Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2005;111:2282-2290
Published online before print May 2, 2005, doi: 10.1161/01.CIR.0000164262.08004.BB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
111/18/2282    most recent
01.CIR.0000164262.08004.BBv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Korte, T.
Right arrow Articles by Grohé, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Korte, T.
Right arrow Articles by Grohé, C.
Related Collections
Right arrow Animal models of human disease
Right arrow Arrythmias-basic studies
Right arrow Arrhythmias, clinical electrophysiology, drugs
Right arrow Chronic ischemic heart disease

(Circulation. 2005;111:2282-2290.)
© 2005 American Heart Association, Inc.


Arrhythmia/Electrophysiology

Female Mice Lacking Estrogen Receptor ß Display Prolonged Ventricular Repolarization and Reduced Ventricular Automaticity After Myocardial Infarction

Thomas Korte, MD; Martin Fuchs, MD; Andreas Arkudas, BS; Sebastian Geertz, BS; Rainer Meyer, PhD; Ajmal Gardiwal, MD; Gunnar Klein, MD; Michael Niehaus, MD; Andrée Krust, PhD; Pierre Chambon, PhD; Helmut Drexler, MD; Klaus Fink, MD; Christian Grohé, MD

From the Department of Cardiology and Angiology, Medical School Hannover, Hannover, Germany (T.K., M.F., A.A., S.G., A.G., G.K., M.N., H.D.); Institute of Physiology (R.M.), Institute of Pharmacology and Toxicology (K.F.), and Medizinische University Poliklinik (C.G.), University of Bonn, Bonn, Germany; and Institute de Génétique et de Biologie Moléculaire et Cellulaire, CNRS/INSERM/ULP/, Collège de France, Illkirch, CU de Strasbourg, France (A.K., P.C.).

Correspondence to Thomas Korte, MD, Department of Cardiology and Angiology, Medical School Hannover, Carl-Neuberg Strasse 1, 30625 Hannover, Germany. E-mail korte.thomas{at}mh-hannover.de

Received September 21, 2004; revision received December 9, 2004; accepted December 29, 2004.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— Major gender-based differences in the incidence of ventricular tachyarrhythmia after myocardial infarction have been shown in humans. Although the underlying mechanisms are unclear, earlier studies suggest that estrogen receptor–mediated effects play a major role in this process.

Methods and Results— We examined the effect of estrogen receptor {alpha} (ER{alpha}) and estrogen receptor ß (ERß) on the electrophysiological phenotype in female mice with and without chronic anterior myocardial infarction. There was no significant difference in overall mortality, infarct size, and parameters of left ventricular remodeling when we compared infarcted ER{alpha}-deficient and ERß-deficient mice with infarcted wild-type animals. In the 12-hour telemetric ECG recording 6 weeks after myocardial infarction, surface ECG parameters did not show significant differences in comparisons of ER{alpha}-deficient mice versus wild-type controls, infarcted versus noninfarcted ER{alpha}-deficient mice, and infarcted ER{alpha}-deficient versus infarcted wild-type mice. However, infarcted ERß-deficient versus noninfarcted ERß-deficient mice showed a significant prolongation of the QT (61±6 versus 48±8 ms; P<0.05) and QTc intervals (61±7 versus 51±9 ms; P<0.05) and the JT (42±6 versus 31±4 ms; P<0.05) and JTc intervals (42±7 versus 33±4 ms; P<0.05). Furthermore, infarcted ERß-deficient versus infarcted wild-type mice showed a significant prolongation of the QT (61±6 versus 53±8 ms; P<0.05) and QTc intervals (61±7 versus 53±7 ms; P<0.05) and the JT (42±6 versus 31±5 ms; P<0.05) and JTc intervals (42±7 versus 31±5 ms; P<0.05), accompanied by a significant decrease of ventricular premature beats (7±21/h versus 71±110/h; P<0.05). Finally, real-time polymerase chain reaction–based quantitative analysis of mRNA levels showed a significantly lower expression of Kv4.3 (coding for Ito) in ERß-deficient mice (P<0.05).

Conclusions— Estrogen receptor ß deficiency results in prolonged ventricular repolarization and decreased ventricular automaticity in female mice with chronic myocardial infarction.


Key Words: estrogens • receptors • mice • myocardial infarction • arrhythmia


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Coronary artery disease, the most common cause of ventricular tachyarrhythmias, is the leading cause of death in both men and women.1–3 However, the incidence of sudden cardiac death at all age groups is significantly lower in women,4–6 and traditional risk factors do not seem to predict sudden death to the same extent in women as they do in men.5,7,8

The mechanisms by which gender affects cardiac electrophysiological parameters and alters the predisposition to certain arrhythmias are not well understood, although differences in the expression and function of ion channels9–13 and in the activation of the autonomic nervous system14–18 may contribute. Furthermore, gender has an influence on certain electrophysiological parameters, such as the corrected QT interval, ventricular refractoriness, and action potential duration,13,19–22 and the susceptibility of halothane-induced ventricular tachyarrhythmia23 in wild-type (WT) mice. However, to date the exact mechanisms that underlie sex hormone–based differences in cardiac electrophysiology after myocardial infarction (MI) have not been established. Female sex hormones, particularly estrogen (17ß-estradiol), may play a role in this process. The myocardium contains both functional estrogen receptor {alpha} (ER{alpha}) and estrogen receptor ß (ERß).24 These transcription factors can activate downstream target genes such as the endothelial/inducible isoforms of NO synthase as well as connexin 43 in the heart.25,26

In the present study, we used an in vivo, closed-chest mouse model to test the hypothesis that ER{alpha} and ERß per se influence ventricular repolarization and ventricular automaticity in a female mouse model with chronic anterior MI and studied the expression of potassium channels as molecular targets of ER{alpha} and ERß underlying these differences.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Mice
The generation of all animals included in this study has been described before.27,28 A total of 71 female mice were investigated; 16 had ER{alpha} deficiency ({alpha}ERKO) and 18 were WT animals, and 15 had ERß deficiency (ßERKO) and 15 were WT animals. {alpha}ERKO and ßERKO mice had a C57BL/6 genetic background. Because of the limitations of the breeding protocol (both {alpha}ERKO and ßERKO homozygous littermates are infertile and had to be bred with heterozygous littermates), the total number in the groups studied after the induction of myocardial ischemia varied insignificantly. Because the 2 transgenic mouse models came from different laboratories, only littermate WT animals were analyzed to rule out any potential difference in the genetic background of the groups compared. The age of the mice was a mean of 6 months, and the weight ranged from 25 to 30 g. All mice were housed under identical conditions and were given standard mice chow and water ad libitum. In a subset of animals, obtained from all groups, the sex hormonal status was controlled and was within physiological limits (data not shown). The Hannover Medical School ethics committee for animal research and the government approved the study protocol, and the investigation conforms with the Guide for the Care and Use of Laboratory Animals of the US National Institutes of Health.

Coronary Artery Ligation
Six weeks before electrophysiological examination, a total of 47 mice (10 {alpha}ERKO versus 13 WT; 15 ßERKO versus 9 WT) underwent left anterior descending artery ligation for induction of an anteroapical MI, and 24 mice (6 {alpha}ERKO versus 5 WT; 7 ßERKO versus 6 WT) underwent sham operation. The surgical procedure was performed as we have described previously.29

Tissue Collection
Mice were euthanized after invasive electrophysiological study, and the hearts were fixed in situ as we have described previously.29

Morphometry
The infarct size was measured in 1 section of each of the 3 upper slices and averaged. The infarct sizing was performed in picrosirius red–stained slices (0.1% solution in saturated aqueous picric acid) with the use of a computerized morphometry system (Q500MC, Leitz). The infarct size was measured as the affected percentage of the total endocardial circumference of the left ventricle.29

Ambulatory ECG Telemetry
Six weeks after MI, the mice underwent ambulatory ECG recordings with the use of implantable PhysioTel TA10EA-F20 radiotransmitters (DataScience International) as we have described previously.30 All baseline surface ECG parameters were measured manually with online calipers by 2 investigators independently (T.K., S.G.), as has been defined in detail elsewhere.31 For each parameter, the mean of 10 consecutively measured beats was calculated. Both investigators were blinded to the genotype of the mice studied. Rate-corrected QTc and JTc intervals were calculated with the use of the following formula proposed by Mitchell et al32: QTc=QT0/(R-R0/100)1/2 and JTc=JT0/(R-R0/100)1/2. Custom-made software was used to detect the R peaks of the ECG signal and to calculate the R-R intervals (Chart 3.6 Data Acquisition Software, AD Instruments). Artifacts in the resulting heart rate series caused by mouse movement were automatically removed. Records consisting of >10% artifacts were excluded from further analysis. Mean heart rate was computed, and supraventricular and ventricular premature beats (VPBs) and supraventricular and ventricular tachycardia were analyzed. Ventricular tachycardia was defined as >3 consecutive beats. A ventricular tachycardia was defined as nonsustained if the duration was <30 seconds.

Invasive Electrophysiological Study Protocol
The mouse invasive electrophysiological study methodology has been previously described in detail by us and others.30,33 Mice were studied 1 day after Holter recording. Briefly, animals underwent endotracheal intubation and were ventilated. An octapolar mouse electrophysiology catheter (NuMED, Inc) was placed via the left jugular vein for pacing and endocardial electrogram recording. A standard atrial and ventricular pacing protocol was used to determine the electrophysiological parameters as previously reported. Atrial and ventricular refractoriness and atrioventricular (AV) effective and functional refractory periods were obtained with the use of a standard programmed atrial stimulation protocol. In addition, rapid atrial pacing and double and triple atrial and ventricular testing were applied to assess atrial and ventricular arrhythmia inducibility. As defined for Holter recordings, induced ventricular tachycardia was defined as nonsustained if the duration was <30 seconds.

Real-Time Polymerase Chain Reaction and Semiquantitative Measurement of Target Gene Expression
The comparative description of the expression of voltage-gated potassium channels Kv1.5 and Kv4.3 in the left ventricular tissue of the mouse was performed by SYBR GREEN real-time polymerase chain reaction (PCR) with the use of the ABI PRISM 7700 Sequence Detector (Applied Biosystems). In this 96-well thermal cycler with laser fluorescence detection, 40-cycle PCRs were run with "Rox" as internal reference, a calibrator for normalizing variable measuring conditions, and a heating scheme following the SYBR GREEN I protocol. The ribosomal 18s served as endogenous control ("housekeeping gene"). Intercalating in double-stranded DNA SYBR GREEN (Quiagen) indicates the gain of new amplicons within each cycle. Suitable primer pairs were designed by using PRIMER EXPRESS Software and checked by BLAST search for their specificity. By melting curve analysis, only target gene amplicons were verified when the presence of primer dimer or spurious products was ruled out. The stable efficacy of the chosen primer pairs was tested in different concentrations. Relative gene expression was calculated because of conditions at that stage of PCR when amplification was logarithmic and thus could be correlated with an initial copy number of gene transcription. The relative Kv gene expression is shown as a percentage of part of the full amount of measured Kv cDNA in each sample.

Mouse Genetic Primer
Mouse genetic primers were as follows: Kv4.3: forward primer GCTCCAGCGGACAAGAACAA, reverse primer GTCTGGAACCGTCGTCCACTT; Kv1.5: forward primer GGCCACCACGTCGATGAT, reverse primer ACACTGCGCACGAAACGGTAACGA.

Data Acquisition and Analysis
Surface ECGs, endocardial electrograms, and telemetry electrogram recordings were acquired on a multichannel amplifier and converted to a digital signal for analysis (MacLab System, AD Instruments). Signals were recorded at a sampling rate of 1000 Hz.

Statistical Analysis
All continuous variables, such as ECG intervals and cardiac conduction properties, were compared with controls, with data presented as mean±1 SD. Mortality and the incidence of inducible or spontaneous arrhythmia were compared by the {chi}2 test or Fisher exact test. For comparison of the infarct size and electrophysiological parameters between 2 groups, the Student t test or ANOVA was used, when applicable. For comparison of ventricular automaticity during ambulatory ECG recording, VPBs per 12 hours were counted and compared between 2 groups by use of the unpaired Student t test. A probability value of <0.05 was considered statistically significant.

Comparisons among ER{alpha} animals were as follows: (1) {alpha}ERKO versus WT (to test solely the effect due to ER{alpha} deficiency); (2) {alpha}ERKO versus {alpha}ERKO+MI (to test solely the effect of MI on animals with receptor deficiency); and (3) {alpha}ERKO+MI versus WT+MI (to test the effect of ER{alpha} deficiency on animals with MI).

Comparisons among ERß animals were as follows: (1) ßERKO versus WT (to test solely the effect due to ERß deficiency); (2) ßERKO versus ßERKO+MI (to test solely the effect of MI on animals with receptor deficiency); and (3) ßERKO+MI versus WT+MI (to test the effect of ERß deficiency on animals with MI).


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Animals, Mortality, and Infarct Size
Absolute numbers of animals with induction of MI or sham operation are given in Table 1. There was no statistically significant difference in mortality during the 6 weeks after MI when we compared {alpha}ERKO+MI and ßERKO+MI with infarcted WT animals. MI resulted in a significant increase in the ratio of heart weight to body weight in comparison to sham-operated controls. There were no significant differences in infarct size and ratio of heart weight to body weight when we compared {alpha}ERKO+MI and ßERKO+MI with infarcted WT animals.


View this table:
[in this window]
[in a new window]
 
TABLE 1. No. of Total Mice, Cumulative Deaths, Infarct Size, Cardiac Weights, and Dimensions

Ambulatory ECG Telemetry
ECG Data
The total number of ambulatory ECGs performed and the results of the ECG data are summarized in Table 2. There was a significant prolongation of QT, QTc, JT, and JTc when we compared both ßERKO with ßERKO+MI and ßERKO+MI with infarcted WT animals (Figures 1 and 2Down).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Surface ECG Conduction Intervals in Mice During Ambulatory ECG Recording



View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. A, Representative ECG tracing of an infarcted WT animal. P wave: 12 ms; PQ: 38 ms; QRS: 12 ms; QT: 45 ms. B, Representative ECG tracing of an infarcted ßERKO animal. Note the significant prolongation of the QT interval. P wave: 17 ms; PQ: 38 ms; QRS: 26 ms; QT: 73 ms.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 2. Mean duration of QT, QTc, JT, and JTc interval in infarcted (MI) WT animals and infarcted ßERKO animals. QT, QTc, JT, and JT intervals are significantly prolonged in the ßERKO+MI group.

There was no significant difference in duration of P, PR, QRS, QT, QTc, JT, and JTc when we compared {alpha}ERKO and ßERKO with WT controls and compared WT controls with and without MI. There also was no significant difference when we compared {alpha}ERKO with {alpha}ERKO+MI and {alpha}ERKO+MI with infarcted WT animals.

Baseline Heart Rate and Arrhythmia Recording
The mean R-R during the 12-hour Holter recording was not significantly different when we compared {alpha}ERKO and ßERKO with controls and {alpha}ERKO+MI and ßERKO+MI with infarcted WT animals.

No VPBs or ventricular tachycardias were documented in noninfarcted WT, {alpha}ERKO, and ßERKO animals during 12-hour Holter recording. In infarcted {alpha}ERKO mice 14±30 (range, 0 to 83) VBPs per hour (2 of 7 animals) and in infarcted WT animals 51±99 (range, 0 to 250) VPBs per hour (3 of 9 animals) were documented (P>0.05). In infarcted ßERKO animals 7±21 (range, 0 to 82) VPBs per hour (3 of 9 animals) and in infarcted WT animals 71±111 (range, 0 to 333) VPBs per hour (4 of 6 animals) were documented (P<0.05; Figure 3). In 1 infarcted WT animal, recurrent nonsustained ventricular tachycardia was documented (Figure 4).



View larger version (7K):
[in this window]
[in a new window]
 
Figure 3. Incidence of VPBs during ambulatory telemetry of awake unrestrained mice in infarcted (MI) WT animals and infarcted ßERKO animals. Infarcted ßERKO mice showed a significantly reduced incidence of VPBs.



View larger version (70K):
[in this window]
[in a new window]
 
Figure 4. Ambulatory telemetry recording of an awake, unrestrained WT mouse with MI. Sinus rhythm (SR) with a cycle length of 83 ms and recurrent runs of VPBs are shown.

Electrophysiological Study
The total number of animals with completed electrophysiological study and the results of surface ECG parameters and of the electrophysiological data are summarized in Table 3.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Electrophysiological Data Summary

Cardiac Conduction Properties and Electrophysiological Data
There was no significant difference in all groups compared with regard to sinus node function and atrioventricular conduction (AV interval, AV Wenckebach cycle length, AV 2:1, AV effective refractory periods, AV functional refractory periods). Furthermore, there was no statistically significant difference in any of the groups compared with regard to ventricular refractoriness.

Programmed Stimulation and Arrhythmia Inducibility
With the use of standard programmed electrical stimulation protocols and burst atrial and ventricular pacing, provocation of ectopic or reentrant rhythms was attempted. No animals experienced spontaneous ventricular arrhythmias during placement of the catheter. No nonsustained ventricular tachycardia/sustained ventricular tachycardia was inducible in {alpha}ERKO and ßERKO animals and their noninfarcted WT controls (Table 3). In 1 of 7 {alpha}ERKO+MI and in 5 of 9 infarcted WT controls, nonsustained ventricular tachycardia was inducible. In 2 of 9 ßERKO+MI and in none of the infarcted WT controls, nonsustained ventricular tachycardia was inducible. There was no statistically significant difference in ventricular tachycardia inducibility in any of the groups compared. Inducibility of atrial tachycardia/atrial fibrillation is summarized in Table 3; there was no statistically significance in any of the compared groups.

Expression of Different K+ Channels in the Mouse Ventricle
To establish whether the prolongation of repolarization in infarcted female ßERKO mice is due to differential expression of fast- and slow-rectifying potassium channels, we analyzed mRNA expression of selected K+ channels with real-time PCR using RNA harvested from the intact left ventricle of female {alpha}ERKO and ßERKO animals and their controls. The K+ channels examined included Kv1.5 (coding for Ikur) and Kv4.3 (coding for Ito). We chose these channels because earlier reports suggest that the expression and function of these 2 potassium channels are likely to be dependent on the sex hormone receptor status (ie, estrogen receptors).13,34 Whereas the transcript levels of Kv1.5 showed no significant difference, there was a significantly lower expression (P<0.05) of Kv4.3 in ßERKO mice (Figure 5). These data are consistent with our electrophysiological data because decreased expression of Kv4.3 in female ßERKO mice could explain the significant prolongation of repolarization and altered ventricular automaticity in the infarcted animals with knockout of ERß.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 5. Significantly reduced relative mRNA expression of Kv4.3 in the female ßERKO heart compared with WT animals. Rel. indicates relative.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
In infarcted female ßERKO mice, ventricular repolarization is significantly prolonged and ventricular spontaneity is significantly decreased. This finding is accompanied by a significant and specific lower expression of Kv4.3 in ßERKO animals. Thus, ERß plays a significant role in ventricular repolarization and automaticity in the female mouse heart after MI, which is mediated, at least in part, by downregulation of Kv4.3 expression.

Mortality, Infarct Size, and Left Ventricular Remodeling
This study showed no evidence that infarct size, ventricular remodeling, and mortality are significantly altered by ER{alpha} and ERß. Thus, the electrophysiological differences shown in female ßERKO mice with chronic MI do not appear to be related to infarct size or the extent of left ventricular remodeling in this subgroup of animals and the time point studied.

The role of estrogen, particularly 17ß-estradiol, has been studied extensively in different models of myocardial ischemia, whereas the role of the respective estrogen receptors remains to be elucidated. We recently showed a reduction in chronic infarct size and cardiomyocyte apoptosis in ovariectomized female mice treated with 17ß-estradiol.35 However, estrogen can increase post-MI ventricular remodeling and mortality. Cavasin et al36 found a decreased ejection fraction and increased left ventricular diameter in female mice with ovariectomy and chronic MI. Other previous studies have suggested that 17ß-estradiol treatment reduces ischemia/reperfusion injury.37–41 Node et al40 found a reduction of both infarct size and the occurrence of ischemia- and perfusion-induced ventricular arrhythmias and suggested a mediation by NO and the opening of Kca channels in the canine heart. Despite these conflicting observations, it remains unclear which role the respective estrogen receptors per se may play in this process.

Role of ERß for Ventricular Repolarization and Spontaneity and Potassium Channel Expression in Noninfarcted and Infarcted Female Mouse Heart
In a previous study we and others described a prolongation of repolarization and increased ventricular vulnerability in C57 BL/6 WT mice with chronic MI.30,42 Huang et al43 found a significantly prolonged ventricular action potential duration and increased ventricular vulnerability in the infarcted rat heart, accompanied by a significant decrease in expression of both Kv2.1 and Kv4.3. Kääb et al44 showed reduced expression and function of Kv4.3 as a potential mechanism of action potential prolongation in failing human heart with chronic MI.

The mechanisms underlying gender-specific differences in cardiac repolarization are still largely unknown. Hormonal regulation of cardiac K+ channel gene expression may affect electrical activity. The issue of the role of sex steroid hormones in the regulation of K+ channel expression is of major importance and has been the focus of previous studies.45–49 However, the results of animal studies with regard to the electrophysiological effects of sex hormones have been divergent, and it is not clear from previous data whether sex steroid hormones consistently alter cardiac repolarization.50–52 Trepanier-Boulay et al13 found a significantly prolonged ventricular repolarization as measured by action potential duration in female mice compared with male mice, which was accompanied by a significantly decreased expression of Kv1.5 and of its corresponding K+ current, Ikur, in the female ventricle. Saba et al22 found that 17ß-estradiol prolongs AV nodal conduction and the right ventricular effective period, and they argue that hormonal status affects aspects of cardiac electrophysiological function. Furthermore, Drici et al23 did not find gender differences with regard to QT interval, action potential duration, dispersion of refractory periods, and conduction velocities in Langendorff-perfused WT mice but described inducibility of significantly longer periods of polymorphic ventricular tachycardia in female mice uncovered by halothane, accompanied by a pronounced expression of KCNE1. Song et al34 were the first to show a direct influence of estrogen on the transcription, ie, expression, of Kv4.3 in the myometrium of female rats.

This study demonstrates, for the first time, a significant prolongation of repolarization (QT, QTc, JT, JTc) in infarcted female ßERKO mice but not in infarcted female {alpha}ERKO mice compared with noninfarcted transgenic animals and infarcted WT animals. Furthermore, only infarcted ßERKO mice had significantly fewer VPBs in 12-hour ECG monitoring. From the data of the present study, it can be hypothesized that prolongation of repolarization caused the reduction of ventricular spontaneity in the infarcted ßERKO animals, although an altered dispersion of repolarization might also have contributed to this effect.52 Future studies will have to address this aspect.

To further characterize the underlying mechanisms, we studied the expression of Kv1.5 and Kv4.3 in {alpha}ERKO and ßERKO animals because these channels play an important role in cardiac repolarization and earlier reports suggest that their expression and function might be altered by sex hormones.13,34 We showed a decreased expression of Kv4.3 (coding for Ito) in the ßERKO left ventricle but not in the {alpha}ERKO left ventricle. The expression of Kv1.5 was unchanged in both {alpha}ERKO and ßERKO animals. These data suggest a downregulation of the expression of Kv4.3 in the female mouse heart via ERß. The influence of ERß on potassium channel expression is not apparent during electrophysiological examination of the ßERKO mouse but becomes apparent after MI of ßERKO animals. The prolonged repolarization is not due to the chronic MI because in this model prolonged repolarization is not apparent in infarcted WT controls and is not apparent in infarcted {alpha}ERKO animals and their controls. Future studies will have to focus on how ERß regulates potassium channel expression and to what extent regulation via ERß is estrogen dependent.

Limitations
There are limitations in the translation of the results of this study to other species and to human physiology. K+ channels may play different roles in repolarization, and the effect of sex hormones on repolarization might significantly differ among species.52 To date, in vivo mouse electrophysiology has been proven to be a helpful tool to understand the underlying mechanisms involved in the pathology of clinically relevant cardiac electrophysiology. This animal model serves as the transgenic model of choice because of a combination of technical difficulties in transgenic techniques for larger animals, as well as cost, reproduction, and ethical issues.53 Future research is needed to directly characterize gender-based differences found in cardiac repolarization comparing estrogen receptor–deficient female and male mice.

Significance of the Present Study
The present study provides new insight into the role of estrogen receptor ß in the pathophysiology of cardiac arrhythmias after MI. Our study suggests regulation of potassium channel expression via ERß, which significantly influences ventricular repolarization and automaticity in the female heart after MI. The work thus improves our understanding of the fundamental mechanisms by which sex hormones influence cardiac repolarization and enhances our awareness of gender differences in the control of K+ channel gene expression.


*    Acknowledgments
 
This study was supported by Deutsche Forschungsgemeinschaft, Deutsche Herzstiftung, and institutional grants by BONFOR. We thank Oliver Smithies for sharing the transgenic animals with knockout of estrogen receptor ß. We thank Hanne Bock, Martina Lennarz, Charlotte Halstrick, and Axel Allera for expert technical assistance and advice.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Cahndra NC, Ziegelstein RC, Rogers WJ, Tiefenbrunn AJ, Gore JM, French WJ, Rubinson M. Observations of the treatment of women in the United States with myocardial infarction: a report of the National Registry of Myocardial Infarction. Arch Intern Med. 1998; 158: 981–988.[Abstract/Free Full Text]

2. Marrugat J, Sala J, Masia R, Pavesi M, Sanz G, Valle V, Mollina L, Seres L, Elousa R. Mortality differences between men and women following first myocardial infarction. JAMA. 1998; 280: 1405–1409.[Abstract/Free Full Text]

3. Maynard C, Every NR, Martin JS, Kudenchuk PJ, Weaver WD. Association of gender and survival in patients with acute myocardial infarction. Arch Intern Med. 1997; 157: 1379–1384.[Abstract/Free Full Text]

4. Cupples AL, Gagnon DR, Kannel WB. Long- and short-term risk of sudden coronary death. Circulation. 1992; 85: 11–18.

5. Kannel WB, Wilson PWF, D’Agostino RB, Cobb J. Sudden coronary death in women. Am Heart J. 1998; 136: 205–212.[CrossRef][Medline] [Order article via Infotrieve]

6. Kim C, Fahrenbuch CE, Cobb LA, Eisenberg MS. Out-of-hospital cardiac arrest in men and women. Circulation. 2001; 104: 2699–2703.[Abstract/Free Full Text]

7. Lerner D, Kannel W. Patterns of coronary heart disease morbidity and mortality in the sexes: a 26-year follow-up of the Framingham population. Am Heart J. 1986; 111: 383–390.[CrossRef][Medline] [Order article via Infotrieve]

8. Dittrich H, Gilpin E, Nicod P, Cali G, Henning H, Ross J. Acute myocardial infarction in women: influence of gender on mortality and prognostic variables. Am J Cardiol. 1988; 62: 1–7.[Medline] [Order article via Infotrieve]

9. Tanaka H, Sekine T, Nishimaru K, Shigenobu K. Role of sarcoplasmatic reticulum in myocardial contraction of neonatal and adult mice. Comp Biochem Physiol. 1998; 120: 431–438.

10. Katsube Y, Yokoshiki H, Nguyen L, Yamamoto M, Sperelakis N. L-type Ca2+ currents in ventricular myocytes from neonatal and adult rats. Can J Physiol Pharmacol. 1998; 76: 873–881.[CrossRef][Medline] [Order article via Infotrieve]

11. Leblanc N, Chartier D, Gosselin H, Rouleau JL. Age and gender differences in the excitation-contraction coupling of the rat ventricle. J Physiol. 1998; 511: 533–548.[Abstract/Free Full Text]

12. Rahimian R, Wang X, van Breeman C. Gender differences in the basal intracellular Ca2+ concentration in the rat valvular endothelial cells. Biochem Biophys Res Commun. 1998; 248: 916–919.[CrossRef][Medline] [Order article via Infotrieve]

13. Trepanier-Boulay V, St-Michel C, Tremblay A, Fiset C. Gender-based differences in cardiac repolarization in mouse ventricle. Circ Res. 2001; 89: 437–444.[Abstract/Free Full Text]

14. Cahndler MP, DiCarlo SE. Acute exercise and gender alter cardiac autonomic tonus differently in hypertensive and normotensive rats. Am J Physiol. 1998; 274: R510–R516.[Medline] [Order article via Infotrieve]

15. Snyder DL, Gayheart-Walsten PA, Rhie S, Wang W, Roberts J. Effect of age, gender, rat strain, and dietary restriction on norepinephrine release from cardiac synaptosomes. J Gerontol. 1998; 53: B33–B41.

16. Airaksinen KE, Ikaheimo MJ, Linnaluoto M, Tahvanainen KU, Huikuri HV. Gender differences in autonomic and hemodynamic reaction to abrupt coronary occlusion. J Am Coll Cardiol. 1998; 31: 301–306.[Abstract/Free Full Text]

17. Gregoire J, Tuck S, Yamamoto Y, Hughson RL. Heart rate variability at rest and exercise: influence of age, gender, and physical training. Can J Appl Physiol. 1996; 21: 445–470.

18. Umetani K, Singer DH, McCraty R, Atkinson M. Twenty-four hour time domain heart rate variability and heart rate: relations to age and gender over nine decades. J Am Coll Cardiol. 1998; 31: 593–601.[Abstract/Free Full Text]

19. Bazett HC. An analysis of the time relationship of electrocardiograms. Heart. 1920; 7: 178–181.

20. Burke JH, Ehlert FA, Kruse JT, Parker MA, Goldenberg JJ, Kadish AH. Gender-specific differences in the QT interval and the effect of the autonomic tone and menstrual cycle in healthy adults. Am J Cardiol. 1997; 79: 178–181.[CrossRef][Medline] [Order article via Infotrieve]

21. Lehmann MH, Hardy S, Archibald D, MacNeil DJ. JTc prolongation with d,l-sotalol in women versus men. Am J Cardiol. 1999; 83: 354–359.[CrossRef][Medline] [Order article via Infotrieve]

22. Saba S, Zhu W, Aronovitz MJ, Estes NAM III, Wang PJ, Mendelsohn ME, Karas RH. Effects of estrogen on cardiac electrophysiology in female mice. J Cardiovasc Electrophysiol. 2002; 13: 276–280.[CrossRef][Medline] [Order article via Infotrieve]

23. Drici MD, Baker L, Plan P, Barhanin J, Romey G, Salama G. Mice display sex differences in halothane-induced polymorphic ventricular tachycardia. Circulation. 2002; 106: 497–503.[Abstract/Free Full Text]

24. Grohe C, Kahlert S, Lobbert K, Vetter H. Expression of oestrogen receptor alpha and beta in rat heart: role of local oestrogen synthesis. J Endocrinol. 1998; 156: R1–R7.[Abstract]

25. Strehlow K, Rotter S, Wassmann S, Adam O, Grohé C, Lauf K, Böhm M, Nickenig G. Modulation of antioxidant enzyme expression and function by estrogen. Circ Res. 2003; 93: 170–177.[Abstract/Free Full Text]

26. Nuedling S, Kahlert S, Loebbert K, Doevendans PA, Meyer R, Vetter H, Grohe C. 17 Beta-estradiol stimulates expression of endothelial and inducible NO synthase in rat myocardium in-vitro and in-vivo. Cardiovasc Res. 1999; 43: 666–674.[Abstract/Free Full Text]

27. Dupont S, Krust A, Gansmuller A, Dierich A, Chambon P, Mark M. Effect of single and compound knockouts of estrogen receptors {alpha} (ER{alpha}) and ß (ERß) on mouse reproductive phenotypes. Development. 2000; 127: 4277–4291.[Abstract]

28. Krege JH, Hodkin JB, Couse JF, Enmark E, Warner M, Mahler JF, Sar M, Korach KS, Gustafsson JA, Smithies O. Generation and reproductive phenotypes of mice lacking estrogen receptor beta. Proc Natl Acad Sci U S A. 1998; 95: 15677–15682.[Abstract/Free Full Text]

29. Fuchs M, Hilfiker A, Kaminski K, Hilfiker-Kleiner D, Guener Z, Klein G, Podewski E, Schieffer B, Rose-John S, Drexler H. Role of interleukin-6 for LV remodeling and survival after experimental myocardial infarction. FASEB J. 2004; 17: 2118–2120.

30. Korte T, Fuchs M, Guener Z, v. Bonin J, de Sousa M, Niehaus M, Tebbenjohanns J. In-vivo electrophysiological study in mice with chronic anterior myocardial infarction. J Interven Card Electrophysiol. 2002; 6: 121–132.

31. Hagendorff A, Schumacher B, Kirchhoff S, Lüderitz B, Willecke K. Conduction disturbances and increased atrial vulnerability in connexin40-deficient mice analyzed by transesophageal stimulation. Circulation. 1999; 99: 1508–1515.[Abstract/Free Full Text]

32. Mitchell GF, Jeron A, Koren G. Measurement of heart rate and QT interval in the conscious mouse. Am J Physiol. 1998; 274: H747–H751.[Medline] [Order article via Infotrieve]

33. Berul CI, Maguire CT, Aronovitz MJ, Greenwood J, Miller C, Gehrmann J, Housman D, Mendelsohn ME, Reddy S. DMPK dosage alterations result in atrioventricular conduction abnormalities in a mouse myotonic dystrophy model. J Clin Invest. 1999; 103: R1–R7.[Medline] [Order article via Infotrieve]

34. Song M, Helguera G, Eghbali M, Zhu N, Zarei MM, Olcese R, Toro L, Stefani E. Remodeling of Kv4.3 potassium channel gene expression under the control of sex hormones. J Biol Chem. 2001; 34: 31883–31890.

35. Van Eickels M, Patten RD, Aronovitz MJ, Alsheikh-Ali A, Gostyla K, Clestin F, Grohe C, Mendelsohn ME, Karas RH. 12-Beta-estradiol increases cardiac remodeling and mortality in mice with myocardial infarction [published correction appears in J Am Coll Cardiol. 2003;42:following 183]. J Am Coll Cardiol. 2003; 41: 2084–2092.[Abstract/Free Full Text]

36. Cavasin MA, Sankey SS, Yu AL, Menon S, Yang XP. Estrogen and testosterone have opposing effects on chronic cardiac remodeling and function in mice with myocardial infarction. Am J Physiol. 2003; 284: H1560–H1569.

37. Hale SL, Birnbaum Y, Kloner RA. ß-Estradiol, but not {alpha}-estradiol, reduces myocardial necrosis in rabbits after ischemia and reperfusion. Am Heart J. 1996; 132: 258–262.[CrossRef][Medline] [Order article via Infotrieve]

38. Delyani JA, Murohara T, Nossuli TO. Protection from myocardial reperfusion injury by acute administration of 17 beta-estradiol. J Mol Cell Cardiol. 1996; 28: 1001–1008.[CrossRef][Medline] [Order article via Infotrieve]

39. Kolodgie FD, Farb A, Litovsky SH. Myocardial protection of contractile function after global ischemia by physiologic estrogen replacement in the ovariectomized rat. J Mol Cell Cardiol. 1997; 29: 2403–2414.[CrossRef][Medline] [Order article via Infotrieve]

40. Node K, Kitakaze M, Kosaka H. Amelioration of ischemia- and reperfusion-induced myocardial injury by 17beta-estradiol: role of nitric oxide and calcium-activated potassium channels. Circulation. 1997; 96: 1953–1963.[Abstract/Free Full Text]

41. McHugh NA, Merill GF, Pwell SR. Estrogen diminishes postischemic hydroxyl radical production. Am J Physiol. 1998; 274: H1950–H1954.[Medline] [Order article via Infotrieve]

42. Gehrmann J, Frantz S, Maguire CT, Vargas M, Ducharme A, Wakimoto H, Lee RT, Berul CI. Electrophysiological characterization of murine myocardial ischemia and infarction. Basic Res Cardiol. 2001; 96: 237–250.[CrossRef][Medline] [Order article via Infotrieve]

43. Huang B, Qin D, El-Sherif N. Early down-regulation of K+ channel genes and currents in the postinfarction heart. J Cardiovasc Electrophysiol. 2000; 11: 1252–1261.[CrossRef][Medline] [Order article via Infotrieve]

44. Kääb S, Dixon J, Duc J, Ashen D, Näbauer M, Beuckelmann DJ, Steinbeck G, McKinnon D, Tomaselli GF. Molecular basis of transient outward potassium current downregulation in human heart failure. Circulation. 1998; 98: 1383–1393.[Abstract/Free Full Text]

45. Pham TV, Sosunov EA, Gainullin RZ, Danilo P Jr, Rosen MR. Impact of sex and gonadal steroids on prolongation of ventricular repolarization and arrhythmias induced by IK-blocking drugs. Circulation. 2001; 103: 2207–2212.[Abstract/Free Full Text]

46. Drici MD, Burklow TR, Haridasse V, Glazer RI, Woosley RL. Sex hormones prolong the QT interval and downregulate potassium channel expression in the rabbit heart. Circulation. 1996; 94: 1471–1474.[Abstract/Free Full Text]

47. Berger F, Borchard U, Hafner D, Pütz I, Weis TM. Effects of 17ß-estradiol on action potential and ionic currents in male rat ventricular myocytes. Naunyn Schmeidebergs Arch Pharmacol. 1997; 356: 788–796.[CrossRef][Medline] [Order article via Infotrieve]

48. De Beer E, Keizer HA. Direct action of estriol-17ß on the atrial action potential. Steroids. 1982; 40: 223–231.[CrossRef][Medline] [Order article via Infotrieve]

49. Tanabe S, Hata T, Hiraoka M. Effects of estrogen on action potential and membrane currents in guinea pig ventricular myocytes. Am J Physiol. 1999; 46: H826–H833.

50. Prinzmetal M, Ishikawa K, Nakashima M, Oishi H, Ozkan E, Wakayama J, Baines JM. Estrogens and the heart. Am J Obstet Gynecol. 1967; 98: 575–576.[Medline] [Order article via Infotrieve]

51. Burke JH, Ehlert FA, Kruse JT, Parker MA, Goldberger JJ, Kadish AH. Gender-specific differences in the QT interval and the effect of autonomic tone and menstrual cycle in healthy adults. Am J Cardiol. 1997; 79: 178–181.[CrossRef][Medline] [Order article via Infotrieve]

52. Pham TV, Rosen MR. Sex, hormones, and repolarization. Cardiovasc Res. 2002; 53: 740–751.[Abstract/Free Full Text]

53. Dubin AM. Of mice and men: in vivo electrophysiologic testing in genetically engineered mice. J Cardiovasc Electrophysiol. 2001; 12: 1302–1303.[CrossRef][Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Wang, Y. Wang, B. Weil, A. Abarbanell, J. Herrmann, J. Tan, M. Kelly, and D. R. Meldrum
Estrogen receptor {beta} mediates increased activation of PI3K/Akt signaling and improved myocardial function in female hearts following acute ischemia
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2009; 296(4): R972 - R978.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. M. Shioura, D. L. Geenen, and P. H. Goldspink
Sex-related changes in cardiac function following myocardial infarction in mice
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2008; 295(2): R528 - R534.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
S. Domingues-Montanari, I. Subirana, M. Tomas, J. Marrugat, and M. Senti
Association between ESR2 Genetic Variants and Risk of Myocardial Infarction
Clin. Chem., July 1, 2008; 54(7): 1183 - 1189.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T.-M. Lee, M.-S. Lin, and N.-C. Chang
Physiological Concentration of 17{beta}-Estradiol on Sympathetic Reinnervation in Ovariectomized Infarcted Rats
Endocrinology, March 1, 2008; 149(3): 1205 - 1213.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
V. Jazbutyte, P. A. Arias-Loza, K. Hu, J. Widder, V. Govindaraj, C. von Poser-Klein, J. Bauersachs, K.-H. Fritzemeier, C. Hegele-Hartung, L. Neyses, et al.
Ligand-dependent activation of ER{beta} lowers blood pressure and attenuates cardiac hypertrophy in ovariectomized spontaneously hypertensive rats
Cardiovasc Res, March 1, 2008; 77(4): 774 - 781.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
F. A. Babiker, D. Lips, R. Meyer, E. Delvaux, P. Zandberg, B. Janssen, G. van Eys, C. Grohe, and P. A. Doevendans
Estrogen Receptor {beta} Protects the Murine Heart Against Left Ventricular Hypertrophy
Arterioscler Thromb Vasc Biol, July 1, 2006; 26(7): 1524 - 1530.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H. S. Karagueuzian, T. Korte, M. Fuchs, A. Arkudas, S. Geertz, A. Gardiwal, G. Klein, M. Niehaus, H. Drexler, R. Meyer, et al.
Letter Regarding Article by Korte et al, "Female Mice Lacking Estrogen Receptor {beta} Display Prolonged Ventricular Repolarization and Reduced Ventricular Automaticity After Myocardial Infarction" * Response
Circulation, October 18, 2005; 112(16): e272 - e272.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
111/18/2282    most recent
01.CIR.0000164262.08004.BBv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Korte, T.
Right arrow Articles by Grohé, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Korte, T.
Right arrow Articles by Grohé, C.
Related Collections
Right arrow Animal models of human disease
Right arrow Arrythmias-basic studies
Right arrow Arrhythmias, clinical electrophysiology, drugs
Right arrow Chronic ischemic heart disease