This Article Abstract Full Text (PDF) All Versions of this Article: 111/14/1800    most recent 01.CIR.0000160936.91849.9Fv1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Chen, J. Articles by Huang, P. L. Search for Related Content PubMed PubMed Citation Articles by Chen, J. Articles by Huang, P. L. Pubmed/NCBI databases Medline Plus Health Information Heart Attack Related Collections Cardiovascular imaging agents/Techniques Animal models of human disease Acute myocardial infarction Related Article

(Circulation. 2005;111:1800-1805.)
© 2005 American Heart Association, Inc.

Imaging

Near-Infrared Fluorescent Imaging of Matrix Metalloproteinase Activity After Myocardial Infarction

Jiqiu Chen, MD; Ching-Hsuan Tung, PhD; Jennifer R. Allport, PhD; Si Chen; Ralph Weissleder, MD, PhD; Paul L. Huang, MD, PhD

From the Cardiovascular Research Center and Cardiology Division (J.C., S.C., P.L.H.) and the Center for Molecular Imaging Research (C.-H.T., J.R.A., R.W.), Massachusetts General Hospital and Harvard Medical School, Charlestown, Mass.

Correspondence to Paul L. Huang, MD, PhD, Cardiovascular Research Center and Cardiology Division, Massachusetts General Hospital East, 149 13th St, Charlestown, MA 02129.

Received November 19, 2004; accepted December 27, 2004.

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background— We used a molecular probe activated by protease cleavage to image expression of matrix metalloproteinases (MMPs) in the heart after myocardial infarction.

Methods and Results— We synthesized and characterized a near-infrared fluorescent (NIRF) probe that is activated by proteolytic cleavage by MMP2 and MMP9. The NIRF probe was injected into mice at various time points up to 4 weeks after myocardial infarction induced by ligation of the left anterior descending coronary artery. NIRF imaging of MMP activity increased in the infarct region, with maximal expression at 1 to 2 weeks, persisting to 4 weeks. Zymography and real-time polymerase chain reaction analysis showed that MMP9 expression is increased at 2 to 4 days, and MMP2 expression is increased at 1 to 2 weeks. Dual-label confocal microscopy showed colocalization of NIRF imaging with neutrophils on day 2, and flow cytometric analysis confirmed that NIRF signal is associated with leukocytes in the infarct zone.

Conclusions— This study demonstrates that the activity of MMPs in the myocardium may be imaged by use of specific activity–dependent molecular probes.

Key Words: matrix metalloproteinases • myocardial infarction • imaging • gelatinase • remodeling

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Myocardial infarction (MI) can lead to complex structural alterations in the heart, including dilation, contractile dysfunction, and congestive heart failure.^1–4 Matrix metalloproteinases (MMPs) play important roles in the structural and functional sequelae of cardiac ischemia and infarction. In the heart, as in other tissues, MMPs participate in degradation of the extracellular matrix (ECM). In addition, MMPs have additional effects independent of ECM breakdown, including degradation of troponin I⁵ and modulation of platelet aggregation^6,7 and vascular tone.^8,9

See p 1730

The expression and activities of MMPs increase in the heart after MI.^10–13 Specifically, the gelatinases MMP2 and MMP9 and the tissue inhibitors of matrix metalloproteinases (TIMPs) have been implicated in the cardiac response to ischemia and infarction. Gene knockout of MMP2¹⁴ or MMP9¹⁵ decreases left ventricular remodeling and limits ventricular dilation after MI. Loss of TIMP4 leads to enhanced MMP activity in the heart after ischemia,¹⁶ and gene knockout of TIMP-1 exacerbates ventricular remodeling.¹⁷ Pharmacological blockade of MMP activity leads to decreased ventricular remodeling.^18–21

Noninvasive methodology to optically image MMP activity would be of use to follow the temporal and spatial patterns of MMP activity after MI and in assessing treatment approaches. We hypothesized that we could monitor the myocardial remodeling process by imaging MMP activity. We used a novel, long-circulating, quenched near-infrared fluorescent (NIRF) probe that is activated by proteolytic cleavage^22,23 by MMP2 and MMP9. Our studies indicate that specific molecular probes can be used to image MMP activity during left ventricular remodeling. This approach complements existing methods for after MMP levels and activity, such as zymography, immunohistochemistry, Western blotting, and scintigraphy.²⁴

	Methods

Top Abstract Introduction Methods Results Discussion References

 
MI Model
All procedures were approved by and performed in accordance with the Institutional Animal Care and Use Committee of the Massachusetts General Hospital. Male C57BL6J mice, ranging in age from 8 to 12 weeks and weighing 25 to 30 g, underwent left anterior descending coronary artery (LAD) ligation to induce MI.²⁵ Animals were anesthetized intraperitoneally with ketamine 0.065 mg/g body wt, acepromazine 0.001 mg/g, and xylazine 0.013 mg/g. Animals were intubated and ventilated with a rodent respirator. After thoracotomy, the LAD was ligated with a 7-0 silk suture at a location 3 to 4 mm from the tip of the left atrium. Successful ligation of the LAD was verified by visual inspection of the left ventricular apex. The chest was closed with continuous 6-0 silk suture, and the skin was closed with 4-0 silk sutures. All mice were given water and food ad libitum.

MMP-Sensitive NIRF Probe
The NIRF probe used in this study was synthesized by use of a previously published method,²⁶ except that a peptide sequence recognized by MMP2 and MMP9 was used. This sequence, SGKGPRQITA, was identified by screening a phage library of random sequences using MMP9 and is cleaved between the Gln and Ile residues. It has a kcat/K_m of 188 000 mol/L^–1 · s^–1, which is 12- to 14-fold higher for MMP9 than for MMP-13 and MMP-7.²⁷ This sequence was used with the linking residues GGPRQITAGK(Fitc)C to attach the fluorochrome Cy5.5 to a pegylated poly-L-lysine backbone.

Activation of the probe (0.2 µmol/L) was studied by incubating with 1 µg recombinant MMP9 or MMP2 (Oncogene) in 50 mmol/L Tris HCl, pH 7.5, 10 mmol/L CaCl₂, 100 mmol/L NaCl, and 0.005% Brij-35 at 37°C. The fluorescence signal changes were monitored at the specific excitation (675 nm) and emission (694 nm) maximum wavelengths of Cy5.5 by use of a fluorescence plate reader (SPECTRAmax Gemini, Molecular Devices).

NIRF Imaging
Four nmol NIRF probe was injected into the tail vein of mice 0 days, 2 days, 1 week, 2 weeks, 3 weeks, and 4 weeks after MI. This dose was chosen on the basis of previous experience with other enzyme-activatable probes in mice. The hearts were excised 48 hours later. NIRF imaging (2-minute acquisition) was performed with a 12-bit monochrome CCD camera (Kodak) equipped with an f/1.2 12.5- to 75-mm zoom lens and an emission long-pass filter at 700 nm (Omega Optical). The NIRF signal was determined as mean signal intensity (SI) from either the infarct region or remote myocardium. Target-to-background ratios (TBR) were calculated as follows: TBR=SI(infarct area)/SI(remote area).²⁸ All results are presented as mean±SEM. Statistical analysis was conducted by use of ANOVA, with values of P<0.05 being considered significant.

Left Ventricular Tissue Extracts
Hearts were excised and washed in cold PBS. The infarct region and remote myocardium were separated under a dissecting microscope. Tissues were snap-frozen in liquid nitrogen and homogenized in 0.5 to 1.0 mL of ice-cold lysis buffer. The Western blot lysis buffer contained 50 mmol/L Tris-HCl, pH 7.4, 150 mmol/L NaCl, 1 mmol/L PMSF, 5 ng/mL aprotinin, 5 ng/mL leupeptin, 1% Triton X-100, 1% sodium deoxycholate, and 1% SDS. The homogenates were centrifuged for 10 minutes at 4°C at 20 000g, and the supernatant was transferred to clean tubes. Protein concentration was determined by use of a protein assay (Bio-Rad) using BSA as standard. The extracted samples were stored at –80°C until use.

Zymography
Protein samples containing 25 µg protein were adjusted to 40 µL, mixed with an equal volume of 2x loading buffer (126 mmol/L Tris-HCl, 20% glycerol, 4% SDS, 0.05% bromophenol blue, pH 6.8), and incubated for 10 minutes at room temperature before loading to 10% gelatin-ready zymogram gel (Bio-Rad, 161-1167). Then, 10 µL Precision protein standards (Bio Rad, 161-0372) were used as molecular weight standards, and 0.5 ng recombinant human MMP9 protein (Oncogene, PF024) and 0.5 ng purified MMP2 (Chemicon, cc071) were loaded as positive controls. Gels were run at 80 V for 2 hours. The gels were incubated in 2.5% Triton X-100 for renaturation for 30 minutes. They were then equilibrated in fresh developing buffer (50 mmol/L Tris-HCl, 0.2 mmol/L NaCl, 5 mmol/L CaCl₂, 0.02% Brij 35) and incubated at 37°C overnight. Gels were stained with 0.5% Coomassie Blue G (40% methanol, 10% acetic acid) for 2 hours and destained with methanol:acetic acid:water (5:1:4) for 30 minutes. Areas of protease activity appear as clear bands against a dark blue background where the protease has digested the gelatin substrate.

Quantitative Reverse Transcription–PCR
MMP9 and MMP2 mRNA levels were measured by quantitative real-time polymerase chain reaction (PCR) of cDNA.²⁹ Total RNA was extracted from infarct regions by use of Trizol (Gibco-BRL) and reverse-transcribed to cDNA by use of Superscript II RT (Gibco-BRL) using oligo (dT) as primers. Real-time PCR was performed by use of an ABI Prism 7000 Sequence Detection system using SYBR Green. Primers were designed by use of Primer Express software. The primers for ß-actin were TGGAATCCTGTGGCATCCATGAAAC (forward) and TAAAACGCAGCTCAGTAACAGTCCG (reverse). The primers for MMP2 were GACATACATCTTTGCAGGAGACAAG (forward) and TCTGCGATGAGCTTAGGGAAA (reverse). The primers for MMP9 were CCTGGAACTCACACGACATCTTC (forward) and TGGAAACTCACACGCCAGAA (reverse). For each primer set, a standard curve was generated between the threshold cycle number and cDNA concentration. MMP2 and MMP9 mRNA levels were expressed as a ratio normalized to ß-actin. Melting curves of the PCR products and agarose gel electrophoresis confirmed the specificity of the reaction.

Histology and Immunohistochemistry
Frozen sections (8 µm) were used for histology (hematoxylin and eosin staining) or immunohistochemistry for MMP9 and markers for macrophage and neutrophils. The following antibodies were used: (1) mouse anti-human MMP9 IgG (1:100, Chemicon, MAB 13415); (2) rat anti-mouse Ly-6G (Gr-1) IgG-FITC (1:50, PharMingen, 553126); (3) rat anti-mouse Mac3 IgG-FITC (1:50, PharMingen, 01784D); and (4) donkey anti-mouse IgG-Texas Red (1:50, Jackson, 715-075-150). The staining procedures have been described in detail elsewhere.³⁰ Confocal imaging was performed by use of a confocal microscope (Leica TCS NT4D) with the use of a BP530/30 filter for FITC and an LP590 filter for Texas Red. When the FITC and Texas Red signals colocalize, a yellow signal is seen.

Flow Cytometric Analysis
Mice with infarcted hearts or control mice were injected with NIRF probe or vehicle control. Twenty-four hours after probe administration, animals were euthanized by CO₂ asphyxiation, and their hearts were immediately excised and washed in Hanks’ balanced salt solution (HBSS). Infarct and noninfarct heart tissues were separated. All tissues were then minced finely and digested in collagenase (Worthington Biochemical, 2 mg/mL wt/vol in HBSS) at 37°C for 45 minutes. The resulting cell suspensions were filtered through 100-µm pore-size filters, pelleted, and resuspended in RPMI-1640 containing 5% FCS. Cells were then stained with anti-mouse CD45-FITC conjugated antibody (BD Pharmingen). Each population was analyzed on a BDFACSCalibur flow cytometer for the presence of CD45 and the NIRF probe. A minimum of 10 000 cells per sample were analyzed.

	Results

Top Abstract Introduction Methods Results Discussion References

 
NIRF Probe Detects MMP2 and MMP9 Activity
The NIRF probe used in this study was similar to those used previously for imaging other proteases.^22,26,31 The probe contains multiple NIRF Cy5.5 dye molecules attached to the recognition peptide sequence, which is positioned on a pegylated poly-L-lysine backbone. In the intact probe, the Cy5.5 molecules are in close proximity, and fluorescence resonance energy transfer results in efficient quenching. In the presence of MMP2 or MMP9, the peptide sequence is cleaved, resulting in liberation of the Cy5.5 dye molecules from the probe.

We tested the activation of the NIRF probe by MMP2 and MMP9 (Figure 1). At the zero time point, there was only background fluorescence activity. Both MMP2 and MMP9 caused time-dependent increases in fluorescence, with roughly equivalent kinetics. Overall, either protease resulted in 200-fold signal amplification. Therefore, the NIRF probe is equally sensitive to MMP2 and MMP9.

View larger version (8K): [in this window] [in a new window]   Figure 1. Activation of NIRF probe by MMP2 and MMP9. NIRF probe (0.2 µmol/L), in 50 mmol/L Tris HCl, pH 7.5, 10 mmol/L CaCl2, 100 mmol/L NaCl, 0.005% Brij-35, was incubated with 5 µg of active MMP2 or MMP9 (Oncogene). Fluorescence was measured at various time points. Error bars show SEM.

NIRF Imaging After MI
To image MMP2 and MMP9 activity in the heart after MI, we performed LAD ligation in mice, resulting in an apical infarct. Figure 2 shows the appearance of the heart 2 days and 1 week later. The area of infarction is pale compared with surrounding tissue. At 1 week, the left ventricular apex showed thinning. The MMP2- and MMP9-sensitive probe was injected, and NIRF imaging was performed. In the control animal, infarcted area had a signal similar to that of normal tissue, with a TBR of 1.08±0.11. In animals receiving the probe, the TBR increased to 3.34±0.43 at 1 week after MI, and areas of infarction were intensely bright (Figure 2).

View larger version (45K): [in this window] [in a new window]   Figure 2. NIRF imaging of MMP-activated probe in mouse heart after MI. Top row, probe was injected at time of MI and imaged at 2 days. Bottom row, probe was injected at 5 days and imaged at 7 days. Left column, bright-field photograph; middle column, NIFR imaging; right column, hematoxylin and eosin staining.

We imaged MMP2 and MMP9 activity in different cohorts of animals to establish a time course over a 4-week period. The NIRF signal in the infarct zone rises and peaks at 1 to 2 weeks after MI (Figure 3). It then decreases over time, but was still significantly elevated at 4 weeks compared with baseline values or values from remote myocardium. Quantification of the absolute NIRF signal, as well as the ratio of the signal between the infarct zone and a remote area, shows the same pattern.

View larger version (16K): [in this window] [in a new window]   Figure 3. Time course of NIRF signal after MI. NIRF signal intensity in infarct region (closed circles) and remote myocardium (open circles) is shown over time. Error bars show SEM.

MMP9 and MMP2 Levels in the Myocardium After MI
To correlate the NIRF imaging results with expression of MMP2 and MMP9, we performed zymography and quantitative reverse transcription–PCR analysis. Zymography showed that MMP9 activity is increased in the infarct zone at 2 and 4 days after MI, with levels dropping subsequently (Figure 4). Of interest, MMP9 activity is increased in the remote area as well at 4 days, although less than in the infarct zone. In the infarct region, MMP2 activity increases by 1 week and reaches a maximum at 2 and 3 weeks. MMP2 activity is present in the remote area at low but detectable levels. Multiple molecular species are seen for MMP9 and MMP2.

View larger version (55K): [in this window] [in a new window]   Figure 4. Zymography of MMP2 and MMP9 activity in heart after MI. A, Infarct zone. B, Remote zone. Gelatin in polyacrylamide gel is hydrolyzed by MMP2 and MMP9 activity, resulting in clear bands.

We used real-time PCR analysis of cDNA reverse-transcribed from cardiac mRNA to quantify MMP2 and MMP9 expression (Figure 5). In the infarct region, MMP9 mRNA levels were highest at 2 and 4 days after MI and decreased subsequently. MMP2 levels, in contrast, rose by 4 days, peaked at 1 to 2 weeks after MI, and were still significantly increased at 4 weeks. Taken together, zymography and real-time PCR results were in agreement that MMP9 levels were increased at 1 and 3 days after MI and that MMP2 levels increased at 1 to 4 weeks.

View larger version (15K): [in this window] [in a new window]   Figure 5. Real-time PCR analysis of MMP2 and MMP9 mRNA levels in infarct regions after MI. RNA levels are expressed as a ratio normalized to ß-actin mRNA.

MMP9 Is Leukocyte Derived in the Infarcted Myocardium
Comparison of microscopic NIRF imaging with hematoxylin and eosin staining of an adjacent section shows that the fluorescence signal correlates with regions of leukocyte infiltration (Figure 6). Confocal microscopy with dual labeling for cell-specific markers and for MMP9 confirmed colocalization of MMP9 with a neutrophil marker at 1 day (Figure 7). To verify that MMP9 was leukocyte derived in the infarcted myocardium, we made use of the NIRF probe to perform flow cytometric analysis on cells isolated from the heart. We used NIRF to detect the gelatinase probe and immunoreactivity to the leukocyte common antigen CD45 to detect leukocytes. In the noninfarcted heart tissue, the majority of cells that display NIRF are CD45-negative. In the infarct region, however, there is an increase in the number of CD45-positive cells that display NIRF (Figure 8). These results confirm our macroscopic observations and point to infiltrating leukocytes as the main source of the increase in MMP9 activity after MI.

View larger version (79K): [in this window] [in a new window]   Figure 6. Microscopic NIRF imaging. A microscopic NIRF image and an adjacent section stained with hematoxylin and eosin. Magnification, x10.

View larger version (114K): [in this window] [in a new window]   Figure 7. Dual-label confocal staining for MMP9, macrophages, and neutrophils. MMP9 is stained with Texas Red, whereas macrophages (top row) and neutrophils (bottom row) are stained with FITC-conjugated antibody. MMP9 activity colocalizes strongly with neutrophils at 1 day.

View larger version (20K): [in this window] [in a new window]   Figure 8. Flow cytometry of gelatinase probe activation and CD45. Infarcted and noninfarcted regions of heart were dissected, minced, and digested with collagenase. Cells were stained with CD45–FITC-conjugated antibody and analyzed for CD45 and NIRF signal intensity.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The MMPs are a family of zinc-containing metalloproteinases that play important roles in ECM degradation.³² MMPs have been divided into subgroups on the basis of substrate specificity and domain structure.³³ MMP2 and MMP9 are of particular interest because they break down collagen, elastin, and basement membrane components. They share a common domain structure that includes type II fibronectin-like domains, differentiating them from other MMPs.³⁴ Both MMP2 and MMP9 also have effects that seem to be independent of ECM breakdown. MMP2 degrades troponin I, a mechanism important to its effects on the heart after ischemia.⁵ Other MMP targets affect vascular tone^8,9 and platelet aggregation.⁶

Several lines of evidence point to the importance of MMP2 and MMP9 in cardiac remodeling after MI,^10–13 as well as in vascular remodeling after injury and during atherogenesis.^32,35 Gene knockout of either MMP2¹⁴ or MMP9¹⁵ results in attenuation of LV dilation after MI. Similarly, gene knockout of the MMP inhibitor TIMP-1 worsens ventricular dilation and remodeling after MI. Furthermore, pharmacological blockade of MMP activity results in attenuation of ventricular dilation.^18–21

Our results indicate that MMP9 and MMP2 activity show different time courses after MI. MMP9 increases by days 2 to 4, whereas MMP2 activity increases between 1 and 2 weeks. Other studies show similar time courses for MMP2 and MMP9 after MI.³⁶ Despite their shared substrate, MMP2 and MMP9 may play distinct roles after tissue injury, as shown in vascular remodeling.^32,35 In terms of cellular source, early after MI, NIRF activity colocalizes with areas of leukocytic infiltrate (Figure 6) and with neutrophils (Figure 7). Flow cytometry confirms that CD45-positive leukocytes account for the increase in NIRF cells in the heart after MI (Figure 8). These results indicate that infiltrating neutrophils are the likely cellular source of MMP9 activity early after MI.

Monitoring of MMP activity is complicated by overlapping substrate specificities of the MMPs and by the fact that there are multiple species, including pro-MMP zymogens, and multiple levels of regulation by TIMPs and other MMP inhibitors.³⁷ In addition, a recent report demonstrates that MMPs can be activated by S-glutathiolation in the presence of peroxynitrite.³⁸ Here, we show that an optically detectable probe that is activated by MMP2 and MMP9 can be used to image the activities of these proteases in the heart after MI. The use of such enzyme-activated probes would allow monitoring of the spatial and temporal patterns of MMP activity over time in the heart and may facilitate the study of cardiac remodeling. They also provide a high degree of molecular specificity, because their fluorescence is based on activation by enzyme activity. However, the NIRF probe described here, like gelatin zymography, does not distinguish between MMP2 and MMP9.

In summary, we have shown that enzyme-activated NIRF probes can be used to image MMP activity in the myocardium after MI, providing both spatial and temporal information on activity. These probes may be useful to complement other techniques used to study MMPs, including zymography and scintigraphy.²⁴ Our results also indicate that these probes can be used to monitor enzyme activity on a microscopic level and can be coupled with flow cytometry. Similar NIRF probes have been coupled with optical tomography methods for in vivo imaging.^28,39

	Acknowledgments

 
This work was supported by Public Health Service grants HL-52818 to Dr Huang and CA-86355 to Dr Weissleder.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Bayat H, Swaney JS, Ander AN, Dalton N, Kennedy BP, Hammond HK, Roth DM. Progressive heart failure after myocardial infarction in mice. Basic Res Cardiol. 2002; 97: 206–213.[CrossRef][Medline] [Order article via Infotrieve]
   
2. Weisman HF, Bush DE, Mannisi JA, Weisfeldt ML, Healy B. Cellular mechanisms of myocardial infarct expansion. Circulation. 1988; 78: 186–201.[Abstract/Free Full Text]
   
3. Patten RD, Aronovitz MJ, Deras-Mejia L, Pandian NG, Hanak GG, Smith JJ, Mendelsohn ME, Konstam MA. Ventricular remodeling in a mouse model of myocardial infarction. Am J Physiol. 1998; 274: H1812–H1820.[Medline] [Order article via Infotrieve]
   
4. Yang F, Liu YH, Yang XP, Xu J, Kapke A, Carretero OA. Myocardial infarction and cardiac remodelling in mice. Exp Physiol. 2002; 87: 547–555.[Abstract]
   
5. Wang W, Schulze CJ, Suarez-Pinzon WL, Dyck JR, Sawicki G, Schulz R. Intracellular action of matrix metalloproteinase-2 accounts for acute myocardial ischemia and reperfusion injury. Circulation. 2002; 106: 1543–1549.[Abstract/Free Full Text]
   
6. Sawicki G, Salas E, Murat J, Miszta-Lane H, Radomski MW. Release of gelatinase A during platelet activation mediates aggregation. Nature. 1997; 386: 616–619.[CrossRef][Medline] [Order article via Infotrieve]
   
7. Fernandez-Patron C, Martinez-Cuesta MA, Salas E, Sawicki G, Wozniak M, Radomski MW, Davidge ST. Differential regulation of platelet aggregation by matrix metalloproteinases-9 and -2. Thromb Haemost. 1999; 82: 1730–1735.[Medline] [Order article via Infotrieve]
   
8. Fernandez-Patron C, Stewart KG, Zhang Y, Koivunen E, Radomski MW, Davidge ST. Vascular matrix metalloproteinase-2–dependent cleavage of calcitonin gene–related peptide promotes vasoconstriction. Circ Res. 2000; 87: 670–676.[Abstract/Free Full Text]
   
9. Fernandez-Patron C, Radomski MW, Davidge ST. Vascular matrix metalloproteinase-2 cleaves big endothelin-1 yielding a novel vasoconstrictor. Circ Res. 1999; 85: 906–911.[Abstract/Free Full Text]
   
10. Lu L, Gunja-Smith Z, Woessner JF, Ursell PC, Nissen T, Galardy RE, Xu Y, Zhu P, Schwartz GG. Matrix metalloproteinases and collagen ultrastructure in moderate myocardial ischemia and reperfusion in vivo. Am J Physiol. 2000; 279: H601–H609.
    
11. Spinale FG. Matrix metalloproteinases: regulation and dysregulation in the failing heart. Circ Res. 2002; 90: 520–530.[Abstract/Free Full Text]
    
12. Danielsen CC, Wiggers H, Andersen HR. Increased amounts of collagenase and gelatinase in porcine myocardium following ischemia and reperfusion. J Mol Cell Cardiol. 1998; 30: 1431–1442.[CrossRef][Medline] [Order article via Infotrieve]
    
13. Spinale FG, Coker ML, Bond BR, Zellner JL. Myocardial matrix degradation and metalloproteinase activation in the failing heart: a potential therapeutic target. Cardiovasc Res. 2000; 46: 225–238.[Abstract/Free Full Text]
    
14. Hayashidani S, Tsutsui H, Ikeuchi M, Shiomi T, Matsusaka H, Kubota T, Imanaka-Yoshida K, Itoh T, Takeshita A. Targeted deletion of MMP-2 attenuates early LV rupture and late remodeling after experimental myocardial infarction. Am J Physiol. 2003; 285: H1229–H1235.
    
15. Ducharme A, Frantz S, Aikawa M, Rabkin E, Lindsey M, Rohde LE, Schoen FJ, Kelly RA, Werb Z, Libby P, Lee RT. Targeted deletion of matrix metalloproteinase-9 attenuates left ventricular enlargement and collagen accumulation after experimental myocardial infarction. J Clin Invest. 2000; 106: 55–62.[Medline] [Order article via Infotrieve]
    
16. Schulze CJ, Wang W, Suarez-Pinzon WL, Sawicka J, Sawicki G, Schulz R. Imbalance between tissue inhibitor of metalloproteinase-4 and matrix metalloproteinases during acute [myocardial] ischemia-reperfusion injury. Circulation. 2003; 107: 2487–2492.[Abstract/Free Full Text]
    
17. Roten L, Nemoto S, Simsic J, Coker ML, Rao V, Baicu S, Defreyte G, Soloway PJ, Zile MR, Spinale FG. Effects of gene deletion of the tissue inhibitor of the matrix metalloproteinase-type 1 (TIMP-1) on left ventricular geometry and function in mice. J Mol Cell Cardiol. 2000; 32: 109–120.[CrossRef][Medline] [Order article via Infotrieve]
    
18. Lindsey ML, Gannon J, Aikawa M, Schoen FJ, Rabkin E, Lopresti-Morrow L, Crawford J, Black S, Libby P, Mitchell PG, Lee RT. Selective matrix metalloproteinase inhibition reduces left ventricular remodeling but does not inhibit angiogenesis after myocardial infarction. Circulation. 2002; 105: 753–758.[Abstract/Free Full Text]
    
19. Mukherjee R, Brinsa TA, Dowdy KB, Scott AA, Baskin JM, Deschamps AM, Lowry AS, Escobar GP, Lucas DG, Yarbrough WM, Zile MR, Spinale FG. Myocardial infarct expansion and matrix metalloproteinase inhibition. Circulation. 2003; 107: 618–625.[Abstract/Free Full Text]
    
20. Yarbrough WM, Mukherjee R, Brinsa TA, Dowdy KB, Scott AA, Escobar GP, Joffs C, Lucas DG, Crawford FA Jr, Spinale FG. Matrix metalloproteinase inhibition modifies left ventricular remodeling after myocardial infarction in pigs. J Thorac Cardiovasc Surg. 2003; 125: 602–610.[Abstract/Free Full Text]
    
21. Yarbrough WM, Mukherjee R, Escobar GP, Mingoia JT, Sample JA, Hendrick JW, Dowdy KB, McLean JE, Lowry AS, O’Neill TP, Spinale FG. Selective targeting and timing of matrix metalloproteinase inhibition in post–myocardial infarction remodeling. Circulation. 2003; 108: 1753–1759.[Abstract/Free Full Text]
    
22. Bremer C, Tung CH, Weissleder R. In vivo molecular target assessment of matrix metalloproteinase inhibition. Nat Med. 2001; 7: 743–748.[CrossRef][Medline] [Order article via Infotrieve]
    
23. Bremer C, Tung CH, Weissleder R. Molecular imaging of MMP expression and therapeutic MMP inhibition. Acad Radiol. 2002; 9 (suppl 2): S314–S315.[Medline] [Order article via Infotrieve]
    
24. Schafers M, Riemann B, Kopka K, Breyholz HJ, Wagner S, Schafers KP, Law MP, Schober O, Levkau B. Scintigraphic imaging of matrix metalloproteinase activity in the arterial wall in vivo. Circulation. 2004; 109: 2554–2559.[Abstract/Free Full Text]
    
25. Michael LH, Entman ML, Hartley CJ, Youker KA, Zhu J, Hall SR, Hawkins HK, Berens K, Ballantyne CM. Myocardial ischemia and reperfusion: a murine model. Am J Physiol. 1995; 269: H2147–H2154.[Medline] [Order article via Infotrieve]
    
26. Law B, Curino A, Bugge TH, Weissleder R, Tung CH. Design, synthesis and characterization of urokinase-type plasminogen activator sensitive near-infrared reporter. Chem Biol. 2004; 11: 99–106.[CrossRef][Medline] [Order article via Infotrieve]
    
27. Kridel SJ, Chen E, Kotra LP, Howard EW, Mobashery S, Smith JW. Substrate hydrolysis by matrix metalloproteinase-9. J Biol Chem. 2001; 276: 20572–20578.[Abstract/Free Full Text]
    
28. Chen J, Tung CH, Mahmood U, Ntziachristos V, Gyurko R, Fishman MC, Huang PL, Weissleder R. In vivo imaging of proteolytic activity in atherosclerosis. Circulation. 2002; 105: 2766–2771.[Abstract/Free Full Text]
    
29. Ishihara Y, Nishikawa T, Iijima H, Matsunaga K. Expression of matrix metalloproteinase, tissue inhibitors of metalloproteinase and adhesion molecules in silicotic mice with lung tumor metastasis. Toxicol Lett. 2003; 142: 71–75.[CrossRef][Medline] [Order article via Infotrieve]
    
30. Chen J, Kuhlencordt P, Urano F, Ichinose H, Astern J, Huang PL. Effects of chronic treatment with L-arginine on atherosclerosis in apoE-knockout and apoE/inducible NO synthase double-knockout mice. Arterioscler Thromb Vasc Biol. 2003; 23: 97–103.[Abstract/Free Full Text]
    
31. Tung CH, Bredow S, Mahmood U, Weissleder R. Preparation of a cathepsin D sensitive near-infrared fluorescence probe for imaging. Bioconjug Chem. 1999; 10: 892–896.[CrossRef][Medline] [Order article via Infotrieve]
    
32. Whatling C, McPheat W, Hurt-Camejo E. Matrix management: assigning different roles for MMP-2 and MMP-9 in vascular remodeling. Arterioscler Thromb Vasc Biol. 2004; 24: 10–11.[Free Full Text]
    
33. Spinale FG, Gunasinghe H, Sprunger PD, Baskin JM, Bradham WC. Extracellular degradative pathways in myocardial remodeling and progression to heart failure. J Card Fail. 2002; 8: S332–S338.[CrossRef][Medline] [Order article via Infotrieve]
    
34. Stamenkovic I. Extracellular matrix remodelling: the role of matrix metalloproteinases. J Pathol. 2003; 200: 448–464.[CrossRef][Medline] [Order article via Infotrieve]
    
35. Johnson C, Galis ZS. Matrix metalloproteinase-2 and -9 differentially regulate smooth muscle cell migration and cell-mediated collagen organization. Arterioscler Thromb Vasc Biol. 2004; 24: 54–60.[Abstract/Free Full Text]
    
36. Tao ZY, Cavasin MA, Yang F, Liu YH, Yang XP. Temporal changes in matrix metalloproteinase expression and inflammatory response associated with cardiac rupture after myocardial infarction in mice. Life Sci. 2004; 74: 1561–1572.[CrossRef][Medline] [Order article via Infotrieve]
    
37. Visse R, Nagase H. Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function, and biochemistry. Circ Res. 2003; 92: 827–839.[Abstract/Free Full Text]
    
38. Okamoto T, Akaike T, Sawa T, Miyamoto Y, van der Vliet A, Maeda H. Activation of matrix metalloproteinases by peroxynitrite-induced protein S-glutathiolation via disulfide S-oxide formation. J Biol Chem. 2001; 276: 29596–29602.[Abstract/Free Full Text]
    
39. Ntziachristos V, Tung CH, Bremer C, Weissleder R. Fluorescence molecular tomography resolves protease activity in vivo. Nat Med. 2002; 8: 757–760.[CrossRef][Medline] [Order article via Infotrieve]
    

Related Article:

Molecular Beacons Illuminate Subcellular Events

Robert O. Bonow
Circulation 2005 111: 1730-1732. [Full Text]

This article has been cited by other articles:

				H. F. Langer, R. Haubner, B. J. Pichler, and M. Gawaz Radionuclide imaging a molecular key to the atherosclerotic plaque. J. Am. Coll. Cardiol., July 1, 2008; 52(1): 1 - 12. [Abstract] [Full Text] [PDF]

				M. Rodriguez-Porcel, W. Cai, O. Gheysens, J. K. Willmann, K. Chen, H. Wang, I. Y. Chen, L. He, J. C. Wu, Z.-b. Li, et al. Imaging of VEGF Receptor in a Rat Myocardial Infarction Model Using PET J. Nucl. Med., April 1, 2008; 49(4): 667 - 673. [Abstract] [Full Text] [PDF]

				M. Nahrendorf, F. K. Swirski, E. Aikawa, L. Stangenberg, T. Wurdinger, J.-L. Figueiredo, P. Libby, R. Weissleder, and M. J. Pittet The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions J. Exp. Med., November 26, 2007; 204(12): 3037 - 3047. [Abstract] [Full Text] [PDF]

				F. A. Jaffer, P. Libby, and R. Weissleder Molecular Imaging of Cardiovascular Disease Circulation, August 28, 2007; 116(9): 1052 - 1061. [Full Text] [PDF]

				M. Nahrendorf, D. E. Sosnovik, P. Waterman, F. K. Swirski, A. N. Pande, E. Aikawa, J.-L. Figueiredo, M. J. Pittet, and R. Weissleder Dual Channel Optical Tomographic Imaging of Leukocyte Recruitment and Protease Activity in the Healing Myocardial Infarct Circ. Res., April 27, 2007; 100(8): 1218 - 1225. [Abstract] [Full Text] [PDF]

				D. E. Sosnovik, M. Nahrendorf, N. Deliolanis, M. Novikov, E. Aikawa, L. Josephson, A. Rosenzweig, R. Weissleder, and V. Ntziachristos Fluorescence Tomography and Magnetic Resonance Imaging of Myocardial Macrophage Infiltration in Infarcted Myocardium In Vivo Circulation, March 20, 2007; 115(11): 1384 - 1391. [Abstract] [Full Text] [PDF]

				J. Cuenca, P. Martin-Sanz, A. M. Alvarez-Barrientos, L. Bosca, and N. Goren Infiltration of Inflammatory Cells Plays an Important Role in Matrix Metalloproteinase Expression and Activation in the Heart during Sepsis Am. J. Pathol., November 1, 2006; 169(5): 1567 - 1576. [Abstract] [Full Text] [PDF]

				W. Cai, J. Rao, S. S. Gambhir, and X. Chen How molecular imaging is speeding up antiangiogenic drug development. Mol. Cancer Ther., November 1, 2006; 5(11): 2624 - 2633. [Abstract] [Full Text] [PDF]

				R. Mukherjee, J. T. Mingoia, J. A. Bruce, J. S. Austin, R. E. Stroud, G. P. Escobar, D. M. McClister Jr, C. M. Allen, M. A. Alfonso-Jaume, M. E. Fini, et al. Selective spatiotemporal induction of matrix metalloproteinase-2 and matrix metalloproteinase-9 transcription after myocardial infarction Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2216 - H2228. [Abstract] [Full Text] [PDF]

				I. Ernens, D. Rouy, E. Velot, Y. Devaux, and D. R. Wagner Adenosine Inhibits Matrix Metalloproteinase-9 Secretion By Neutrophils: Implication of A2a Receptor and cAMP/PKA/Ca2+ Pathway Circ. Res., September 15, 2006; 99(6): 590 - 597. [Abstract] [Full Text] [PDF]

				F. G. Spinale, G. P. Escobar, J. W. Hendrick, L. L. Clark, S. S. Camens, J. P. Mingoia, C. G. Squires, R. E. Stroud, and J. S. Ikonomidis Chronic Matrix Metalloproteinase Inhibition Following Myocardial Infarction in Mice: Differential Effects on Short and Long-Term Survival J. Pharmacol. Exp. Ther., September 1, 2006; 318(3): 966 - 973. [Abstract] [Full Text] [PDF]

				M. P. Hudson, P. W. Armstrong, W. Ruzyllo, J. Brum, L. Cusmano, P. Krzeski, R. Lyon, M. Quinones, P. Theroux, D. Sydlowski, et al. Effects of Selective Matrix Metalloproteinase Inhibitor (PG-116800) to Prevent Ventricular Remodeling After Myocardial Infarction: Results of the PREMIER (Prevention of Myocardial Infarction Early Remodeling) Trial J. Am. Coll. Cardiol., July 4, 2006; 48(1): 15 - 20. [Abstract] [Full Text] [PDF]

				J.-o Deguchi, M. Aikawa, C.-H. Tung, E. Aikawa, D.-E. Kim, V. Ntziachristos, R. Weissleder, and P. Libby Inflammation in Atherosclerosis: Visualizing Matrix Metalloproteinase Action in Macrophages In Vivo Circulation, July 4, 2006; 114(1): 55 - 62. [Abstract] [Full Text] [PDF]

				M. Nahrendorf, K. Hu, S. Frantz, F. A. Jaffer, C.-H. Tung, K.-H. Hiller, S. Voll, P. Nordbeck, D. Sosnovik, S. Gattenlohner, et al. Factor XIII Deficiency Causes Cardiac Rupture, Impairs Wound Healing, and Aggravates Cardiac Remodeling in Mice With Myocardial Infarction Circulation, March 7, 2006; 113(9): 1196 - 1202. [Abstract] [Full Text] [PDF]

				S. Janssens and H. R. Lijnen What has been learned about the cardiovascular effects of matrix metalloproteinases from mouse models? Cardiovasc Res, February 15, 2006; 69(3): 585 - 594. [Abstract] [Full Text] [PDF]

				C. M. Dollery and P. Libby Atherosclerosis and proteinase activation Cardiovasc Res, February 15, 2006; 69(3): 625 - 635. [Abstract] [Full Text] [PDF]

				H. Su, F. G. Spinale, L. W. Dobrucki, J. Song, J. Hua, S. Sweterlitsch, D. P. Dione, P. Cavaliere, C. Chow, B. N. Bourke, et al. Noninvasive Targeted Imaging of Matrix Metalloproteinase Activation in a Murine Model of Postinfarction Remodeling Circulation, November 15, 2005; 112(20): 3157 - 3167. [Abstract] [Full Text] [PDF]

				R. O. Bonow Molecular Beacons Illuminate Subcellular Events Circulation, April 12, 2005; 111(14): 1730 - 1732. [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 111/14/1800    most recent 01.CIR.0000160936.91849.9Fv1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal