Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2005;111:598-606
doi: 10.1161/01.CIR.0000154554.65287.F5
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tsoporis, J. N.
Right arrow Articles by Parker, T. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsoporis, J. N.
Right arrow Articles by Parker, T. G.
Related Collections
Right arrow Structure
Right arrow Animal models of human disease
Right arrow Apoptosis
Right arrow Hypertrophy
Right arrow Physiological and pathological control of gene expression
Right arrow Acute myocardial infarction

(Circulation. 2005;111:598-606.)
© 2005 American Heart Association, Inc.


Heart Failure

S100B Expression Modulates Left Ventricular Remodeling After Myocardial Infarction in Mice

James N. Tsoporis, PhD; Alexander Marks, MD; Abraham Haddad, MSc; Fayez Dawood, DVM; Peter P. Liu, MD; Thomas G. Parker, MD

From the Division of Cardiology, St Michael’s Hospital (J.N.T., A.H., T.G.P.), and Banting and Best Department of Medical Research (A.M.), Heart and Stroke/Richard Lewar Centre of Excellence (F.D., P.P.L.), University of Toronto, Toronto, Canada.

Reprint requests to Thomas G. Parker, Division of Cardiology, St Michael’s Hospital, 30 Bond St, Queen Wing, Room 6-044, Toronto, Ontario M5B 1W8, Canada. E-mail parkertg{at}smh.toronto.on.ca

Received June 14, 2004; revision received September 30, 2004; accepted October 22, 2004.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— S100B, a 20-kDa, Ca2+-binding dimer, is a putative intrinsic negative regulator of myocardial hypertrophy expressed after myocardial infarction. S100B-overexpressing transgenic (TG) and S100B-knockout (KO) mice have been generated to assess the consequences of S100B expression and altered hypertrophy after infarction.

Methods and Results— We compared 21 wild-type (WT), 20 TG, and 24 KO mice over 35 days after experimental myocardial infarction with sham-operated controls (n=56). Of those, 4 WT-infarcted mice, 7 TG-infarcted mice, and 1 KO-infarcted mouse and no sham-operated mice died during the observation period. Among survivors, echocardiography, hemodynamic studies, and postmortem examination indicated that the WT and KO groups of infarcted mice mounted a hypertrophic response that was augmented in KO mice. The S100B-overexpressing TG group did not develop hypertrophy but demonstrated increased apoptosis. The postinfarct end-diastolic pressure was lower in KO mice than in WT mice, in accordance with other structural, hemodynamic, and functional parameters, which suggests that abrogation of S100B expression augmented hypertrophy, decreased apoptosis, and was beneficial to preservation of cardiac function within this time frame.

Conclusions— S100B regulates the hypertrophic response and remodeling in the early postinfarct period and represents a potential novel therapeutic target.


Key Words: hypertrophy • proteins • myocardial infarction • apoptosis • remodeling


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The structural and functional consequences of myocardial infarction (MI) are related to alterations in left ventricular (LV) geometry called post-MI ventricular remodeling.1 These changes involve myocyte necrosis and apoptosis, scar formation, ventricular dilation, and hypertrophy of noninfarcted myocardium. Hypertrophy of noninfarcted muscle is regulated by a balance of positive effectors such as {alpha}1-adrenergic agonists, angiotensin II, and peptide growth factors and negative effectors such as myocyte-enriched calcineurin-interacting protein, mitogen-activated protein kinase-phosphatase-1, and potentially S100B.2–5 S100B, a 20-kDa EF-hand Ca2+-binding dimer, is a member of a multigenic family of calcium-binding proteins that exhibit tissue-specific expression and has been implicated in the regulation of a number of intracellular activities by its interaction with effector proteins.6–9 S100B is expressed in cell types that constitute the nervous system (eg, astrocytes and neuronal subpopulations) and other cell lineages (eg, skeletal muscle cells).7 S100B can also be released from cells and interact in a paracrine (eg, microglia) or autocrine (eg, astrocytes) manner with trophic or apoptotic consequences depending on the concentration attained.9 We have identified S100B as a putative intrinsic negative-feedback regulator of the hypertrophic response induced in the myocardium after MI in human subjects and experimental rodent models and have shown it to be capable of inhibiting the {alpha}1-adrenergic–induced hypertrophy in cultured neonatal rat cardiac myocytes and transgenic mice.4,5,10 In addition to induction of S100B, the post-MI hypertrophic response is accompanied by induction of a program of fetal gene reexpression that encompasses ß-myosin heavy chain (ß-MHC), the skeletal isoform of {alpha}-actin (skACT), and atrial natriuretic factor (ANF).5 Although we have shown that S100B inhibits ß-protein kinase C signaling in cultured cardiac myocytes,4 the exact molecular mechanisms through which S100B modulates hypertrophy remain to be defined.

Although teleologically, the myocardial hypertrophy after MI appears to be a manifestation of an early adaptive compensatory response to mitigate the consequences of loss of cardiac muscle, this concept has not been fully tested in animal models, and both positive and negative effectors of the hypertrophic response are potential therapeutic targets to modify this response.1,3,11 To gain further insight into the action of S100B in post-MI myocardial hypertrophy and ventricular remodeling, we used S100B transgenic (TG) mice that overexpress S100B and S100B-knockout (KO) mice that do not express S100B. We used these mouse models to examine the effects of a potentially attenuated (TG mice) or exaggerated (KO mice) hypertrophic response on survival and LV architecture after experimental MI. Our results indicate that KO mice exhibit greater hypertrophy, less LV dilation, less apoptosis, and improved hemodynamics in the early post-MI period.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Mice
S100B TG mice containing multiple copies ({approx}8) of the human S100B gene under the control of its own promoter and S100B-KO mice with a null mutation of S100B were derived on a CD1 background as described previously.12,13 TG, KO, and control wild-type (WT) CD1 mice (Charles River, St. Constant, Quebec, Canada) were housed in microisolators. All animal experiments conformed to protocols approved by St. Michael’s Hospital and University Health Network Animal Care Committees.

Left Coronary Artery Ligation
Left anterior descending (LAD) coronary artery ligation was performed as described previously.14 In brief, 8-week-old mice were anesthetized with ketamine (50 mg/kg) and xylazine (10 mg/kg) intraperitoneally. A left thoracotomy was performed, and a 7-0 silk suture was placed through the myocardium into the anterolateral LV wall. LAD-ligated mice were maintained for 35 days and were compared with sham-operated (nonligated) mice.

Monitoring of Systolic Pressure and Heart Rate
Because the anesthetics ketamine and xylazine induce a marked negative chronotropic effect,15 on day 35 after coronary artery ligation, LV systolic blood pressure (LVSP) and heart rate (HR) were measured with an indirect mouse tail blood pressure system (Harvard Apparatus) according to the instructions supplied by the manufacturer.

Echocardiographic Assessment of Cardiac Hypertrophy and Function
Transthoracic echocardiography, with a 12-mHz probe (Hewlett Packard),5 was performed with mice anesthetized with 1% isoflurane (Halocarbon) using a vaporizer and 0.2 L/min oxygen. LV end-diastolic (LVEDD) and end-systolic (LVESD) diameters, end-diastolic interventricular septal (SWT), and anterolateral (LWT) wall thickness, and LV percent fractional shortening (FS) were measured from M-mode tracings (short-axis view) at the level of the papillary muscles and recorded as the consensus of 2 blinded observers (J.N.T. and T.G.P.) with interobserver variability <10%. FS was calculated with the following equation: FS (%)=(LVEDD–LVESD)/LVEDDx100.

In Situ Hemodynamics
For in situ measurements, the animals were anesthetized with ketamine hydrochloride (50 mg/kg) and xylazine (10 mg/kg) intraperitoneally, and LV pressures were measured by fluid-filled (heparinized saline [100 U/mL]) catheters as previously described5 or by a Millar microtip catheter transducer. Mean arterial pressure (MAP) was calculated with the following equation: MAP (mm Hg)=1/3(SP–DP)+DP, where SP is systolic pressure and DP is diastolic pressure. There were no significant differences in the hemodynamic measurements obtained by fluid-filled catheters compared with the Millar microtip catheter in any experimental group.

Harvesting of Cardiac Tissue
On day 35 after LAD ligation, mice were euthanized to harvest cardiac tissue for measurement of LV and right ventricular weights, RNA and protein isolation, and fixation.5 Infarct size was determined as described previously.16 Infarct size (in percent) was calculated as total infarct circumference divided by total LV circumference times 100.

Ribonuclease Protection Assay
RNA was isolated from tissues by a 1-step acid guanidinium phenol method.17 RNase protection assays to determine steady-state levels of S100B mRNA, ANF mRNA, ß-MHC mRNA, and GAPDH mRNA were performed as described previously.5

Real-Time Quantitative Reverse Transcription–Polymerase Chain Reaction
RNA was extracted as above and analyzed with thermoscript 1-step quantitative reverse transcription–polymerase chain reaction (RT-PCR) with the platinum Taq kit to synthesize cDNA and subsequent real-time quantitative RT-PCR (Applied Biosystems). The gene-specific sequences of oligonucleotide primers (Qiagen) were based on DNA sequences in the National Center for Biotechnology database unless otherwise stated and were as follows: human S100B, TGGACAATGATGGAGACGG (forward), ATTAGCTACAACACGGCTGG (reverse); mouse S100B,18 GCTGACCACCATGCCCCTGTAG (forward), CTGGCCATTCCCTCCTCTGTC (reverse); ANF, CCTGGGACCCCTCCTATA (forward), AGCCCTCAGTTTGCTTTTCAA (reverse); ß-MHC, GTGCCAAGGGCCTGAATGAG (forward), GCAAAGGCTCCAGGTCTGA (reverse); skACT, AGGAAGGACCTGTACGCCAA (forward), GTACATGGTAGTGCCCCCTGA (reverse); {alpha}-MHC, CTGCTGGAGAGGTTATTCCTCG (forward), GGAAGAGTGAGCGGCGCATCAAGG (reverse); cardiac sarcoplasmic reticulum Ca+2-ATPase 2a19 (SERCA 2a), GGCTTTTACAGGGCGAGAGT (forward), ACCAGATTGACCCAGAGTAACTG (reverse); ryanodine receptor,20 GACGGCAGAAGCCACTCACCTGCG (forward), CCTGCAGAGAAACTGACAACTGGA (reverse); and GAPDH, GTGCAGTGCCAGCCTCGTC (forward), GGCAGCACCAGTGGATGCAG (reverse). The gene-specific oligonucleotide primers were added to a mixture that contained a 1x concentration of SYBR green PCR master mix, 0.25 U/mL multiscribe reverse transcriptase, 0.4 U/mL RNase inhibitor, and 10 ng of total tissue RNA in a 50-mL mixture according to the manufacturer’s protocol (Applied Biosystems). The relative quantification of gene expression by real-time RT-PCR in a sample was determined by comparing the target-amplified product against GAPDH (internal standard) within the same sample. GAPDH mRNA expression was not significantly different among the various groups. Gene expression in the MI groups was compared with their respective sham group, which was set at 1.

Western Blotting
Western blotting was performed on aliquots of tissue extracts that contained 500 µg of total protein or bovine brain S100B (Calbiochem; 5 to 50 ng) as described previously.5

Cardiac Myocyte Cultures
Neonatal cardiac myocytes were isolated from the ventricles of 2-day-old WT, TG, and KO mice as described previously.4,5 Cell protein was determined after 48-hour treatment with either vehicle (ascorbic acid 100 µmol/L) or 20 µmol/L norepinephrine (NE) and was quantified by continuous labeling with [14C]phenylalanine as described previously.4 There were at least 3 cell culture dishes in each group. There was no change in the number of cells after treatment of cultures with any agent.

Measurement of Apoptosis in LV Transverse Sections
LV transverse sections (4 µm thick) were subjected to the TUNEL (terminal dUTP nick end-labeling) method with the CardioTACS In Situ Apoptosis Detection Kit according to the manufacturer’s instructions (R&D Systems). To identify cells or bodies of cardiac origin, the sections were double stained with MF-20, a monoclonal anti-myosin antibody (working dilution 1:50; Developmental Studies Hybridoma Bank, University of Iowa). A goat anti-mouse TRITC conjugate (Sigma Chemical Co; working dilution 1:200) was used as secondary antibody for LV transverse sections. Thus, for each heart, the number of TUNEL-positive cells (blue nuclei) was scored per total number of myocytes. From each section, 17 light microscopic fields (x400) selected at random that bordered each side of the infarct were used to count the number of cells positively labeled for nuclear DNA fragmentation. The average number of cells in fields selected from regions that bordered infarcts was 98 (range 88 to 108). In addition, 10 fields were selected at random from the infarct and remote myocardial regions. No TUNEL-positive cells were identified in these regions. Sections from the LV free wall from WT sham, TG sham, and KO sham mice were examined in an identical fashion. The average number of cells in these fields was 107 (range 95 to 119). Values are presented as mean±SEM percent TUNEL-positive myocytes per total myocytes per field (x400), with 6 to 8 sections per group.

Assessment of Apoptosis by DNA Laddering
The methodology used for the assessment of apoptosis by DNA laddering in LV tissue has been described previously.21–23

Analysis of Apoptosis in Neonatal Cultured Mouse Myocytes
Neonatal CD1, KO, and TG mouse cardiac myocytes were analyzed for apoptosis by the TUNEL method or after visualization of nuclear morphology with the fluorescent DNA-binding dye Hoechst 33342 (Sigma). A sheep anti-mouse horseradish peroxidase (Amersham Biosciences; working dilution 1:500) conjugate and a goat anti-mouse TRITC conjugate (Sigma; working dilution 1:200) were used as secondary antibodies after TUNEL staining and Hoechst 33342, respectively. On day 2 of serum-free culture, cells were treated for 48 hours with (recombinant bovine) S100B (Calbiochem; 0.0001 to 10 µmol/L), (human) TNF-{alpha} (R&D Systems; 100 pg/mL), or H2O2 (100 µmol/L) or vehicle (50 mmol/L Tris buffer, pH 8), then fixed (70% alcohol and 30% acetone) and incubated with 10 µmol/L Hoechst and MF-20 or stained by the TUNEL method. Individual nuclei were visualized at x400 by light or fluorescent microscopy and analyzed for apoptotic characteristics. Ten fields were selected at random per culture dish for quantification. The average number of cells in these fields was 80 (range 70 to 90). The apoptotic index (percentage of apoptotic nuclei) was calculated as (myocyte apoptotic nuclei/total myocyte nuclei)x100. Sample identities were concealed during scoring, and at least 6 culture dishes were scored per group.

Statistical Analysis
Treated/control ratios were tested for deviation from unity by calculation of confidence limits. Mean values were compared by 1-way ANOVA followed by a Dunnett test when appropriate and by Student’s t test where appropriate. Only probability values of P<0.05 were accepted as statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
MI and Survival
A total of 136 mice were studied, 80 that underwent LAD ligation and 56 that were sham-operated. Of those undergoing LAD ligation, 15 (5 WT, 6 TG, and 4 KO mice) died within 24 hours and were excluded from the study. All sham-operated mice survived surgery and to the end of the observation period. Among LAD-ligated mice, there was 1 death in KO mice (1/24), 4 deaths in WT mice (4/21), and 7 deaths in TG mice (7/20). Death in TG mice occurred due to rupture of the LV. There was a significant difference in survival between KO and TG mice (P=0.01; Figure 1). No sham-operated mice but all LAD-ligated mice developed LV transmural infarction and subsequent scar formation (Figure 2). Infarct sizes for the groups of mice studied were 41±4% (WT), 43±4% (TG), and 38±3% (KO), with extensive apical involvement, which was not significantly different from each other.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 1. Comparison of survival of mice after coronary artery ligation (LAD ligation). !P<0.05 vs KO-LAD ligation.



View larger version (80K):
[in this window]
[in a new window]
 
Figure 2. Mice were euthanized 35 days after sham or coronary artery ligation. Photomicrograph depicting perfusion-fixed midlevel left and right ventricular transverse slices.

Induction of S100B and Fetal Gene Program
Hearts of euthanized mice were examined for evidence of post-MI gene expression with RNase protection and quantified by real-time RT-PCR (Figures 3A and 3B; Table 1). S100B was not detected in sham-operated or KO mice by RNase protection. After MI, both the human S100B transgene and the mouse endogenous S100B gene were induced in TG mice, and the mouse endogenous S100B gene was induced in WT mice (Figure 3B; 10.65±0.89-fold, 1.79±0.23-fold, and 2.11±0.15-old, respectively, by real-time RT-PCR, n=6). There was no induction of the hypertrophic fetal genes ANF, ß-MHC, and skACT in sham-operated or TG LAD-ligated mice 35 days after injury (Figure 3A; Table 1). Fetal gene expression was induced in WT and, to a greater magnitude, KO mice (Figure 3A; Table 1). {alpha}-MHC and the calcium binding proteins, SERCA 2a and the ryanodine receptor, were downregulated in WT and KO mice (Table 1). By quantitative Western blot analysis, the band immunoreactive with S100B from the LV of TG-ligated mice was of greater intensity than that observed in WT-ligated mice, corresponding to {approx}10 and 1 ng of S100B protein per 500 µg of total myocardial protein. Assuming a molecular weight of 20 kDa for S100B dimer, the concentration of S100B in total ventricular tissue of TG and WT mice after infarction is {approx}60 and 6 nmol/L, respectively (Figure 3C).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 3. Mice were euthanized 35 days after coronary artery ligation (LAD Lig.). Steady state levels of ANF, ß-MHC, GAPDH (A), human S100B, and endogenous mouse S100B mRNAs (B) were determined by RNase protection. Protected fragments specific for human S100B (210 bp), mouse S100B (135 bp), ANF (600 bp), ß-MHC (218 bp), and GAPDH (355 bp) mRNAs are shown in composite figures depicting results of representative experiments using RNA from human brain, mouse brain, and fetal and adult mice hearts. Western analysis was performed on heart extracts. Position of migration of S100B is shown in representative blot (C). Purified bovine S100B protein was used as quantitative control.


View this table:
[in this window]
[in a new window]
 
TABLE 1. LV Gene Expression After Coronary Artery Ligation

LV Weight and Myocyte Protein
Morphometric analysis confirmed that the hypertrophy of the noninfarcted muscle was blunted in TG mice overexpressing S100B and exaggerated in KO mice that did not express S100B (Figure 2). All LAD-ligated and sham-operated mice had similar total body weights (data not shown); however, the LV weight/body weight ratios were significantly increased in LAD-ligated WT and KO mice, but not in TG mice, compared with their respective sham-operated controls (Figure 4A). Moreover, the increase in KO mice was significantly higher than in WT mice (Figure 4A). LAD ligation had no significant effect on the right ventricle weight/body weight or lung weight in any group of mice (data not shown). To confirm a direct action of S100B on cardiac myocytes, primary myocyte cultures were established from hearts of neonatal, WT, TG, and KO mice. The {alpha}1-adrenergic agent NE did not increase myocyte protein content in TG myocytes but increased cell protein content 1.3-fold in WT myocytes and provoked a significantly greater 1.7-fold increase in KO myocytes (Figure 4B).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 4. LV weight–to–body weight ratios of sham-operated and LAD-ligated (Lig.) WT, TG, and KO mice 35 days after injury. Bars are mean±SEM of LV weight–to–body weight ratios (g/kg; A). *P<0.05 vs respective sham group; !P<0.05 vs WT LAD-ligated group. Neonatal cardiac myocytes from WT, TG, and KO mice were treated with either vehicle or norepinephrine (NE, 20 µmol/L). Incorporation of [14C]phenylalanine into newly synthesized protein after 48 hours was determined (B). Bars are mean±SEM from 6 separate experiments normalized to protein incorporation in vehicle group. *P<0.05 vs respective vehicle-treated group; !P<0.05 vs NE-treated WT group.

Echocardiographic Measurements
At day 35, echocardiographic parameters of sham-operated WT, TG, and KO mice were not significantly different. SWT increased significantly in infarcted WT and KO mice but not TG mice over their respective sham-operated controls, and this increase was significantly higher in KO mice than in WT mice (Table 2). All groups exhibited significant decreases in infarcted LWT and increases in dilation of the LV chamber, on the basis of increased LVEDD and LVESD compared with respective sham-operated mice. However, there was less thinning of the infarcted LV wall and less dilation of the LV chamber in KO mice than in WT or TG mice (Table 2). Thus, in the absence of S100B, LV architecture could be interpreted as more favorable for post-MI recovery. Conversely, overexpression of S100B in TG mice promoted increased dilatation of the LV chamber.


View this table:
[in this window]
[in a new window]
 
TABLE 2. LV Dimensions as Assessed by Echocardiography After Coronary Artery Ligation

LV Function After LAD Ligation
We also examined post-MI changes in parameters related to cardiac function in vivo 35 days after surgery before euthanasia. In all groups of mice, there was a decrease in FS, LVSP, and MAP and an increase in LVEDP compared with sham-operated controls (Tables 2 and 3Down). The increase in LVEDP and the fall in FS were significantly attenuated in KO mice compared with WT mice (Tables 2 and 3 Down).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Hemodynamic Data After Coronary Artery Ligation

LV Apoptosis After LAD Ligation
We also examined the hearts of euthanized mice for evidence of apoptosis at 7, 14, and 35 days after experimental MI. DNA samples from peri-infarct cardiac tissue displayed the laddering pattern of fragmented DNA characteristic of apoptosis beginning at 7 days after LAD ligation in TG mice and 14 days after LAD ligation in WT mice. Thirty-five days after LAD ligation, all groups displayed DNA fragmentation that was absent in corresponding sham-operated mice (Figure 5A). We also determined the relative number of apoptotic cells in the peri-infarct region by TUNEL staining in LV sections of WT, TG, and KO sham-operated mice and 35 days after LAD ligation (Figure 5B). A significantly greater number of apoptotic cells were detected in all LAD-ligated mice than in their respective sham-operated controls (Figure 5B). The percent of apoptotic over viable cardiac myocytes was highest in TG mice (0.22±0.04%), intermediate in WT mice (0.13±0.03%), and lowest in KO mice (0.06±0.03%), with a significant difference between KO mice and TG mice (Figure 5B).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 5. Representative agarose gel electrophoresis of peri-infarct myocardial DNA fragmentation from WT, KO, or TG mice sham operated at 7, 14, and 35 days after LAD ligation (A). Scored values expressed as percent TUNEL-positive (apoptotic) myocytes per total myocytes per high-power field (B). Values are mean±SEM from at least 6 hearts. *P<0.05 vs respective sham group; !P<0.05 vs TG LAD-ligated group. Lig. indicates ligation.

Cardiac Myocyte Apoptosis and S100B
To address the question of whether exogenous S100B can induce cardiac myocyte apoptosis directly, primary cultures were established from hearts of WT, TG, and KO neonatal mice. Treatment of WT myocyte cultures with increasing doses of S100B caused DNA fragmentation as visualized by TUNEL (Figure 6A). Myocyte apoptosis was confirmed by colabeling with the myocyte-specific marker MF-20 and visualization with horseradish peroxidase staining (Figure 6B). The small nonmyocyte population did not undergo S100B-induced apoptosis (Figure 6B). Myocyte apoptosis–associated nuclear morphology, identified by the fluorescent DNA-binding dye Hoechst 33342 and colabeling by MF-20, was performed as a second independent assessment of apoptosis (Figure 6C). Apoptotic cardiac myocytes were counted and expressed as a percentage of total cardiac myocytes. In this quantitative assay, a significant increase in myocyte apoptosis was first observed at 100 nmol/L S100B relative to vehicle-treated myocytes regardless of the methodology used to determine apoptosis (Figure 6C). The known apoptotic stimuli TNF-{alpha} and H2O2 also induced cardiomyocyte apoptosis to a degree similar to 10 µmol/L S100B (Figure 6C). The genomic S100B status of cardiomyocytes did not affect their response to extracellular S100B and other apoptotic stimuli, because KO and TG cardiomyocytes exhibited similar dose-dependent apoptosis as WT cardiomyocytes. These stimuli did not induce S100B in any cultured myocyte lineage within the time frame of these experiments (data not shown).



View larger version (55K):
[in this window]
[in a new window]
 
Figure 6. Representative photomicrographs (x400) of TUNEL-stained WT neonatal cardiomyocyte cultures treated with 100 nmol/L S100B. White arrows indicate apoptotic nucleus as visualized by TUNEL staining (A) and TUNEL and anti-sarcomeric myosin staining of cardiomyocyte (B). Black arrow identifies nonapoptotic nonmyocyte (B). Myocytes were treated with increasing doses of S100B (0.0001 to 10 µmol/L), apoptotic doses of TNF-{alpha} (100 pg/mL), H2O2 (100 µmol/L), or vehicle and visualized with Hoechst or TUNEL staining and anti-sarcomeric myosin. Apoptotic cardiomyocytes were counted and expressed as percentage of total cardiomyocytes. Results are mean±SEM from random fields in blinded experiments. Minimum 6 samples were scored per experiment of 3 different cell isolates (C). *P<0.05 vs vehicle control.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The change in geometry after MI is a progressive process that involves LV chamber dilation, infarcted wall thinning, myocyte apoptosis, and compensatory thickening in the noninfarcted region.1,14,24 In the present study, we used TG and KO mice to assess the role of the calcium-binding protein S100B, with its concomitant effects on hypertrophy, in the early (35 day) period after experimental myocardial infarction provoked by LAD ligation. This approach was based on our previous observations suggesting S100B could act as an intrinsic negative modulator of the hypertrophic response. S100B is induced in the peri-infarct region in human and rat heart, inhibits the activation of fetal genes by {alpha}1-adrenergic agonists in cultured myocytes, and limits adrenergic-induced hypertrophy in vivo.4,5 In the present study, induction of an {approx}10-fold higher level of S100B protein in TG mice above that seen in WT animals (Figure 2C) inhibited post-MI hypertrophy as assessed by LV/body weight ratio and SWT (Figures 2 and 4Up; Table 2). By contrast, KO mice demonstrated augmented hypertrophy. Confirming an effect on the full spectrum of the hypertrophic phenotype, upregulation of the fetal genes ANF, ß-MHC, and skACT, seen in WT mice, was attenuated in TG and enhanced in KO mice. The above observations support a role for S100B in limiting the hypertrophic response after infarction and confirmed the utility of S100B TG and KO mice as models for altering this response.

In all 3 groups of mice studied, there was thinning of the infarcted LV wall (LWT) and an increase in the LV cavity based on measurements of LVEDD and LVESD relative to sham-operated controls (Table 2). This indicates that other components of postinfarct remodeling, such as "slippage" of muscle fibers in the peri-infarct region and apoptosis, occur even in the context of modifying the hypertrophic response.1 Indeed, in the context of increased hypertrophy, as is the case in KO mice, there was significantly less mural thinning of the infarct and noninfarct zones and dilatation after MI than in WT mice. This suggested that the enhanced hypertrophic response associated with a block to induction of S100B conferred changes in LV architecture that could be interpreted as more favorable to averting the sequelae in the immediate post-MI period such as LV rupture or early progression to pump failure. The survival data on the 3 groups of mice support this concept, with a significant difference in survival between KO and TG mice.

Consistent with the size of experimental infarction, we found evidence for impaired cardiac function in WT, TG, and KO mice at 35 days after experimental MI, including decreases in FS, LVSP, and MAP and increases in LVEDP, but no overt heart failure. In KO mice, FS was preserved, and notably, the increase in LVEDP was significantly lower than in WT or TG mice. Thus, paradoxically, increased hypertrophy in KO mice, in the setting of less ventricular dilation, was not at the expense of augmented filling pressures and impairment of diastolic filling. Attenuation of LVEDP occurred even with downregulation of SERCA 2a and ryanodine receptor expression in KO mice (Table 1). The impact on preservation of systolic function and ventricular dimensions may predominate over the potential adverse effects of the hypertrophic phenotype on filling in the early postinfarct period. These findings are in agreement with those of a previous study in a rat model showing that induction of additional myocardial hypertrophy with an inhibitor of long-chain fatty oxidation reduced LV dilation and preserved function 13 days after MI.25,26

Global changes in cardiac mass and wall thickness after infarction represent the sum of both myocyte hypertrophy and loss or apoptosis. Overlapping pathways can trigger both hypertrophy and apoptosis, and over a chronic course, they can lead to dilated cardiomyopathy and heart failure.27 The postinfarct hypertrophic response in the myocardium is initiated by multiple trophic signals that include the state of local and systemic sympathetic hyperactivity through {alpha}1-adrenergic stimulation.2,28 We have previously provided experimental evidence that the same {alpha}1-adrenergic pathway that initiates and sustains the hypertrophic response in cardiac myocytes by activating protein kinase C and is subject to negative modulation by S100B also induces S100B.4,10 Although the exact mechanisms by which S100B modulates myocyte hypertrophy are unknown, this protein is capable of binding directly to multiple intracellular targets, and we and others have provided evidence that intracellular S100B is capable of inhibiting the phosphorylation of kinase substrates.4,6,7 Extracellular S100B inhibits myogenic differentiation of rat L6 myoblasts and the expression of the myogenic differentiation markers, including myosin heavy chain, via inactivation of p38 kinase.29 In the brain, S100B is released by astrocytes and at nanomolar concentrations stimulates neurite outgrowth and survival, whereas at micromolar concentrations, it causes astrocyte and neuronal apoptosis, in part through interaction with the receptor for advanced glycation end products (RAGE).21,30 Analogously, we demonstrate that in neonatal mouse cultures, exogenously administered S100B induces apoptosis in a dose-dependent manner beginning at 100 nmol/L, a local or regional concentration that may be achieved in the peri-infarct myocardium, at least in TG mice (Figure 2C). Although there may be differences in susceptibility to apoptosis between neonatal and adult myocytes, we documented the presence of apoptosis in the peri-infarct region at 35 days after LAD ligation, but not in the heart of sham-operated controls, and confirmed previous observations that apoptosis in peri-infarct myocardium increases with time after infarction.31 Moreover, we found significantly fewer apoptotic cells in the heart of KO mice than in TG mice at day 35 after infarction (Figure 5B). Furthermore, peri-infarct myocyte apoptosis appears earlier at day 7 in TG mice, which coincides with our previously demonstrated timing of induction of S100B at day 7, peaking at day 28.4 S100B may play a role in the regulation of apoptosis in post-MI myocardium by an extracellular mechanism after cellular release from damaged myocytes and interaction with RAGE, resulting in cytochrome c release and the activation of the proapoptotic caspase cascade, as has been reported in N18 neuroblastoma cells in response to micromolar concentrations.30 Relevant to the postinfarct setting, S100B effects overlap and interact with oxidative stress–activated pathways in this cell lineage.30 Alternatively, S100B may induce apoptosis in a RAGE-independent manner by interacting with an unidentified receptor, as has been reported in myoblast cell lines via stimulation of reactive oxygen species production and inhibition of the prosurvival kinase ERK1/2.32 Finally, the present studies do not exclude that the intracellular effects of S100B may themselves modulate the apoptotic response of postinfarct myocytes. In total, S100B expression after infarction may modulate global remodeling by distinct intracellular and extracellular mechanisms that regulate both myocyte growth and apoptosis.

The effects of S100B on myocyte growth and function stand in contrast to that of S100A1, the most abundant S100 protein expressed in cardiac muscle under basal conditions.6 S100A1 exhibits increased expression in compensated hypertrophy and decreased expression in human cardiomyopathy, and we have previously demonstrated downregulation of this protein after experimental MI.33–35 S100A1 KO and TG mice demonstrate impaired and augmented cardiac contractile responses to stress, respectively.35–37 S100A1 appears to modulate sarcoplasmic reticulum calcium handling and myofibrillar responsiveness.38 We have demonstrated that unlike S100B, S100A1 plays a role in maintenance of differentiated gene expression.23 Like our proposed mechanism for S100B release, S100A1 is released into the extracellular space in the setting of myocardial injury, but unlike S100B, extracellular S100A1 inhibits apoptosis via activation of ERK 1/2.39 Thus, S100 proteins may differentially regulate myocardial structure and function. Given the capacity of S100A1 and S100B to heterodimerize, phenotypic consequences may depend on the availability and stoichiometry of S100A1 and S100B homodimers and heterodimers.

The present study is limited to the impact of S100B expression on the hypertrophic and apoptotic responses in the early period of healing after MI. Our current model does not reflect decompensated LV dysfunction, and the ultimate impact of S100B on the development of congestive heart failure will require a more long-term study that does not focus on the early hypertrophic response. Furthermore, the regulation of S100B expression in the present transgenic model is dependent on the gene’s own tissue-restricted promoter, which constrains the ability to experimentally regulate the timing and magnitude of expression. Nevertheless, the present results add to an emerging understanding of the cardiac effects of members of the S100 protein family and specifically demonstrate that S100B expression modulates hypertrophy, apoptosis, and remodeling after infarction. Because absence of S100B in KO mice was associated with structural, functional, and survival advantage, S100B could be a novel therapeutic target in post-MI management.


*    Acknowledgments
 
This work was supported by the Canadian Institutes of Health Research. We thank Jean Francois Desjardins and Ali Pourdjabbar for excellent technical assistance.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Pfeffer MA, Braunwald E. Ventricular remodeling after myocardial infarction: experimental observations and clinical implications. Circulation. 1990; 81: 1161–1172.[Abstract/Free Full Text]

2. Parker TG. Molecular biology of cardiac growth and hypertrophy. Herz. 1993; 18: 245–255.[Medline] [Order article via Infotrieve]

3. Hoshijima M, Chien KR. Mixed signals in heart failure: cancer rules. J Clin Invest. 2002; 109: 849–855.[CrossRef][Medline] [Order article via Infotrieve]

4. Tsoporis JN, Marks A, Kahn HJ, Butany JW, Liu PP, O’Hanlon D, Parker TG. S100B inhibits {alpha}1-adrenergic induction of the hypertrophic phenotype in cardiac myocytes. J Biol Chem. 1997; 272: 31915–31921.[Abstract/Free Full Text]

5. Tsoporis JN, Marks A, Kahn HJ, Butany JW, Liu PP, O’Hanlon D, Parker TG. Inhibition of norepinephrine-induced cardiac hypertrophy in S100B transgenic mice. J Clin Invest. 1998; 102: 1609–1616.[Medline] [Order article via Infotrieve]

6. Schafer BW, Heizmann CW. The S100 family of EF-hand calcium-binding proteins: functions and pathology. Trends Biochem Sci. 1996; 21: 134–140.[CrossRef][Medline] [Order article via Infotrieve]

7. Donato R. Functional roles of S100 proteins, calcium binding proteins of the EF-hand type. Biochim Biophys Acta. 1999; 1450: 191–231.[Medline] [Order article via Infotrieve]

8. Donato R. S100: A multigenic family of calcium-modulated proteins of the EF-hand type with intracellular and extracellular functional roles. Int J Biochem Cell Biol. 2001; 33: 637–668.[CrossRef][Medline] [Order article via Infotrieve]

9. Donato R. Intracellular and extracellular roles of S100 proteins. Microsc Res Tech. 2003; 60: 540–551.[CrossRef][Medline] [Order article via Infotrieve]

10. Tsoporis JN, Marks A, Van Eldik LJ, O’Hanlon D, Parker TG. Regulation of the S100B gene by {alpha}1-adrenergic stimulation in cardiac myocytes. Am J Physiol. 2003; 284: H193–H203.

11. Anthonio RL, van Veldhuisen DJ, van Gilst WH. Left ventricular dilatation after myocardial infarction: ACE inhibitors, beta-blockers, or both? J Cardiovasc Pharmacol. 1998; 32 (suppl 1): S1–S8.

12. Friend WC, Clapoff S, Landry C, Becker LE, O’Hanlon D, Allure RJ, Brown IR, Marks A, Roder J, Dunn RJ. Cell-specific expression of high levels of human S100B in transgenic mouse brain is dependent on gene dosage. J Neurosci. 1992; 12: 4337–4346.[Abstract]

13. Xiong ZG, O’Hanlon D, Becker LE, Roder J, MacDonald JF, Marks A. Enhanced calcium transients in glial cells in neonatal cerebellar cultures derived from S100B null mice. Exp Cell Res. 2000; 257: 281–289.[CrossRef][Medline] [Order article via Infotrieve]

14. Sun M, Opavsky MA, Stewart DJ, Rabinovitch M, Dawood F, Wen WH, Liu PP. Temporal response and localization of integrins beta1 and beta3 in the heart after myocardial infarction: regulation by cytokines. Circulation. 2003; 107: 1046–1052.[Abstract/Free Full Text]

15. Yang XP, Liu YU, Rhaleb NE, Kurihara N, Kim HE, Carretero OH. Echocardiographic assessment of cardiac function in conscious and anesthetized mice. Am J Physiol. 1999; 277: H1967–H1974.[Medline] [Order article via Infotrieve]

16. Pfeffer JM, Pfeffer MA, Braunwald E. Myocardial infarct size and ventricular function in rats. Circ Res. 1979; 41: 503–512.

17. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987; 162: 156–159.[Medline] [Order article via Infotrieve]

18. Sakaguchi T, Yan SF, Yan SD, Belov D, Rong LL, Sousa M, Andrassy M, Marso SP, Duda S, Arnold B, Liliensiek B, Nawroth PP, Stern DM, Schmidt AM, Naka Y. Central role of RAGE-dependent neointimal expansion in arterial restenosis. J Clin Invest. 2003; 111: 959–972.[CrossRef][Medline] [Order article via Infotrieve]

19. Arredouani A, Guiot Y, Jonas JC, Liu LH, Nenquin M, Pertusa JA, Rahier J, Rolland JF, Shull GE, Stevens M, Wuytack F, Henquin JC, Gilon P. SERCA ablation does not impair insulin secretion but suggests distinct roles of different sarcoendoplasmic reticulum Ca2+ pumps for Ca2+ homeostasis in pancreatic ß-cells. Diabetes. 2002; 3245–3253.

20. Yang HT, Tweedie D, Wang S, Guia A, Vinogradova T, Bogdanov K, Allen PD, Stern MD, Lakatta EG, Boheler KR. The ryanodine receptor modulates the spontaneous beating rate of cardiomyocytes during development. Proc Natl Acad Sci U S A. 2002; 99: 9225–9230.[Abstract/Free Full Text]

21. Hu J, Van Eldik LJ. S100B induces apoptotic cell death in cultured astrocytes via a nitric oxide–dependent pathway. Biochim Biophys Acta. 1996; 1313: 239–245.[Medline] [Order article via Infotrieve]

22. Sia YT, Lapointe N, Parker TG, Tsoporis JN, Deschepper CF, Calderone A, Pourjabbar A, Jasmin JF, Sarrazin JF, Liu P, Adam A, Butany J, Rouleau JL. Beneficial effects of long-term use of the antioxidant probucol in heart failure in the rat. Circulation. 2002; 105: 2549–2555.[Abstract/Free Full Text]

23. Lapointe N, Tsoporis JN, Parker TG, Blais C Jr, Adam A, Rouleau D, Slaughter G, Clement R, Deschepper CE, Rouleau JL. Comparative effects of a vasopeptidase inhibitor vs. an angiotensin converting enzyme inhibitor on cardiomyocyte apoptosis in rats with heart failure. Mol Cell Biochem. 2003; 254: 235–245.[CrossRef][Medline] [Order article via Infotrieve]

24. Pfeffer JM, Pfeffer MA, Fletcher PJ, Braunwald E. Progressive ventricular remodeling in rat with myocardial infarction. Am J Physiol. 1991; 260: 1406–1441.

25. Gintzon LE, Conant R, Rodrigues DM, Laks MM. Functional significance of hypertrophy of the noninfarcted myocardium after myocardial infarction in humans. Circulation. 1989; 80: 816–822.[Abstract/Free Full Text]

26. Litwin SE, Raya TE, Anderson PG, Litwin CM, Bressler R, Goldman S. Induction of myocardial hypertrophy after coronary artery ligation in rats decreases ventricular dilatation and improves function. Circulation. 1991; 84: 1819–1827.[Abstract/Free Full Text]

27. Hunter JJ, Chien KR. Signaling pathways for cardiac hypertrophy and failure. N Engl J Med. 1999; 341: 1276–1283.[Free Full Text]

28. Sigurdssen A, Held P, Swedberg K. Short-and long-term neurohormonal activation following acute myocardial infarction. Am Heart J. 1993; 126: 1068–1076.[CrossRef][Medline] [Order article via Infotrieve]

29. Sorci G, Riuzz F, Agneletti AL, Marchetti C, Donato R. S100B inhibits myogenic differentiation and myotube formation in a RAGE-independent manner. Mol Cell Biol. 2003; 23: 4870–4881.[Abstract/Free Full Text]

30. Huttunen HJ, Kuja-Panula J, Sorci G, Agneletti AL, Donato R, Rauvala H. Coregulation of neurite outgrowth and cell survival by amphoterin and S100 proteins through RAGE activation. J Biol Chem. 2000; 275: 40096–40105.[Abstract/Free Full Text]

31. Sam F, Sawyer DB, Chang DLF, Eberli FR, Ngoy S, Jain M, Amin J, Apstein CS, Colucci AS. Progressive remodeling and apoptosis late after myocardial infarction in mouse heart. Am J Physiol. 2000; 279: H422–H428.

32. Sorci G, Riuzzi F, Agneletti AL, Marchetti C, Donato R. S100B causes apoptosis in a myoblast cell line in a RAGE-independent manner. J Cell Physiol. 2004; 199: 274–283.[CrossRef][Medline] [Order article via Infotrieve]

33. Ehlermann P, Remppis O, Guddat J, Weimann J, Schnabel PA, Motsch J, Heizmann CW, Katus HA. Right ventricular upregulation of the Ca2+-binding protein S100A1 in chronic pulmonary hypertension. Biochim Biophys Acta. 2000; 1500: 249–255.[Medline] [Order article via Infotrieve]

34. Remppis A, Greten T, Schafer BW, Hunzicker P, Erne P, Katus HA, Heizmann CW. Altered expression of the Ca++-binding protein S100A1 in human cardiomyopathy. Biochim Biophys Acta. 1996; 1313: 253–257.[Medline] [Order article via Infotrieve]

35. Tsoporis JN, Marks A, Zimmer DB, McMahon C, Parker TG. The myocardial protein S100A1 plays a role in the maintenance of normal gene expression in the adult heart. Mol Cell Biochem. 2003; 242: 27–33.[CrossRef][Medline] [Order article via Infotrieve]

36. Most P, Remppis A, Pleger ST, Loffler E, Ehlermann P, Bernotat J, Kleuss C, Heierhorst J, Ruiz P, Witt H, Karczewski P, Mao L, Rockman HA, Duncan ST, Katus HA, Koch WJ. Transgenic overexpression of the Ca2+-binding protein S100A1 in the heart leads to increased in vivo myocardial contractile performance. J Biol Chem. 2003; 278: 33809–33817.[Abstract/Free Full Text]

37. Du XJ, Cole TJ, Tenis N, Gao XM, Kontgen F, Kemp BE, Heierhorst J. Impaired cardiac contractility response to hemodynamic stress in S100A1-deficient mice. Mol Cell Biol. 2002; 22: 2821–2829.[Abstract/Free Full Text]

38. Kiewitz R, Acklin C, Schafer BW, Maco B, Uhrik B, Wuytack F, Erne P, Heizmann CW. Ca2+-dependent interaction of S100A1 with the sarcoplasmic reticulum Ca2+-ATPase2a and phospholamban in human heart. Biochem Biophys Res Commun. 2003; 306: 550–557.[CrossRef][Medline] [Order article via Infotrieve]

39. Most P, Boerries M, Eicher C, Schweda C, Ehlermann P, Pleger ST, Loeffler E, Koch WJ, Katus HA, Schoenenberger CA, Remppis A. Extracellular S100A1 protein inhibits apoptosis in ventricular cardiomyocytes via activation of the extracellular signal–regulated protein kinase 1/2 (ERK1/2). J Biol Chem. 2003; 278: 48404–48412.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Diabetes and Vascular Disease ResearchHome page
J. B Lindsey, F. Cipollone, S. M Abdullah, and D. K Mcguire
Receptor for advanced glycation end-products (RAGE) and soluble RAGE (sRAGE): cardiovascular implications
Diabetes and Vascular Disease Research, January 1, 2009; 6(1): 7 - 14.
[Abstract] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. Sonin, S.-Y. Zhou, C. Cronin, T. Sonina, J. Wu, K. A. Jacobson, A. Pappano, and B. T. Liang
Role of P2X purinergic receptors in the rescue of ischemic heart failure
Am J Physiol Heart Circ Physiol, September 1, 2008; 295(3): H1191 - H1197.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
L. G. Bucciarelli, R. Ananthakrishnan, Y. C. Hwang, M. Kaneko, F. Song, D. R. Sell, C. Strauch, V. M. Monnier, S. F. Yan, A. M. Schmidt, et al.
RAGE and Modulation of Ischemic Injury in the Diabetic Myocardium
Diabetes, July 1, 2008; 57(7): 1941 - 1951.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. Ramasamy, S. F. Yan, and A. M. Schmidt
Stopping the Primal RAGE Reaction in Myocardial Infarction: Capturing Adaptive Responses to Heal the Heart?
Circulation, June 24, 2008; 117(25): 3165 - 3167.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. T. Pleger, P. Most, and H. A. Katus
S100 proteins: A missing piece in the puzzle of heart failure?
Cardiovasc Res, July 1, 2007; 75(1): 1 - 2.
[Full Text] [PDF]


Home page
Circ. Res.Home page
M. Odashima, S. Usui, H. Takagi, C. Hong, J. Liu, M. Yokota, and J. Sadoshima
Inhibition of Endogenous Mst1 Prevents Apoptosis and Cardiac Dysfunction Without Affecting Cardiac Hypertrophy After Myocardial Infarction
Circ. Res., May 11, 2007; 100(9): 1344 - 1352.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. Most, H. Seifert, E. Gao, H. Funakoshi, M. Volkers, J. Heierhorst, A. Remppis, S. T. Pleger, B. R. DeGeorge Jr, A. D. Eckhart, et al.
Cardiac S100A1 Protein Levels Determine Contractile Performance and Propensity Toward Heart Failure After Myocardial Infarction
Circulation, September 19, 2006; 114(12): 1258 - 1268.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tsoporis, J. N.
Right arrow Articles by Parker, T. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsoporis, J. N.
Right arrow Articles by Parker, T. G.
Related Collections
Right arrow Structure
Right arrow Animal models of human disease
Right arrow Apoptosis
Right arrow Hypertrophy
Right arrow Physiological and pathological control of gene expression
Right arrow Acute myocardial infarction