Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2005;112:1435-1443
doi: 10.1161/CIRCULATIONAHA.105.539122
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Quinkler, M.
Right arrow Articles by Stewart, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Quinkler, M.
Right arrow Articles by Stewart, P. M.
Related Collections
Right arrow Clinical Studies
Right arrow Cardio-renal physiology/pathophysiology
Right arrow Other hypertension
Right arrow ACE/Angiotension receptors

(Circulation. 2005;112:1435-1443.)
© 2005 American Heart Association, Inc.


Hypertension

Increased Expression of Mineralocorticoid Effector Mechanisms in Kidney Biopsies of Patients With Heavy Proteinuria

Marcus Quinkler, MD; Daniel Zehnder, MD, PhD; Kevin S. Eardley, MRCP; Julia Lepenies, MD; Alexander J. Howie, MD, FRCPath; Susan V. Hughes, HNC; Paul Cockwell, PhD; Martin Hewison, PhD; Paul M. Stewart, MD, FRCP

From the Division of Medical Sciences (M.Q., S.V.H., M.H., P.M.S.) and Department of Pathology (A.J.H.), University of Birmingham, Birmingham, UK; Department of Nephrology (D.Z., K.L.S.E., J.L., P.C.), Queen Elizabeth Hospital, Birmingham, UK; and Clinical Endocrinology (M.Q.), Centre for Internal Medicine, Gastroenterology, Hepatology and Endocrinology, Charité Campus Mitte, Berlin, Germany.

Correspondence to Paul M. Stewart, MD, FRCP, FMedSci, Professor of Medicine, Division of Medical Sciences, Institute of Biomedical Research, University of Birmingham, Birmingham B15 2TT, UK. E-mail p.m.stewart{at}bham.ac.uk

Received January 27, 2005; revision received May 4, 2005; accepted May 13, 2005.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— Aldosterone has emerged as a deleterious hormone in the heart, with mineralocorticoid receptor (MR) blockade reducing mortality in patients with severe heart failure. There is also experimental evidence that aldosterone contributes to the development of nephrosclerosis and renal fibrosis in rodent models, but little is known of its role in clinical renal disease.

Methods and Results— We quantified MR, serum- and glucocorticoid-regulated kinase 1 (sgk1), and mRNA expression of inflammatory mediators such as macrophage chemoattractant protein-1 (MCP-1), transforming growth factor-ß1, and interleukin-6 in 95 human kidney biopsies in patients with renal failure and mild to marked proteinuria of diverse etiologic origins. We measured renal function, serum aldosterone, urinary MCP-1 protein excretion, and the amount of chronic renal damage. Macrophage invasion was quantified by CD68 and vascularization by CD34 immunostaining. Serum aldosterone correlated negatively with creatinine clearance (P<0.01) and positively with renal scarring (P<0.05) but did not correlate with MR mRNA expression or proteinuria. Patients with heavy albuminuria (>2 g/24 h; n=15) had the most renal scarring and the lowest endothelial CD34 staining. This group showed a significant 5-fold increase in MR, a 2.5-fold increase in sgk1 expression and a significant increase in inflammatory mediators (7-fold increase in MCP-1, 3-fold increase in transforming growth factor-ß1, and 2-fold increase in interleukin-6 mRNA). Urinary MCP-1 protein excretion and renal macrophage invasion were significantly increased in patients with heavy albuminuria.

Conclusions— These studies support animal data linking aldosterone/MR activation to renal inflammation and proteinuria. Further studies are urgently required to assess the potential beneficial effects of MR antagonism in patients with renal disease.


Key Words: blood pressure • hormones • hypertension, renal • kidney • receptors


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Inhibitors of ACE and angiotensin receptor blockers have shown efficacy in slowing the progression of both experimental and clinical renal disease.1–5 Angiotensin II has been regarded as the major mediator of injurious actions of the renin-angiotensin-aldosterone system in the kidney by elevating glomerular pressure, mediating vasoconstriction, and promoting fibroproliferative effects. Recently, aldosterone (associated with salt) has also been proposed as a deleterious mediator of the renin-angiotensin-aldosterone system in the heart and kidney.4,6 In 1999, the RALES study showed that mineralocorticoid receptor (MR) blockade by spironolactone reduced morbidity in patients with severe heart failure.7 Four years later, the beneficial effect of MR blockade with the newer antagonist eplerenone was shown in patients with left ventricular dysfunction after myocardial infarction.8 There is considerable experimental evidence that aldosterone also contributes to the development of renal fibrosis in several models. First, aldosterone produces arterial hypertension, proteinuria, and glomerulosclerosis despite ACE inhibitors and angiotensin receptor blockers in the rat remnant kidney model.4 Second, stroke-prone spontaneously hypertensive rats have higher renal concentrations of MR than normotensive Wistar-Kyoto rats,9 and spironolactone reduced proteinuria10 and prevented malignant nephrosclerosis.11 In salt-loaded rats (eg, spontaneously hypertensive rates, stroke-prone spontaneously hypertensive rats), plasma aldosterone is presumably suppressed. The efficacy of spironolactone in this setting raises the possibility of local aldosterone production and its autocrine/paracrine properties.12 Third, in the NG-nitro-L-arginine methyl ester rat model, MR blockade was nephroprotective without altering blood pressure.13 Finally, the inflammatory effects of aldosterone in the rat include increased renal expression of proinflammatory cytokines such as monocyte chemoattractant protein-1 (MCP-1), with interstitial macrophage infiltration and injury.14 Tubular epithelial cells are considered a central cell type in renal inflammation because they are able to produce a large variety of cytokines15 such as interleukin (IL)-6, chemokines such as IL-8 and MCP-1, and profibrotic factors, including transforming growth factor-ß1 (TGFß-1). Tubular epithelial cell activation is triggered by hypoxia or protein overload resulting from enhanced glomerular permeability.16,17 Cross-talk between tubular epithelial cells and infiltrating leukocytes regulates inflammatory mediators and may lead to further attraction of inflammatory cells.

Patients with stable chronic renal insufficiency show higher plasma aldosterone levels than healthy individuals.18,19 Most patients with aldosteronism have proteinuria, present often with increased urinary calcium and magnesium excretion, and show hypomagnesemia.20 There are a few small, preliminary, encouraging clinical trials using MR blockers to attenuate chronic renal injury.21–23

To the best of our knowledge, nothing has been published about renal MR expression and MR effector mechanisms in human kidney disease. Therefore, we have investigated the expression of MR and its target gene serum- and glucocorticoid-regulated kinase 1 (sgk1) and their correlation with inflammatory markers and serum aldosterone concentrations in 95 patients with renal disease undergoing diagnostic biopsy. The aim of this study was to provide further evidence that aldosterone influences renal inflammation and the expression of proinflammatory cytokines via the MR in humans.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Subjects and Clinical Data
All 95 patients (53 men, 42 women), recruited from the Department of Nephrology at Queen Elizabeth Hospital (Birmingham, UK), underwent kidney biopsies to investigate proteinuria and/or hematuria and/or renal impairment. Patients with acute renal failure were not included; those taking spironolactone also were excluded. The study was approved by the local research ethics committee, and all patients gave written informed consent before study inclusion. Renal biopsy material was divided, and part was rapidly frozen at –80°C. The rest was fixed in formal-saline and glutaraldehyde for routine pathological study. Blood pressure was measured 3 times before the biopsy, and the average was calculated. Twenty-four–hour urine collection was performed before renal biopsy. Urinary MCP-1 protein was quantified with an ELISA kit (Duoset, R&D Systems). Creatinine clearance (CCR; mL/min) was calculated by the Cockroft-Gault formula24: CCR=[1.23 (for men or 1.04 for women)x(140–age)xweight (kg)]/serum creatinine concentration (µmol/L). Serum aldosterone concentration was measured by radioimmunoassay (Coat-A-Count 125I-Aldosterone RIA Kit, Diagnostic Products Corp). The main diagnoses are shown in Table 1 and the relevant clinical data in Table 2.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Pathological Diagnoses on Renal Biopsies


View this table:
[in this window]
[in a new window]
 
TABLE 2. Clinical Data of Patients Who Underwent Kidney Biopsies

Forty-four patients had an underlying diagnosis of hypertension and received antihypertensive therapy: 10 with single therapy, 22 with double therapy, 6 with 3 drugs, and 6 with 4 drugs. Eighteen received furosemide, 10 took ACE inhibitors, and 5 received thiazides given either as single therapy or in combination with each other or with calcium antagonists or ß-blockers. Eleven patients were taking regular prednisolone in doses of ≥5 mg/d. Four patients without hypertension were taking ACE inhibitors for proteinuria. The various factors were analyzed for their relation to 4 variables: renal function, blood pressure, diagnosis, and proteinuria. For analysis with regard to proteinuria, patients were divided into 4 groups: no albuminuria (<30 mg/24 h; n=30), microalbuminuria (30 to 300 mg/24 h; n=26), moderate albuminuria (300 mg to 2g/24 h; n=17), and heavy albuminuria (>2 g/24 h; n=14). Four patients with heavy albuminuria had nephrotic syndrome.

RNA Extraction and RT
Biopsies were homogenized on ice with a metal homogenizer treated with RNase Zap (Ambion). Homogenates were centrifuged at 12 000g for 10 minutes at 4°C. Total RNA was extracted from supernatants with the Tri Reagent extraction method (Sigma UK). RNA integrity was assessed by electrophoresis on 1% agarose gels; the quantity determined spectrophotometrically at OD260. 1 µg of total RNA was initially denatured by heating to 70°C for 5 minutes. Then, 30 U avian myeloblastososis virus, 200 ng random primers, 20 U ribonuclease inhibitor, and 40 nmol deoxy-NTPs with 5x reaction buffer were added to the RNA, and the RT reaction was carried out at 37°C for 1 hour. The reaction was terminated by heating the cDNA to 95°C for 5 minutes.

Quantitative RT-PCR
MR, sgk1, MCP-1, TGFß-1, and IL-6 mRNA expression levels were analyzed with an ABI Prism 7700 sequence detection system (Perkin-Elmer Applied Biosystems) as previously described.25 Real-time RT-PCR was performed in 25-µL volumes on 96-well plates in reaction buffer containing TaqMan Universal PCR Master Mix (Applied Biosystems) and 25 ng cDNA template. All reactions were singleplexed with the housekeeping gene (18S ribosomal RNA gene) provided as preoptimized control probe and primers (Applied Biosystems), enabling data to be expressed in relation to an internal reference to allow for differences in RT efficiency. Measurements were carried out ≥3 times for each sample. All target gene probes were labeled with the fluorescent reporter dye FAM, and the housekeeping gene was labeled with the fluorescent reporter dye VIC. Reactions were as follows: 50°C for 2 minutes, 95°C for 10 minutes, and then 44 cycles of 95°C for 15 seconds and 60°C for 1 minute. Oligonucleotide primers and a Taqman probe for MR were as follows: forward, CCAAATCAGCCTTCAGTTCGTT; reverse, TTGAGGCCATCCTTTGGAAT; and probe, TTGAAGAATACACCATCATGAAAGTTTTGCTGCTACTAAG. The primers and probe used for sgk1, MCP-1, TGFß-1, and IL-6 real-time PCR were commercially available Assays on Demand (Applied Biosystems).

According to the manufacturer’s guidelines, data were expressed as ct values (the cycle number at which logarithmic PCR plots crossed a calculated threshold line) and used to determine {Delta}ct values ({Delta}ct equals ct of the target gene minus ct of the housekeeping gene). High {Delta}ct values represent low levels of expression. Fold changes in expression were calculated according to the transformation: fold increase=2–difference in {Delta}ct.

Measurement of Chronic Damage in Biopsy Specimens
An interactive image analysis system was used to outline and measure the extent of glomerular and interstitial scarring, expressed as percentage of cortical cross-sectional area, in renal biopsy stained with periodic acid–methenamine silver. This measure, the index of chronic damage, was shown to be a strong predictor of renal outcome.26

Immunohistochemistry on Biopsy Specimens
Detection of tissue macrophages, endothelial cells, and MR was performed with immunohistochemistry. Briefly, paraffin-embedded sections were processed in 0.01 mol/L sodium citrate buffer (pH 6.0) kept at 95°C in a microwave for 30 minutes. Slides were then incubated with methanol-hydrogen peroxide (1:100), followed by sequential treatment with 0.1% avidin, 0.01% biotin (X0590 Dako Ltd Ely, UK), and 10% rabbit serum. Three-stage indirect immunohistochemistry was performed with primary mouse monoclonal antibodies directed against the pan-macrophage antigen CD68 (5 µg/mL; clone PG-M1; Dako Ltd Ely UK) or the endothelial marker CD34 (1 µg/mL; clone QBEnd 10; Dako Ltd Ely, UK), each for 1 hour, or a mouse antibody (1:20) directed against the MR (generous gift from C. Gomez-Sanchez) for 16 hours. Biotinylated secondary rabbit anti-mouse antibody (50 µg/mL; Dako Ltd Ely, UK) was applied for 1 hour and by horseradish peroxidase–conjugated streptavidin ABC complex (Dako Ltd Ely, UK) for 20 minutes. Binding was visualized with 3'3-diaminobenzidine (Vector Laboratories Ltd) and hydrogen peroxide. Slides used for qualitative analysis of CD68 or CD34 were then counterstained with Mayer’s hematoxylin; those used for quantitative analysis were not. An isotype control (IgG1; Dako Ltd) consistently resulted in no positive staining.

An interactive image analysis system was used to carry out blinded quantitative analysis of the extent of CD68 and CD34 immunostaining in biopsy specimens, expressed as percentage of cortical cross-sectional area. This technique was found to be reliable in the analysis of human and animal renal sections.27 Images at magnification x200 were captured and converted to a 2-color scale image with an Aequitas IDA software system (Dynamic Data Links). For each patient, the mean measurement of 5 randomly selected nonconfluent microscopic fields was determined. Glomerular staining was excluded from analysis.

Statistical Analysis
Data are expressed as mean±SD unless otherwise stated. Statistical analysis on real-time PCR data was performed on mean {Delta}ct values (not on fold changes) to exclude potential bias owing to averaging data that had been transformed through the equation 2–ct. Statistical analysis of comparisons between groups was undertaken with paired and unpaired t tests or ANOVA when appropriate; otherwise, the Mann-Whitney rank-sum test was used. For correlations, a stepwise multiple regression analysis was performed with SPSS (SPSS Inc) and Pearson’s correlations.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Renal Function
Using a cutoff of 60 mL/min for creatinine clearance,28 we found that 58 patients had good or slightly impaired renal function, and 37 had moderately or severely impaired renal function. Patients with moderately or severely impaired renal function had higher blood pressure than the other patients, both systolic (142.7±15.6 versus 128.9±17.4 mm Hg; P<0.001) and diastolic (77.3±11.0 versus 72.5±10.7 mm Hg; P<0.05). Patients with moderately or severely impaired renal function showed no significant changes in MR, sgk1, TGFß-1, or IL-6 mRNA expression compared with patients with good or slightly impaired renal function. MCP-1 mRNA expression showed a significant negative correlation with creatinine clearance (Figure 1A). Patients with moderately or severely impaired renal function showed a higher urinary MCP-1 protein excretion (353±343 versus 180±231 pg/mg creatinine; P<0.05), a higher index of chronic damage (46.2±31.2% versus 7.3±11.9%; P<0.001), less staining for endothelial marker CD34 (6.4±2.4% versus 9.9±2.2%; P<0.001), and more staining for macrophage antigen CD68 (2.7±1.8% versus 1.2±0.5%; P<0.001). There was a significantly negative correlation between serum aldosterone concentration and renal function (Figure 1B). Aldosterone concentration did not correlate with serum potassium, calcium, or magnesium levels or MR mRNA expression but had a significant positive correlation with renal scarring (Figure 1C).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. MCP-1 mRNA expression (in {Delta}ct values) in renal biopsies (A) and serum aldosterone concentrations (B; pmol/L) from 95 patients in correlation to their renal function (creatinine clearance in mL/min). High {Delta}ct values represent low levels of expression and vice versa. C, Serum aldosterone concentrations (pmol/L) in correlation to renal scarring (percent of area) in renal biopsies from those 95 patients.

Blood Pressure
Forty-four patients on treatment for hypertension had significant higher blood pressure than the other patients (systolic, 142.7±15.5 versus 127.0±16.8 mm Hg; P<0.001; diastolic, 78.5±9.5 versus 70.7±11.1 mm Hg; P<0.001). The hypertensive patients had a lower creatinine clearance (47.7±27.8 versus 85.4±35.1 mL/min; P<0.001), a higher index of chronic damage (scarring index, 34.4±29.9% versus 10.5±21.3%; P<0.001), less CD34 staining (7.1±2.6% versus 9.9±2.3;% P<0.001), more CD68 staining (2.1±1.2% versus 1.4±1.3%; P<0.05), and higher serum aldosterone concentration (472±284 versus 324±230 pmol/L; P<0.05). There were no differences in MR, sgk1, MCP-1, TGFß-1, or IL-6 mRNA expression between the 2 groups. No correlation was found between systolic or diastolic blood pressure and MR, sgk1, TGFß-1, or IL-6 mRNA expression, but there was a significant positive correlation between systolic blood pressure and MCP-1 mRNA expression (r=0.359, P<0.005) and between systolic blood pressure and renal scarring (r=0.314, P<0.01).

Diagnosis
Patients with thin glomerular basement membrane disease (n=23) were compared with patients with chronic ischemic renal damage (n=22), IgA nephropathy (n=18), and focal segmental sclerosing glomerulonephritis (n=8). Other diagnoses could not be compared because of an insufficient number of patients. No significant differences in MR, sgk1, TGFß-1, or IL-6 mRNA expression were found between these groups. Compared with patients with thin glomerular basement membrane disease, patients with focal segmental sclerosing glomerulonephritis had significantly increased MCP-1 mRNA expression ({Delta}ct, 9.57±4.09 versus 13.50±2.37; P<0.01) and urinary MCP-1 excretion ({Delta}ct, 661±427 versus 119±87 pg/mg creatinine; P<0.001).

Proteinuria
Patients with no albuminuria had the highest creatinine clearance (88.3±29.1 mL/min) compared with those with microalbuminuria (59.5±40.1 mL/min; P<0.005), moderate albuminuria (64.8±36.5 mL/min; P<0.05), and heavy albuminuria (50.0±31.7 mL/min; P<0.001). They also had the lowest blood pressure (systolic: 127.6±18.4 versus 135.3±15.2 mm Hg, P=NS; 143.1±14.1 mm Hg, P<0.005; and 144.0±17.1 mm Hg, P<0.05; diastolic: 71.0±10.4 versus 74.2±11.0 mm Hg, P=NS; 79.1±8.6 mm Hg, P<0.01; and 78.1±10.1 mm Hg, P=NS, respectively).

Patients with heavy albuminuria had the highest index of chronic damage (Figure 2A) and the least staining for CD34 (Figure 2B) compared with those with no albuminuria, microalbuminuria, and moderate albuminuria. Patients with heavy albuminuria had also the highest urinary MCP-1 protein concentrations (Figure 2C) and showed the most staining for macrophages (Figure 2D) compared with the other groups.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 2. Renal scarring (A), CD34 staining for endothelial cells (B; both in percent of area), urinary MCP-1 excretion (C; pg/mg creatinine), and macrophage invasion (D; in percent of area) in renal biopsies from 95 patients with various degrees of urinary albumin excretion. Values are mean±SD. ***P<0.005.

A 4.6-fold increase in MR mRNA expression was observed in patients with heavy albuminuria ({Delta}ct, 14.8±2.4) compared with no albuminuria ({Delta}ct, 17.0±3.3; P<0.05), microalbuminuria ({Delta}ct, 18.1±3.7; P<0.01), and moderate albuminuria ({Delta}ct, 17.2±2.0; P<0.01) (Figure 3A). A 2- and 3.4-fold increase in sgk1 mRNA expression was seen in those with moderate and heavy albuminuria ({Delta}ct, 11.7±1.2 and 11.0±2.9, respectively) compared with no albuminuria ({Delta}ct, 12.8±2.4; both P=NS) and microalbuminuria ({Delta}ct, 14.1±3.6; both P<0.05) (Figure 3A).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. Fold induction of MR and sgk1 (A) and MCP-1, TGFß-1, and IL-6 mRNA (B) expression in renal biopsies from 95 patients divided according to 24-hour urinary albumin excretion (<30 mg was set as 1).

A 7.1-fold increase in MCP-1 mRNA expression was observed in patients with heavy albuminuria ({Delta}ct, 10.2±4.3) compared with no albuminuria ({Delta}ct, 13.7±3.2; P<0.05), microalbuminuria ({Delta}ct, 13.9±2.8; P<0.005), and moderate albuminuria ({Delta}ct, 14.0±2.5; P<0.05) (Figure 3B).

The expression of cytokines and profibrotic factors was increased in patients with heavy albuminuria. TGFß-1 was increased 3.8-fold in heavy albuminuria ({Delta}ct, 13.9±2.9) compared with no albuminuria ({Delta}ct, 15.9±2.4; P<0.05), microalbuminuria ({Delta}ct, 17.6±5.1; P<0.05), and moderate albuminuria ({Delta}ct, 16.7±2.6; P<0.05). IL-6 was increased 2.7-fold ({Delta}ct, 21.7±2.5) compared with no albuminuria ({Delta}ct, 23.2±1.7; P<0.05), microalbuminuria ({Delta}ct, 23.9±2.6; P<0.05), and moderate albuminuria ({Delta}ct, 25.4±2.3; P<0.005) (Figure 3B).

MR mRNA expression showed a highly significant positive correlation with sgk1 mRNA expression (Figure 4). MCP-1, TGFß-1, and IL-6 mRNA expression also positively correlated with MR mRNA expression (Figure 4) and sgk1 mRNA expression (Figure 5).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Correlation between MR mRNA expression (in {Delta}ct values) and sgk1, MCP-1, TGFß-1, and IL-6 mRNA expression (in {Delta}ct values) in renal biopsies from 95 patients. High {Delta}ct values represent low levels of expression and vice versa.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 5. Correlation between sgk1 mRNA expression (in {Delta}ct values) and MCP-1, TGFß-1, and IL-6 mRNA expressions (in {Delta}ct values) in renal biopsies from 95 patients. High {Delta}ct values represent low levels of expression and vice versa.

Serum aldosterone concentrations were not significantly different between the proteinuric groups: no albuminuria, 347±232 pmol/L; microalbuminuria, 455±256 pmol/L; moderate albuminuria, 474±349 pmol/L; and heavy albuminuria, 284±227 pmol/L.

Localization of the MR
In normal kidney, MR immunoreactivity was found predominantly in nuclei with some cytoplasmatic staining in cells of distal convoluted tubules and collecting tubules. No staining was found in proximal tubules. Staining for MR was detected patchily in smooth muscle cells of arteries and veins and in the cells of the macula densa. Staining for MR in renal biopsies was detected in the same sites as in normal kidney. In general, the intensity of staining in distal tubules and collecting ducts was stronger in biopsies of patients with heavy proteinuria than in biopsies of patients with no proteinuria (Figure 6A and 6B). In addition, MR immunoreactivity was seen in some interstitial cells (Figure 6C).



View larger version (91K):
[in this window]
[in a new window]
 
Figure 6. Immunohistochemistry of MR expression in renal biopsies of patients with no albuminuria (<30 mg/24 hour; A) or heavy albuminuria (>2 g/24 h; B). C, Biopsy of a patient with MR staining of interstitial cells. P indicates proximal tubule; D, distal tubule; CD, collecting duct; G, glomerulus; IC, interstitial cells; and art, artery. Magnification x200.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Patients with hyperaldosteronism have a higher incidence of left ventricular hypertrophy, albuminuria, and stroke than do patients with essential hypertension.20 Experimental animal models reveal the pathophysiological sequence after exposure to aldosterone and salt in the heart.6 Within weeks, there are increased production and activation of proinflammatory molecules, resulting in a histological picture of perivascular macrophage infiltration and inflammation.29 This is followed by increased interstitial collagen deposition, fibrosis, and ventricular hypertrophy.30 These events are prevented if an MR antagonist is used, with clinical trials (RALES and EPHESUS) confirming the beneficial effect of MR blockade in heart failure.7,8 Adverse structural remodeling of kidneys or heart does not appear when aldosterone treatment is given with a salt-depleted diet.

Activation of the MR by aldosterone also contributes to kidney damage in experimental models of hypertension. In hypertensive rats, aldosterone treatment induces severe vascular and glomerular sclerosis, fibrinoid necrosis, and thrombosis. In addition, it causes interstitial leukocyte infiltration and tubular damage and results in an increase in albuminuria and proinflammatory molecules.14 Administration of MR blockers or aldosterone ablation by adrenalectomy attenuates renal injury and reduces albuminuria and renal expression of proinflammatory molecules in rats independently of blood pressure reduction.11,13,14 These observations support the renoprotective effects of MR antagonism in nephropathy.

Local and systemically acting factors, notably MCP-1, TGFß-1, and IL-6, have been associated with progressive renal injury. A prominent feature throughout the inflammatory process is the presence of leukocytes at sites of injury. MCP-1 is expressed by tubular epithelial and peritubular capillary endothelial cells,31 and levels of expression correlate with interstitial macrophage infiltration and fibrosis,32,33 suggesting that MCP-1 has a central role in directing macrophage recruitment to tissue sites.

In our study, serum aldosterone concentrations but not MR expression increased with loss of renal function compatible with an increased mineralocorticoid effect in patients with poor renal function. Other studies have described elevated serum aldosterone concentrations in patients with chronic renal disease.18,19,34 Patients with high aldosterone concentrations also showed a higher index of chronic damage than patients with low aldosterone concentrations, in keeping with rodent data.14 The renal expression of MCP-1 mRNA inversely correlated with renal function in agreement with urinary MCP-1 excretion in patients with chronic progressive renal disease.32,33 Additionally, MCP-1 expression correlated with expression of the pan-macrophage antigen CD68, supporting the hypothesis that MCP-1 plays a role in directing macrophages to tissue sites.

In human and rodents, proteinuria seems to be a major risk factor and pathological stimulus of renal inflammation.35–37 In experimental animal models, the deleterious effects of aldosterone seemed to be related to proteinuria, with MR blockade causing a decrease in proteinuria.38 Preliminary data suggest that spironolactone decreases proteinuria in patients with chronic renal disease21 and those with type 2 diabetes mellitus and early nephropathy,23 but the mechanisms are unclear. In our study, patients with heavy albuminuria presented with the highest index of chronic damage, the lowest staining for CD34, and the worst renal survival (end points were doubling of serum creatinine concentrations or dialysis). This group of patients displayed the highest renal MCP-1 mRNA expression and urinary MCP-1 protein excretion and consequently high macrophage invasion as shown by staining for CD68. Bearing in mind first that aldosterone infusion in rats led to increased renal proinflammatory gene expression such as MCP-114 and second that this inflammation was attenuated by eplerenone,14 we analyzed mRNA and protein expression of MR and mRNA expression of the MR target gene sgk1 in the renal biopsies. Serum aldosterone concentrations did not differ significantly between the groups with different levels of albuminuria, but patients with heavy albuminuria showed a marked increase (5-fold) in renal MR mRNA expression compared with patients with no or moderate albuminuria. The correlation with and concomitant increase (2.5-fold) in sgk1 mRNA expression in these patients suggest that the increase in MR effector systems is both real and functional. Immunohistochemistry data confirmed that the increase in MR expression is within the distal nephron, although some interstitial cells stained for MR. In keeping with the association found by Blasi et al14 that aldosterone regulates MCP-1 expression, probably via the MR, we found a significant correlation between MR and MCP-1 mRNA expression. This finding underpins the possible direct interaction between those 2 systems. We cannot conclude whether the induction of MCP-1 is mediated via sgk1 or possibly via other unknown MR target genes; this subject needs further clarification. There is also the possibility of an indirect effect of aldosterone leading to a proinflammatory vascular phenotype of the kidneys and heart. For example, increased aldosterone is associated with activation of circulating immune cells that are involved in a proinflammatory/fibrogenic vascular phenotype of the heart and systemic organs.39 Aldosterone and salt supplementation in rats leads to changes in peripheral blood mononuclear cell divalent cation composition with reduced ionized [Mg2+] and increased Ca2+ loading. This results in an induction of oxidative/nitrosative stress, including H2O2 production, and activation of these immune cells.40

In addition to systemic aldosterone levels, local tissue-specific aldosterone production might play a role at least in cardiac fibrosis,12 although aldosterone synthase-transgenic mice showed no structural or myocardial alterations.41 This highlights that in vitro studies with aldosterone often have not been consistent and reproducible.

Inflammation is an important contributor to renal damage. We investigated the expression of further proinflammatory cytokines in renal biopsies. The cytokine IL-6 is associated with subsequent cardiovascular mortality and progression of vascular disease42,43 and correlates with the degree of mesangial hyperproliferation, tubular atrophy, and the intensity of interstitial infiltration.44 Furthermore, it is known to directly induce MCP-1 expression.44 Our patients with heavy albuminuria showed a significant increase in IL-6 mRNA expression that may explain, in part, the increased MCP-1 expression. Blasi et al14 showed that renal IL-6 expression is increased in rats treated with aldosterone. We did find a correlation between MR and sgk1 expression and IL-6 expression, but a causative relationship remains to be established.

TGFß-1 is an important cytokine that promotes fibroblast differentiation and proliferation, upregulates collagen synthesis and deposition, and inhibits matrix metalloproteinase collagenases.41 In proteinuric rats, TGFß-1 production from interstitial macrophages correlated with inflammatory infiltration.36 TGFß-1 is increased by treatment with aldosterone,45 and in rats with renal fibrosis, expression could be blocked by treatment with spironolactone.46,47 Human studies on TGFß-1 are scarce. Increased TGFß-1 expression has been reported in human diabetic patients48,49 and in patients with nephrotic syndrome.50 Here, we found a significant correlation between renal MR and renal TGFß-1 mRNA expression, supporting this link, and observed a 3-fold increase in renal TGFß-1 mRNA expression in patients with heavy albuminuria. Therefore, we believe MR via sgk1 or as-yet-unknown MR target genes regulate the expression of several inflammatory cytokines.

Preliminary but small clinical trials have analyzed the effect of MR antagonists on chronic renal injury,21–23 but there is now an obvious need for larger trials with additional end points besides proteinuria. Hyperkalemia has been raised as a potential deleterious side effect, particularly in patients with reduced renal function, heart failure, or diabetes,51,52 but careful titration53 and the use of lower doses of MR antagonists minimize this risk.

In conclusion, in patients with heavy albuminuria, the expression of MR and sgk1 mRNA is significantly increased, suggesting a direct receptor-mediated activation of mineralocorticoid action. This group of patients is at the highest risk for progression of renal damage and failure as indicated by high renal MCP-1 mRNA and urinary levels, high macrophage invasion, and a high index of chronic damage. Because of an increase in MR effector mechanisms, expression of inflammatory mediators such as IL-6 and TGFß-1 are enhanced and further promote renal inflammation. These observations support the further evaluation of MR antagonists in patients with renal disease, particularly those with severe proteinuria.


*    Acknowledgments
 
This work was supported by a Deutsche Forschungsgemeinschaft (DFG) postdoctoral research fellowship grant (QU142/1-1 to Marcus Quinkler) and the Medical Research Council (senior clinical fellowship to Paul M. Stewart). We thank Celso Gomez-Sanchez, University of Mississippi, Jackson, for the antibody against MR.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 

  1. Anderson S, Rennke HG, Brenner BM. Therapeutic advantage of converting enzyme inhibitors in arresting progressive renal disease associated with systemic hypertension in the rat. J Clin Invest. 1986; 77: 1993–2000.[Medline] [Order article via Infotrieve]
  2. Ruggenenti P, Perna A, Gherardi G, Gaspari F, Benini R, Remuzzi G. Renal function and requirement for dialysis in chronic nephropathy patients on long-term ramipril: REIN follow-up trial: Gruppo Italiano di Studi Epidemiologici in Nefrologia (GISEN): Ramipril Efficacy in Nephropathy. Lancet. 1998; 352: 1252–1256.[CrossRef][Medline] [Order article via Infotrieve]
  3. Lafayette RA, Mayer G, Park SK, Meyer TW. Angiotensin II receptor blockade limits glomerular injury in rats with reduced renal mass. J Clin Invest. 1992; 90: 766–771.[Medline] [Order article via Infotrieve]
  4. Greene EL, Kren S, Hostetter TH. Role of aldosterone in the remnant kidney model in the rat. J Clin Invest. 1996; 98: 1063–1068.[Medline] [Order article via Infotrieve]
  5. Lewis EJ, Hunsicker LG, Bain RP, Rohde RD. The effect of angiotensin-converting-enzyme inhibition on diabetic nephropathy: the Collaborative Study Group. N Engl J Med. 1993; 329: 1456–1462.[Abstract/Free Full Text]
  6. Weber KT. Aldosterone in congestive heart failure. N Engl J Med. 2001; 345: 1689–1697.[Free Full Text]
  7. Pitt B, Zannad F, Remme WJ, Cody R, Castaigne A, Perez A, Palensky J, Wittes J. The effect of spironolactone on morbidity and mortality in patients with severe heart failure: Randomized Aldactone Evaluation Study Investigators. N Engl J Med. 1999; 341: 709–717.[Abstract/Free Full Text]
  8. Pitt B, Remme W, Zannad F, Neaton J, Martinez F, Roniker B, Bittman R, Hurley S, Kleiman J, Gatlin M. Eplerenone, a selective aldosterone blocker, in patients with left ventricular dysfunction after myocardial infarction. N Engl J Med. 2003; 348: 1309–1321.[Abstract/Free Full Text]
  9. Horiuchi M, Nishiyama H, Hama J, Takenaka T, Kondo H, Kino H, Nagata S, Sugimura K, Katori R. Characterization of renal aldosterone receptors in genetically hypertensive rats. Am J Physiol. 1993; 264 (pt 2): F286–F291.[Medline] [Order article via Infotrieve]
  10. Rocha R, Chander PN, Khanna K, Zuckerman A, Stier CT Jr. Mineralocorticoid blockade reduces vascular injury in stroke-prone hypertensive rats. Hypertension. 1998; 31 (pt 2): 451–458.[Abstract/Free Full Text]
  11. Rocha R, Chander PN, Zuckerman A, Stier CT Jr. Role of aldosterone in renal vascular injury in stroke-prone hypertensive rats. Hypertension. 1999; 33 (pt 2): 232–237.[Abstract/Free Full Text]
  12. Delcayre C, Silvestre JS, Garnier A, Oubenaissa A, Cailmail S, Tatara E, Swynghedauw B, Robert V. Cardiac aldosterone production and ventricular remodeling. Kidney Int. 2000; 57: 1346–1351.[CrossRef][Medline] [Order article via Infotrieve]
  13. Rocha R, Stier CT Jr, Kifor I, Ochoa-Maya MR, Rennke HG, Williams GH, Adler GK. Aldosterone: a mediator of myocardial necrosis and renal arteriopathy. Endocrinology. 2000; 141: 3871–3878.[Abstract/Free Full Text]
  14. Blasi ER, Rocha R, Rudolph AE, Blomme EA, Polly ML, McMahon EG. Aldosterone/salt induces renal inflammation and fibrosis in hypertensive rats. Kidney Int. 2003; 63: 1791–1800.[CrossRef][Medline] [Order article via Infotrieve]
  15. Baggiolini M. Chemokines and leukocyte traffic. Nature. 1998; 392: 565–568.[CrossRef][Medline] [Order article via Infotrieve]
  16. Wang Y, Rangan GK, Tay YC, Wang Y, Harris DC. Induction of monocyte chemoattractant protein-1 by albumin is mediated by nuclear factor {kappa}B in proximal tubule cells. J Am Soc Nephrol. 1999; 10: 1204–1213.[Abstract/Free Full Text]
  17. Tang S, Leung JC, Abe K, Chan KW, Chan LY, Chan TM, Lai KN. Albumin stimulates interleukin-8 expression in proximal tubular epithelial cells in vitro and in vivo. J Clin Invest. 2003; 111: 515–527.[CrossRef][Medline] [Order article via Infotrieve]
  18. Hene RJ, Boer P, Koomans HA, Mees EJ. Plasma aldosterone concentrations in chronic renal disease. Kidney Int. 1982; 21: 98–101.[Medline] [Order article via Infotrieve]
  19. Berl T, Katz FH, Henrich WL, de Torrente A, Schrier RW. Role of aldosterone in the control of sodium excretion in patients with advanced chronic renal failure. Kidney Int. 1978; 14: 228–235.[Medline] [Order article via Infotrieve]
  20. Conn JW, Knopf RF. Clinical characteristics of primary aldosteronism from analysis of 145 cases. Am J Surg. 1964; 107: 159–172.[CrossRef][Medline] [Order article via Infotrieve]
  21. Chrysostomou A, Becker G. Spironolactone in addition to ACE inhibition to reduce proteinuria in patients with chronic renal disease. N Engl J Med. 2001; 345: 925–926.[Free Full Text]
  22. Epstein M. Aldosterone receptor blockade and the role of eplerenone: evolving perspectives. Nephrol Dial Transplant. 2003; 18: 1984–1992.[Free Full Text]
  23. Sato A, Hayashi K, Naruse M, Saruta T. Effectiveness of aldosterone blockade in patients with diabetic nephropathy. Hypertension. 2003; 41: 64–68.[Abstract/Free Full Text]
  24. Cockcroft DW, Gault MH. Prediction of creatinine clearance from serum creatinine. Nephron. 1976; 16: 31–41.[Medline] [Order article via Infotrieve]
  25. Bujalska IJ, Walker EA, Tomlinson JW, Hewison M, Stewart PM. 11ß-Hydroxysteroid dehydrogenase type 1 in differentiating omental human preadipocytes: from de-activation to generation of cortisol. Endocr Res. 2002; 28: 449–461.[CrossRef][Medline] [Order article via Infotrieve]
  26. Howie AJ, Ferreira MA, Adu D. Prognostic value of simple measurement of chronic damage in renal biopsy specimens. Nephrol Dial Transplant. 2001; 16: 1163–1169.[Abstract/Free Full Text]
  27. Thomas ME, Harris KP, Walls J, Furness PN, Brunskill NJ. Fatty acids exacerbate tubulointerstitial injury in protein-overload proteinuria. Am J Physiol Renal Physiol. 2002; 283: F640–F647.[Abstract/Free Full Text]
  28. Couchoud C, Pozet N, Labeeuw M, Pouteil-Noble C. Screening early renal failure: cut-off values for serum creatinine as an indicator of renal impairment. Kidney Int. 1999; 55: 1878–1884.[CrossRef][Medline] [Order article via Infotrieve]
  29. Gerling IC, Sun Y, Ahokas RA, Wodi LA, Bhattacharya SK, Warrington KJ, Postlethwaite AE, Weber KT. Aldosteronism: an immunostimulatory state precedes proinflammatory/fibrogenic cardiac phenotype. Am J Physiol Heart Circ Physiol. 2003; 285: H813–H821.[Abstract/Free Full Text]
  30. Young M, Fullerton M, Dilley R, Funder J. Mineralocorticoids, hypertension, and cardiac fibrosis. J Clin Invest. 1994; 93: 2578–2583.[Medline] [Order article via Infotrieve]
  31. Ota T, Tamura M, Osajima A, Doi Y, Kudo H, Anai H, Miyazaki M, Nishino T, Nakashima Y. Expression of monocyte chemoattractant protein-1 in proximal tubular epithelial cells in a rat model of progressive kidney failure. J Lab Clin Med. 2002; 140: 43–51.[CrossRef][Medline] [Order article via Infotrieve]
  32. Grandaliano G, Gesualdo L, Ranieri E, Monno R, Montinaro V, Marra F, Schena FP. Monocyte chemotactic peptide-1 expression in acute and chronic human nephritides: a pathogenetic role in interstitial monocytes recruitment. J Am Soc Nephrol. 1996; 7: 906–913.[Abstract]
  33. Wada T, Furuichi K, Sakai N, Iwata Y, Yoshimoto K, Shimizu M, Takeda SI, Takasawa K, Yoshimura M, Kida H, Kobayashi KI, Mukaida N, Naito T, Matsushima K, Yokoyama H. Up-regulation of monocyte chemoattractant protein-1 in tubulointerstitial lesions of human diabetic nephropathy. Kidney Int. 2000; 58: 1492–1499.[CrossRef][Medline] [Order article via Infotrieve]
  34. Reams GP, Bauer JH. Effect of enalapril in subjects with hypertension associated with moderate to severe renal dysfunction. Arch Intern Med. 1986; 146: 2145–2148.[Abstract]
  35. Cameron JS. Proteinuria and progression in human glomerular diseases. Am J Nephrol. 1990; 10 (suppl 1): 81–87.[Medline] [Order article via Infotrieve]
  36. Eddy AA, Giachelli CM. Renal expression of genes that promote interstitial inflammation and fibrosis in rats with protein-overload proteinuria. Kidney Int. 1995; 47: 1546–1557.[Medline] [Order article via Infotrieve]
  37. Zoja C, Donadelli R, Colleoni S, Figliuzzi M, Bonazzola S, Morigi M, Remuzzi G. Protein overload stimulates RANTES production by proximal tubular cells depending on NF-{kappa}B activation. Kidney Int. 1998; 53: 1608–1615.[CrossRef][Medline] [Order article via Infotrieve]
  38. Hollenberg NK. Aldosterone in the development and progression of renal injury. Kidney Int. 2004; 66: 1–9.[CrossRef][Medline] [Order article via Infotrieve]
  39. Ahokas RA, Warrington KJ, Gerling IC, Sun Y, Wodi LA, Herring PA, Lu L, Bhattacharya SK, Postlethwaite AE, Weber KT. Aldosteronism and peripheral blood mononuclear cell activation: a neuroendocrine-immune interface. Circ Res. 2003; 93: e124–e135.[Abstract/Free Full Text]
  40. Ahokas RA, Sun Y, Bhattacharya SK, Gerling IC, Weber KT. Aldosteronism and a proinflammatory vascular phenotype: role of Mg2+, Ca2+, and H2O2 in peripheral blood mononuclear cells. Circulation. 2005; 111: 51–57.[Abstract/Free Full Text]
  41. Garnier A, Bendall JK, Fuchs S, Escoubet B, Rochais F, Hoerter J, Nehme J, Ambroisine ML, De Angelis N, Morineau G, d’Estienne P, Fischmeister R, Heymes C, Pinet F, Delcayre C. Cardiac specific increase in aldosterone production induces coronary dysfunction in aldosterone synthase-transgenic mice. Circulation. 2004; 110: 1819–1825.[Abstract/Free Full Text]
  42. Bologa RM, Levine DM, Parker TS, Cheigh JS, Serur D, Stenzel KH, Rubin AL. Interleukin-6 predicts hypoalbuminemia, hypocholesterolemia, and mortality in hemodialysis patients. Am J Kidney Dis. 1998; 32: 107–114.[Medline] [Order article via Infotrieve]
  43. Zimmermann J, Herrlinger S, Pruy A, Metzger T, Wanner C. Inflammation enhances cardiovascular risk and mortality in hemodialysis patients. Kidney Int. 1999; 55: 648–658.[CrossRef][Medline] [Order article via Infotrieve]
  44. Coletta I, Soldo L, Polentarutti N, Mancini F, Guglielmotti A, Pinza M, Mantovani A, Milanese C. Selective induction of MCP-1 in human mesangial cells by the IL-6/sIL-6R complex. Exp Nephrol. 2000; 8: 37–43.[CrossRef][Medline] [Order article via Infotrieve]
  45. Sun Y, Zhang J, Zhang JQ, Ramires FJ. Local angiotensin II and transforming growth factor-ß1 in renal fibrosis of rats. Hypertension. 2000; 35: 1078–1084.[Abstract/Free Full Text]
  46. Fujisawa G, Okada K, Muto S, Fujita N, Itabashi N, Kusano E, Ishibashi S. Spironolactone prevents early renal injury in streptozotocin-induced diabetic rats. Kidney Int. 2004; 66: 1493–1502.[CrossRef][Medline] [Order article via Infotrieve]
  47. Juknevicius I, Segal Y, Kren S, Lee R, Hostetter TH. Effect of aldosterone on renal transforming growth factor-ß. Am J Physiol Renal Physiol. 2004; 286: F1059–F1062.[Abstract/Free Full Text]
  48. Shankland SJ, Scholey JW, Ly H, Thai K. Expression of transforming growth factor-ß1 during diabetic renal hypertrophy. Kidney Int. 1994; 46: 430–442.[Medline] [Order article via Infotrieve]
  49. Pfeiffer A, Middelberg-Bisping K, Drewes C, Schatz H. Elevated plasma levels of transforming growth factor-ß1 in NIDDM. Diabetes Care. 1996; 19: 1113–1117.[Abstract]
  50. Goumenos DS, Tsakas S, El Nahas AM, Alexandri S, Oldroyd S, Kalliakmani P, Vlachojannis JG. Transforming growth factor-ß(1) in the kidney and urine of patients with glomerular disease and proteinuria. Nephrol Dial Transplant. 2002; 17: 2145–2152.[Abstract/Free Full Text]
  51. McLaughlin N, Gehr TW, Sica DA. Aldosterone-receptor antagonism and end-stage renal disease. Curr Hypertens Rep. 2004; 6: 327–330.[Medline] [Order article via Infotrieve]
  52. Barnes BJ, Howard PA. Eplerenone: a selective aldosterone receptor antagonist for patients with heart failure. Ann Pharmacother. 2005; 39: 68–76.[Abstract/Free Full Text]
  53. Levy DG, Rocha R, Funder JW. Distinguishing the antihypertensive and electrolyte effects of eplerenone. J Clin Endocrinol Metab. 2004; 89: 2736–2740.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
H. Nishimura, Y. Ito, M. Mizuno, A. Tanaka, Y. Morita, S. Maruyama, Y. Yuzawa, and S. Matsuo
Mineralocorticoid receptor blockade ameliorates peritoneal fibrosis in new rat peritonitis model
Am J Physiol Renal Physiol, May 1, 2008; 294(5): F1084 - F1093.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Nagase, H. Matsui, S. Shibata, T. Gotoda, and T. Fujita
Salt-Induced Nephropathy in Obese Spontaneously Hypertensive Rats Via Paradoxical Activation of the Mineralocorticoid Receptor: Role of Oxidative Stress
Hypertension, November 1, 2007; 50(5): 877 - 883.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. W. Good
Nongenomic Actions of Aldosterone on the Renal Tubule
Hypertension, April 1, 2007; 49(4): 728 - 739.
[Full Text] [PDF]


Home page
HypertensionHome page
S. Shibata, M. Nagase, S. Yoshida, H. Kawachi, and T. Fujita
Podocyte as the Target for Aldosterone: Roles of Oxidative Stress and Sgk1
Hypertension, February 1, 2007; 49(2): 355 - 364.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
M. Nagase, S. Yoshida, S. Shibata, T. Nagase, T. Gotoda, K. Ando, and T. Fujita
Enhanced Aldosterone Signaling in the Early Nephropathy of Rats with Metabolic Syndrome: Possible Contribution of Fat-Derived Factors
J. Am. Soc. Nephrol., December 1, 2006; 17(12): 3438 - 3446.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
J. Lepenies and M. Quinkler
MR blockade in patients with chronic renal disease--not the more the merrier, but the earlier the better
Nephrol. Dial. Transplant., November 1, 2006; 21(11): 3343 - 3344.
[Full Text] [PDF]


Home page
EndocrinologyHome page
C. Guo, D. Martinez-Vasquez, G. P. Mendez, M. F. Toniolo, T. M. Yao, E. M. Oestreicher, T. Kikuchi, N. Lapointe, L. Pojoga, G. H. Williams, et al.
Mineralocorticoid Receptor Antagonist Reduces Renal Injury in Rodent Models of Types 1 and 2 Diabetes Mellitus
Endocrinology, November 1, 2006; 147(11): 5363 - 5373.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this ar