed and secreted by activated monocytes. In acute MI, MMP-9 has been found to be secreted into the plasma and therefore can serve as a marker of acute MI.9
The synthesis of these MMPs appears to be affected by the so-called extracellular MMP inducer (EMMPRIN, CD147). EMMPRIN is a 58-kDa cell surface glycoprotein of the immunoglobulin superfamily.10 Originally, EMMPRIN expression has been described on tumor cells, where it can induce the synthesis of MT1-MMP, MMP-9, and MMP-2 in adjacent fibroblasts through homotypic EMMPRIN-EMMPRIN interactions.11–13 However, the mechanism of MMP regulation by EMMPRIN is poorly understood. Recently, EMMPRIN expression has been described on macrophages in vitro and in human atheroma.14 In vivo, any regulation of EMMPRIN on cardiovascular cells has not been described thus far.
Therefore, we studied whether EMMPRIN expression on monocytes is regulated in vivo under inflammatory conditions such as acute MI and its potential association with MT1-MMP and MMP-9. Moreover, we investigated whether changes in EMMPRIN expression are of functional relevance for MMP activation.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Patients
The study group comprised 20 patients presenting with acute MI (Killip class I to IV) within 24 hours after the onset of pain. The diagnosis was based on a history of prolonged ischemic chest pain, ST-segment elevations, and elevation of creatine kinase >240 U/mL with a concomitant rise in MB isoenzyme. We included patients who met the first criterion and at least 1 of the other criteria. Blood samples were obtained on admission before revascularization by stent placement. All patients with acute MI were treated by percutaneous coronary intervention with bare metal stent placement. Successful revascularization was defined as Thrombolysis in Myocardial Infarction (TIMI) flow grade III in coronary angiography after stent placement. Twenty patients with chronic stable angina (CSA) and angiographically proven coronary artery disease and 20 healthy volunteers recruited from the hospital staff were studied as control groups. Patients with noncardiac diseases that may have affected results, such as inflammatory disorders, cancer, or infection, were excluded. The baseline clinical, demographic, and angiographic data in the 2 patient groups are shown in Table 1. Approval for blood sampling was obtained from the institutional ethics committee of Technische Universität München. Informed consent was provided according to the Declaration of Helsinki.
|
Cells
Human monocytes were isolated as described.15 Briefly, mononuclear cells were isolated by centrifugation of citrate-phosphate-dextrose-adenine–anticoagulated blood on a Ficoll gradient (20 minutes, 800g, 4°C). Mononuclear cells were cultured on plastic dishes (0.5x106 cells/mL) in VLE-RPMI-1640 (Very-Low-Endotoxin RPMI, Biochrom) supplemented with 10% low-toxin fetal calf serum (Clonetics). After 24 hours, nonadherent cells were removed by gentle washing. The remaining cells (85% to 90% CD14-positive monocytes) were resuspended with the use of EDTA (0.05% PBS) and washed in VLE-RPMI. The cell line MonoMac6 represents human monocytic cells with a closely related pattern of surface receptors and monocytelike behavior.16 The cells were cultured in supplemented VLE-RPMI-1640. Human coronary artery SMCs and SMC basal medium were from Clonetics. Cells were used after 2 to 5 passages. Chinese hamster ovary (CHO) cells were stably transfected with EMMPRIN as described.17 EMMPRIN surface expression was routinely confirmed before coculture experiments by real-time polymerase chain reaction (PCR) and Western blot.
Flow Cytometry
Flow cytometry was performed as described18 with the use of primary mouse anti-human monoclonal antibodies anti-EMMPRIN (clone 1G6.2, from Chemicon) or anti–MT1-MMP (clone 114-1F2, from Oncogene).
Gelatin Zymography
Gelatin zymography was performed as described.19 Precast SDS gels containing 10% gelatin were from Invitrogen. Equal amounts of plasma from patients with acute MI, patients with CSA, or healthy controls or cell supernatants were loaded on the gels. After electrophoresis, renaturation, and incubation of the gels for 12 hours at 37°C, gelatinolytic activity of MMP-2 and MMP-9 was detected as transparent bands on the Coomassie brilliant blue–stained gels. Gelatin zymographies were quantified (optical density) by ImageJ software.
Real-Time Reverse Transcriptase–PCR
Total RNA was extracted from cells with the use of the RNeasy Mini Kit (Qiagen). Contaminating DNA was removed by the Message Clean kit (Gene Hunter). RNA was reverse-transcribed with the use of Omniscript reverse transcriptase (Qiagen) and random hexamers (GIBCO). Real-time PCR was performed by the SybrGreen-PCR core reagents kit according to the manufacturer’s instructions (Applied Biosystems) with the use of the primers shown in Table 2.
|
Small-Interfering RNA–Mediated Gene Silencing of EMMPRIN
Small-interfering RNA (siRNA) for EMMPRIN exon sequence and nonsilencing control siRNA were obtained from Qiagen (2-For-Silencing). The following EMMPRIN duplex was used: sense, 5'-(CGG CCA UGC UGG UCU GCA A)dTdT-3'; antisense, 5'-(UUG CAG ACC AGC AUG GCC G)dTdC-3'. Nonsilencing control siRNA (Qiagen) was used as negative control. Transfections were performed in 24-well plates with a complex of 1 µg siRNA (20 µmol/L) and 6 µL Effectene Transfection Reagent (Qiagen) 48 hours before the experiments. Successful suppression of EMMPRIN surface expression was routinely confirmed by FACS analysis.
Cloning of EMMPRIN
The EMMPRIN was amplificated from a human heart cDNA library (Clontech) by PCR with the use of the forward primer 5'-gcggggggtaccaccatggcggctgcgctgttcgtg-3' and the reverse primer 5'- gcggggctcgagtcacttgtcgtcgtcgtccttatagtcggaagagttcctctggcgg-3' (56°C annealing temperature, 24 cycles). The PCR fragment was cloned in the plasmid pADTrack CMV with KpnI/XhoI to get pADTrack CMV EMMPRIN, the sequence was checked by sequencing, and the expression of the recombinant EMMPRIN was tested by Western blot with the use of peroxidase-conjugated anti-flag M2 antibody (Sigma-Aldrich).
Adenovirus Generation
For recombination, electrocompetent Escherichia coli BJ5183 (Stratagene) was cotransformed with 1 µg of PmeI linearized plasmid pADTrack CMV EMMPRIN and 0.1 µg pAdeasy1 at 2500 V, 200 
, and 25 µFD (E coli pulser; Bio-Rad). The positive plasmid pADeasy1 EMMPRIN was retransformed in E coli DH5
and amplified. For transfection (effectene transfection reagent; Qiagen) of 293 cells, pADeasy1 EMMPRIN was digested with PacI. After 7 days, cells were harvested, the pellet was resuspended in PBS, and the cells were lysed. After centrifugation, the lysate was stored at –80°C. For plaque selection of recombinant virus, infected 293 cells were overlayed with growth medium containing 0.5% agarose (1:1 mix of modified Eagle’s medium 2x [GIBCO Life Technologies] supplemented with 20% serum, 2x penicillin/streptomycin, 2x L-glutamine, and 1% agarose in water 1%). Five to 14 days after infection, the cell layer was monitored for formation of plaques that were picked, resuspended in 0.5 mL PBS, and stored at –80°C. The plaques were used for further amplification rounds on 293 cells.
Generation of Chimeric EMMPRIN-Fc Fusion Protein
CHO codon–optimized Fc was synthesized (Medigenomix) and cloned KpnI/EcoRV in the plasmid pcDNA5-FRT (Invitrogen; KpnI/XhoI bunded) to get pcDNA-FRT Fc opt. For cloning of the extracellular domain of human EMMPRIN, a PCR was performed with the primers 5'-gcggggggtaccaccatggcggctgcgctgttcgtg-3' and 5'-gcgggggcggccgccgtggctgcgcacgcggag-3' with the use of pADTrack CMV EMMPRIN as template DNA at 56°C annealing temperature and 24 cycles. The PCR fragment was cloned in the plasmid pcDNA-FRT Fc with KpnI/NotI to get pcDNA-FRT EMMPRIN-Fc opt and checked by sequencing.
Cloning of Human Fc Fragments
For cloning of a control fragment, the leader peptide of CD40 was amplificated from a human heart cDNA library (Clontech, Palo Alto, Calif) by PCR with the use of the primer 5'-gcggggggtaccaccatggttcgtctgcctctgc-3' and 5'-gcgggggcggccgccgggtggttctggatggac-3'. The PCR fragment was cloned in the plasmid pcDNA-FRT Fc with KpnI/NotI and checked by sequencing.
Western Blot
Cells were lysed in RIPA buffer (20 mmol/L Tris-HCl, pH 8.0, 150 mmol/L NaCl, 1% NP-40, 0.5 deoxycholate, 0.1% SDS, 1 mmol/L EDTA, 10 µg/mL leupeptin, 2 µg/mL aprotinin, 1 mmol/L phenylmethylsulfonyl fluoride). Protein was quantified with the use of Bio-Rad protein assay reagents. Cell lysates were subjected to precasted 10% SDS-PAGE gels under reducing conditions. Prestained molecular markers (Invitrogen) were used to estimate the molecular weight of samples. Proteins were transferred to Hybond-ECL membrane (Amersham-Pharmacia) in running buffer with 20% methanol. After nonspecific sites were blocked, blots were incubated with mouse monoclonal antibodies anti-human EMMPRIN (HIM6, Becton Dickinson, 10 µg/mL), anti-human MT1-MMP (clone 114-1F2, Oncogene, 10 µg/mL), anti-human MMP-9 (polyclonal, Chemicon, 10 µg/mL), anti-human MMP-2 (42-5D1, Calbiochem, 10 µg/mL), or anti-human ß-actin (AC 15, Sigma-Aldrich, 640 ng/mL). After they were washed, blots were incubated with biotinylated secondary anti-mouse antibody (Santa Cruz, 200 ng/mL), and, finally, chemiluminescence staining was performed by Western Blotting Luminol Reagent (Santa Cruz), according to the manufacturer’s instructions. Western blots were quantified (optical density) by ImageJ software.
Cell-to-Cell Adhesion
EMMPRIN-transfected CHO cells or nontransfected CHO cells were cultured in 6-well plates until confluence, fixed with 4% paraformaldehyde, and washed 3 times with PBS. Isolated human monocytes (1x106 per well) were allowed to adhere to the fixed CHO cells. After 12 hours, supernatants were harvested for gelatin zymography to determine EMMPRIN-induced MMP-9 activity of monocytes. In other experiments, MonoMac6 cells were infected with increasing amounts of adenovirus EMMPRIN vector (multiplicity of infection [MOI] 0, 10, 50). Successful overexpression of EMMPRIN was confirmed by Western blot and real-time reverse transcriptase–PCR. EMMPRIN-overexpressing monocytic cells were fixed with 4% paraformaldehyde, washed, and coincubated with cultivated human vascular SMCs. After 12 hours, cell supernatants were harvested for gelatin zymography to determine EMMPRIN-induced MMP-2 activity of SMCs.
Cell Adhesion to Recombinant EMMPRIN-Fc Fusion Protein
SMCs or isolated monocytes were allowed to adhere to immobilized acellular EMMPRIN-Fc fusion protein (5 µg/mL) and to Fc fragments of human IgG (2 µg/mL) as a negative control with and without additional specific activity–blocking anti–MT1-MMP monoclonal antibody (5 µg/mL) for 24 hours. Afterward, cell supernatants were subjected to Western blot analysis and gelatin zymography.
Statistical Analysis
Results with normally distributed continuous variables were reported as mean±SD and were analyzed by unpaired t test or ANOVA followed by the Scheffé test, as appropriate. Surface expressions of MT1-MMP and EMMPRIN were compared by simple linear regression analysis. In general, P<0.05 was regarded as significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
EMMPRIN, MT1-MMP, and MMP-9 in Acute MI
Monocyte expressions of EMPPRIN and MT1-MMP were studied in patients presenting with acute MI (n=20) compared with patients with CSA and healthy control persons (n=20 each). Flow cytometric analysis revealed significantly enhanced surface expression of EMMPRIN in acute MI (Figure 1A), which was associated with enhanced surface expression of MT1-MMP (Figure 1B). Figure 1C demonstrates that EMMPRIN expression in acute MI correlates positively with MT1-MMP expression. Enhanced monocytic surface expression of EMMPRIN additionally was associated with increased MMP-9 activity in the plasma of patients with acute MI (Figure 1D; P<0.01). No differences of EMMPRIN and MT1-MMP surface expression were found between patients with CSA and healthy controls. At 6 months after successful revascularization, cell surface expressions of both EMMPRIN and MT1-MMP were found to be normalized (Figure 2A; P<0.05) in accordance with a normalization of the MMP-9 activity (Figure 2B). These data show for the first time that EMMPRIN is regulated on cardiovascular cells in vivo under pathophysiological conditions such as acute MI, which correlates positively with enhanced expression of MT1-MMP and MMP-9.
|
|
EMMPRIN Induces MMP-9 Secretion From Monocytes
On the basis of these findings, we studied the potential functional consequences of EMMPRIN regulation for MMP activity in vitro. We hypothesized that enhanced cellular expression of EMMPRIN (as found in acute MI) may regulate MMP expression and activity of monocytes. To test this, CHO cells were stably transfected with human EMMPRIN. Successful transfection was confirmed on the mRNA and protein level by real-time PCR (Figure 3A) and by Western blotting (Figure 3B). The cells were fixed with paraformaldehyde (4%) before coincubation with isolated human monocytes. After 12 hours of coincubation, cell culture supernatants were harvested and forwarded to gelatin zymography. Figure 3C shows enhanced MMP-9 activity of monocytes that are adherent to EMMPRIN-expressing CHO cells in comparison to nontransfected cells. These data indicate that cell surface–associated EMMPRIN induces MMP-9 secretion in adjacent monocytes during cellular interactions.
|
To further study the functional relevance of EMMPRIN in an isolated system, EMMPRIN was cloned, and recombinant chimeric Fc-EMMPRIN fusion protein was manufactured. Consistent with the adhesion experiments to cell-associated EMMPRIN, adhesion of human monocytes to the immobilized recombinant Fc-EMMPRIN strongly induced protein secretion and activity of MMP-9 (Figure 3D, 3E) compared with adhesion to immobilized Fc fragments or poly-L-lysine (not shown). Together, these results emphasize the ability of EMMPRIN to stimulate monocytic MMP-9 activity.
SMC Secretion of MMP-2 on Adhesion of EMMPRIN-Transfected Monocytes
Within the vulnerable atherosclerotic plaque, degradation of the protective fibrous cap is thought to also be affected by MMP activity of vascular SMCs, which produce substantial amounts of MMP-2. We therefore studied the impact of EMMPRIN-expressing monocytes on SMC secretion of MMP-2 during cellular interactions. Human monocytic MonoMac6 cells were transfected with increasing concentrations of EMMPRIN adenovirus (MOI 0, 10, 50), yielding increasing concentrations of EMMPRIN surface expression, as confirmed by Western blotting (Figure 4A). Nontransfected or transfected monocytic cells were fixed with paraformaldehyde (4%), washed, and coincubated with monolayers of human vascular SMCs. After 12 hours, cell culture supernatants were harvested and analyzed by gelatin zymography. In fact, we found an increased MT1-MMP surface expression of EMMPRIN-stimulated SMCs (data not shown) and enhanced MMP-2 protein secretion and activity of SMCs after cellular adhesion to EMMPRIN-transfected monocytic cells, which was in the range of maximum SMC stimulation achieved with lipopolysaccharide (Figure 4B). Moreover, specific activity–blocking anti–MT1-MMP monoclonal antibody revealed a crucial role for MT1-MMP in EMMPRIN-mediated MMP-2 activation (Figure 4C) within SMCs. These data indicate that enhanced expression of EMMPRIN on monocytes (as has been observed in acute MI) is operative and can induce MMP activity in adjacent cells of the vascular wall, eg, SMCs.
|
EMMPRIN Is Required for Induction of MT1-MMP and MMP-9 in Monocytes
These results encouraged us to further study the relevance of EMMPRIN within the complex activation cascade of MMPs. EMMPRIN gene silencing was performed with the use of siRNA as described in Methods. The lipopolysaccharide-induced increase of the mean fluorescence for EMMPRIN expression was only 52.5% in EMMPRIN siRNA–pretreated cells in comparison with the increase in control siRNA–treated monocytes. In accordance with our ex vivo data, we found that EMMPRIN gene silencing hindered an adequate induction of MT1-MMP surface expression in response to 12-hour stimulation with lipopolysaccharide (Figure 5A). MT1-MMP upregulation was inhibited by 42% (±28%). Consistently, analysis of cell culture supernatants revealed that lipopolysaccharide-induced secretion and activity of MMP-9 were primarily abrogated by EMMPRIN gene silencing (Figure 5B, 5C). The application of a control siRNA had no inhibitory effect. These data emphasize a predominant role of EMMPRIN for MMP activation in monocytes, suggesting that the presence of EMMPRIN is needed for MMP activation.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
MMPs make an essential contribution to the pathophysiology of atherosclerosis.2,3 Specifically, the presence of MT1-MMP, MMP-2, and MMP-9 within vascular walls has been linked to an unstable plaque phenotype, which is prone to rupture.9,20–22 Monocytes/macrophages and SMCs appear to represent the major sources of MMP activity within the plaque. The present study highlights the role of EMMPRIN in cardiovascular diseases. Specifically, our study shows for the first time that EMMPRIN is quantitatively upregulated on monocytes under pathophysiological conditions in vivo: EMMPRIN surface expression is enhanced in acute MI and normalizes after successful therapy. In vivo, EMMPRIN upregulation is accompanied by MT1-MMP upregulation and by enhanced plasma activity of MMP-9. The fact that EMMPRIN expression correlated with MT1-MMP expression suggests common activation pathways. In vitro, we have shown for the first time a functional relevance for EMMPRIN for both monocyte and SMC function: adhesion of EMMPRIN-transfected monocytic cells to vascular SMCs stimulated SMC secretion of MMP-2. Similarly, monocyte adhesion to EMMPRIN-transfected CHO cells or to immobilized recombinant EMMPRIN induced monocyte secretion and activity of MMP-9. Moreover, suppression of EMMPRIN by gene silencing abrogated the lipopolysaccharide-mediated induction of MT1-MMP and MMP-9 in monocytes, suggesting that the presence of EMMPRIN is required for MMP stimulation in monocytes. These data indicate that cellular upregulation of EMMPRIN in vivo (eg, in acute MI) may be operative and induce a cascade of MMP activation.
The role of EMMPRIN for MMP activation was described originally on tumor cells.10 EMMPRIN-expressing tumor cells appear to induce MMP-2, MMP-9, and MT1-MMP in adjacent fibroblasts by as yet unknown pathways.12 Additionally, the extent of cell surface expression of EMMPRIN on tumor cells is a marker of poor outcome in various tumors, eg, ovarian carcinoma.23,24 The potential role of EMMPRIN for cardiovascular pathologies has not yet been characterized. Previously, it was shown in vitro that EMMPRIN is upregulated on monocytes/macrophages by atherogenic stimuli such as modified LDL and during monocyte differentiation.25,26 In human atheroma, EMMPRIN has been histomorphologically identified and appeared to be colocalized with macrophages and MMP-9 activity, suggesting functional relevance.14 Our data indicate that the upregulation of EMMPRIN in acute MI may have multiple consequences. Because we could clearly demonstrate in vitro that intercellular interactions involving EMMPRIN induce MMPs in both monocytes (MMP-9) and SMCs (MMP-2), it is tempting to assume that EMMPRIN expression is functionally involved in the accompanying MT1-MMP expression and MMP-9 secretion in acute MI. However, the mechanism of how EMMPRIN may affect MMP activation in acute MI remains unclear. The fact that the hindering of EMMPRIN abrogates the induction of protein secretion and activity of MMP-9 by lipopolysaccharide suggests that EMMPRIN may not only directly induce MMPs as an extracellular inductor but may also represent a key element that is required for MMP induction.
Lately, MT1-MMP has been described as facilitating monocyte migration through activated endothelial cells in vitro.8 Our data suggest that EMMPRIN is crucially involved in MT1-MMP regulation and that MT1-MMP is involved in EMMPRIN-mediated MMP-2 activation within adjacent SMCs. Thus, EMMPRIN and MT1-MMP may allow monocyte migration into the subendothelial space. Within the vessel wall, cellular interactions with adjacent monocytes/macrophages or SMCs may stimulate a cascade of MMP activation involving MT1-MMP, MMP-2, and MMP-9 that may promote plaque progression and destabilization. Together, EMMPRIN may induce a vicious circle leading to extracellular matrix degradation within the atherosclerotic plaque.
Limitations
On admission, patients with CSA (compared with patients with acute MI) had preferably received specific therapy such as ACE inhibitors and statins. Obviously, we cannot fully exclude any influence of the medication on EMMPRIN and MMPs. However, we did not observe any significant differences in EMMPRIN expression or MMP activation in acute MI patients who were on ACE inhibitors or statins in comparison to acute MI patients without previous medication. In addition, we have not recognized any differences between the CSA group and healthy control persons (n=20), who did not take any medications (data not shown). Therefore, we are convinced that our findings are at least primarily caused by MI rather than medication.
Degradation of the extracellular matrix and MMP-facilitated migration of mononuclear cells are fundamental for the development of atherosclerosis, for plaque rupture, for restenosis after percutaneous coronary intervention, and for the inflammatory response to myocardial damage after ischemia and reperfusion.6 This study shows for the first time that EMMPRIN and MT1-MMP on monocytes may represent novel biomarkers of acute MI. EMMPRIN is essentially involved in MMP activation in monocytes and in vascular SMCs. Future studies must show whether EMMPRIN and MT1-MMP display targets for the prevention of unwanted MMP activity during cardiovascular processes.
|
Acknowledgments |
|---|
This work was supported by a grant to Dr May from the Wilhelm-Sander Stiftung (2004.801.1). We thank M. Hölderle for expert technical assistance and Dr G. Lehmann for statistical calculations. The authors had full access to the data and take full responsibility for its integrity. All authors have read and agree to the manuscript as written.
Disclosures
None.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Virmani R, Kolodgie FD, Burke AP, Farb A, Schwartz SM. Lessons from sudden coronary death: a comprehensive morphological classification scheme for atherosclerotic lesions. Arterioscler Thromb Vasc Biol. 2000; 20: 1262–1275.
2. Lusis AJ. Atherosclerosis. Nature. 2000; 407: 233–241.[CrossRef][Medline] [Order article via Infotrieve]
3. Libby P. Current concepts of the pathogenesis of acute coronary syndromes. Circulation. 2002; 104: 365–372.
4. Galis ZS, Sukhova GK, Lark MW, Libby P. Increased expression of matrix metalloproteinases and matrix degrading activity in vulnerable regions of human atherosclerotic plaques. J Clin Invest. 1994; 94: 2493–2503.[Medline] [Order article via Infotrieve]
5. Galis ZS, Sukhova GK, Kranzhofer R, Clark S, Libby P. Macrophage foam cells from experimental atheroma constitutively produce matrix degrading proteinases. Proc Natl Acad Sci U S A. 1995; 92: 402–406.
6. Galis ZS, Khatri JJ. Matrix metalloproteinases in vascular remodeling and atherogenesis: the good, the bad, and the ugly. Circ Res. 2002; 90: 251–262.
7. Rajavashisth TB, Xu XP, Jovinge S, Meisel S, Xu XO, Chai NN, Fishbein MC, Kaul S, Cercek B, Sharifi B, Shah PK. Membrane type 1 matrix metalloproteinase expression in human atherosclerotic plaques: evidence for activation by proinflammatory mediators. Circulation. 1999; 99: 3103–3109.
8. Matias-Roman S, Galvez BG, Genis L, Yanez-Mo M, de la Rosa G, Sanchez-Mateos P, Sanchez-Madrid F, Arroyo AG. Membrane type 1-matrix metalloproteinase is involved in migration of human monocytes and is regulated through their interaction with fibronectin or endothelium. Blood. 2005; 105: 3956–3964.
9. Kai H, Ikeda H, Yasukawa H, Kai M, Seki Y, Kuwahara F, Ueno T, Sugi K, Imaizumi T. Peripheral blood levels of matrix metalloproteases-2 and -9 are elevated in patients with acute coronary syndromes. J Am Coll Cardiol. 1998; 32: 368–372.
10. Caudroy S, Polette M, Nawrocki-Raby B, Cao J, Toole BP, Zucker S, Birembaut P. EMMPRIN-mediated MMP regulation in tumor and endothelial cells. Clin Exp Metastasis. 2002; 19: 697–702.[CrossRef][Medline] [Order article via Infotrieve]
11. Yang JM, Xu Z, Wu H, Zhu H, Wu X, Hait WN. Overexpression of extracellular matrix metalloproteinase inducer in multidrug resistant cancer cells. Mol Cancer Res. 2003; 1: 420–427.
12. Yan L, Zucker S, Toole BP. Roles of the multifunctional glycoprotein, EMMPRIN (basigin; CD147) in tumour progression. Thromb Haemost. 2005; 93: 199–204.[Medline] [Order article via Infotrieve]
13. Li R, Huang L, Guo H, Toole BP. Basigin (murine EMMPRIN) stimulates matrix metalloproteinase production by fibroblasts. J Cell Physiol. 2001; 186: 371–379.[CrossRef][Medline] [Order article via Infotrieve]
14. Major TC, Liang L, Xiaokong L, Rosebury W, Bocan T. Extracellular matrix metalloproteinase inducer (EMMPRIN) is induced upon monocyte differentiation and is expressed in human atheroma. Arterioscler Thromb Vasc Biol. 2002; 22: 1200–1207.
15. May AE, Redecke V, Grüner S, Schmidt R, Massberg S, Miethke T, Ryba B, Da Costa CP, Schömig A, Neumann FJ. Recruitment of Chlamydia pneumoniae–infected macrophages to the carotid artery wall in noninfected, nonatherosclerotic mice. Arterioscler Thromb Vasc Biol. 2003; 23: 789–794.
16. Ziegler-Heitbrock HW, Thiel E, Futterer A, Herzog V, Wirtz A, Riethmuller G. Establishment of a human cell line (MonoMac 6) with characteristics of mature monocytes. Int J Cancer. 1988; 41: 456–461.[Medline] [Order article via Infotrieve]
17. Guo H, Zucker S, Gordon MK, Toole BP, Biswas C. Stimulation of matrix metalloproteinase production by recombinant extracellular matrix metalloproteinase inducer from transfected Chinese hamster ovary cells. J Biol Chem. 1997; 272: 24–27.
18. May AE, Neumann FJ, Schomig A, Preissner KT. VLA-4 (4ß1) engagement defines a novel activation pathway for ß2-integrin dependent leukocyte adhesion involving the urokinase receptor. Blood. 2000; 96: 506–513.
19. May AE, Kalsch T, Massberg S, Herouy Y, Schmidt R, Gawaz M. Engagement of glycoprotein IIb/IIIa (alpha(IIb)beta3) on platelets upregulates CD40L and triggers CD40L-dependent matrix degradation by endothelial cells. Circulation. 2002; 106: 2111–2117.
20. Sukhova GK, Schonbeck U, Rabkin E, Schoen FJ, Poole AR, Billinghurst RC, Libby P. Evidence for increased collagenolysis by interstitial collagenases-1 and -3 in vulnerable human atheromatous plaques. Circulation. 1997; 99: 2503–2509.
21. Brown DL, Hibbs MS, Kearney M, Loushin C, Isner JM. Identification of 92-kD gelatinase in human coronary atherosclerotic lesions: association of active enzyme synthesis with unstable angina. Circulation. 1995; 91: 2125–2131.
22. Rajavashisth TB, Xu X-P, Jovinge S, Meisel S, Xu X-O, Chai N-N, Fishbein MC, Kaul S, Cercek B, Sharifi B, Shah PK. Membrane type 1 matrix metalloproteinase expression in human atherosclerotic plaques: evidence for activation by proinflammatory mediators. Circulation. 1999; 99: 3103–3109.
23. Bordador LC, Li X, Toole B, Chen B, Regezi J, Zardi L, Hu Y, Ramos DM. Expression of EMMPRIN by oral squamous cell carcinoma. Int J Cancer. 2000; 85: 347–352.[CrossRef][Medline] [Order article via Infotrieve]
24. Davidson B, Goldberg I, Berner A, Kristensen GB, Reich R. EMMPRIN (extracellular matrix metalloproteinase inducer) is a novel marker of poor outcome in serous ovarian carcinoma. Clin Exp Metastasis. 2003; 20: 161–169.[CrossRef][Medline] [Order article via Infotrieve]
25. Haug C, Lenz C, Diaz F, Bachem MG. Oxidized low-density lipoproteins stimulate extracellular matrix metalloproteinase inducer (EMMPRIN) release by coronary smooth muscle cells. Arterioscler Thromb Vasc Biol. 2004; 24: 1823–1829.
26. May AE, Schmidt R, Bülbül BÖ, Hölderle M, Walther F, Schömig A, Gawaz M, Klouche M. Plasminogen and matrix metalloproteinase activation by enzymatically modified LDL in monocytes and smooth muscle cells. Thromb Haemost. 2005; 93: 710–715.[Medline] [Order article via Infotrieve]
 |
|
 |
|
  E. Shantsila and G. Y.H. Lip Monocytes in Acute Coronary Syndromes Arterioscler Thromb Vasc Biol, October 1, 2009; 29(10): 1433 - 1438. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. R. Lizarbe, C. Tarin, M. Gomez, B. Lavin, E. Aracil, L. M. Orte, and C. Zaragoza Nitric Oxide Induces the Progression of Abdominal Aortic Aneurysms through the Matrix Metalloproteinase Inducer EMMPRIN Am. J. Pathol., October 1, 2009; 175(4): 1421 - 1430. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Venkatesan, A. J. Valente, V. S. Reddy, D. A. Siwik, and B. Chandrasekar Resveratrol blocks interleukin-18-EMMPRIN cross-regulation and smooth muscle cell migration Am J Physiol Heart Circ Physiol, August 1, 2009; 297(2): H874 - H886. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Newby Metalloproteinase Expression in Monocytes and Macrophages and its Relationship to Atherosclerotic Plaque Instability Arterioscler Thromb Vasc Biol, December 1, 2008; 28(12): 2108 - 2114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Zavadzkas, R. A. Plyler, S. Bouges, C. N. Koval, W. T. Rivers, C. U. Beck, E. I. Chang, R. E. Stroud, R. Mukherjee, and F. G. Spinale Cardiac-restricted overexpression of extracellular matrix metalloproteinase inducer causes myocardial remodeling and dysfunction in aging mice Am J Physiol Heart Circ Physiol, October 1, 2008; 295(4): H1394 - H1402. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. P. Levick and G. L. Brower Regulation of matrix metalloproteinases is at the heart of myocardial remodeling Am J Physiol Heart Circ Physiol, October 1, 2008; 295(4): H1375 - H1376. [Full Text] [PDF]
|
|
|
|
|
|
A. E. May, P. Seizer, and M. Gawaz Platelets: Inflammatory Firebugs of Vascular Walls Arterioscler Thromb Vasc Biol, March 1, 2008; 28(3): s5 - s10. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Xu, N. Ohara, J. Liu, M. Amano, R. Sitruk-Ware, S. Yoshida, and T. Maruo Progesterone receptor modulator CDB-2914 induces extracellular matrix metalloproteinase inducer in cultured human uterine leiomyoma cells Mol. Hum. Reprod., March 1, 2008; 14(3): 181 - 191. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Schneider, G. K. Sukhova, M. Aikawa, J. Canner, N. Gerdes, S.-M. T. Tang, G.-P. Shi, S. S. Apte, and P. Libby Matrix Metalloproteinase-14 Deficiency in Bone Marrow-Derived Cells Promotes Collagen Accumulation in Mouse Atherosclerotic Plaques Circulation, February 19, 2008; 117(7): 931 - 939. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Schmidt, A. Bultmann, S. Fischel, A. Gillitzer, P. Cullen, A. Walch, P. Jost, M. Ungerer, N. D. Tolley, S. Lindemann, et al. Extracellular Matrix Metalloproteinase Inducer (CD147) Is a Novel Receptor on Platelets, Activates Platelets, and Augments Nuclear Factor {kappa}B-Dependent Inflammation in Monocytes Circ. Res., February 15, 2008; 102(3): 302 - 309. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. G. Spinale Myocardial Matrix Remodeling and the Matrix Metalloproteinases: Influence on Cardiac Form and Function Physiol Rev, October 1, 2007; 87(4): 1285 - 1342. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. S. Spruill, A. S. Lowry, R. E. Stroud, C. E. Squires, I. M. Mains, E. C. Flack, C. Beck, J. S. Ikonomidis, A. J. Crumbley, P. J. McDermott, et al. Membrane-type-1 matrix metalloproteinase transcription and translation in myocardial fibroblasts from patients with normal left ventricular function and from patients with cardiomyopathy Am J Physiol Cell Physiol, October 1, 2007; 293(4): C1362 - C1373. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||