Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2005;111:1637-1644
Published online before print March 28, 2005, doi: 10.1161/01.CIR.0000160366.50210.E9
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
111/13/1637    most recent
01.CIR.0000160366.50210.E9v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Peng, T.
Right arrow Articles by Feng, Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peng, T.
Right arrow Articles by Feng, Q.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Cardiomyopathy
Related Collections
Right arrow Contractile function
Right arrow Animal models of human disease
Right arrow Physiological and pathological control of gene expression
Right arrow Oxidant stress

(Circulation. 2005;111:1637-1644.)
© 2005 American Heart Association, Inc.


Molecular Cardiology

Pivotal Role of gp91phox-Containing NADH Oxidase in Lipopolysaccharide-Induced Tumor Necrosis Factor-{alpha} Expression and Myocardial Depression

Tianqing Peng, MD, MSc; Xiangru Lu, MD; Qingping Feng, MD, PhD

From the Cardiology Research Laboratory, Centre for Critical Illness Research, Lawson Health Research Institute, London Health Sciences Centre, Departments of Medicine, Physiology and Pharmacology, University of Western Ontario, London, Ontario, Canada.

Correspondence to Dr Qingping Feng, London Health Sciences Centre, VRL, 6th Floor, 800 Commissioner Rd, London, Ontario, Canada N6A 4G5. E-mail qfeng{at}uwo.ca

Received July 27, 2004; revision received November 17, 2004; accepted November 19, 2004.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— Lipopolysaccharide (LPS) induces cardiomyocyte tumor necrosis factor-{alpha} (TNF-{alpha}) production, which is responsible for myocardial depression during sepsis. The aim of this study was to investigate the role of gp91phox-containing NADH oxidase signaling in cardiomyocyte TNF-{alpha} expression and myocardial dysfunction induced by LPS.

Methods and Results— In cultured mouse neonatal cardiomyocytes, LPS increased NADH oxidase (gp91phox subunit) expression and superoxide generation. Deficiency of gp91phox or inhibition of NADH oxidase blocked TNF-{alpha} expression stimulated by LPS. TNF-{alpha} induction was also inhibited by tempol, N-acetylcysteine, or 1,3-dimethyl-2-thiourea. NADH oxidase activation by LPS increased ERK1/2 and p38 phosphorylation, and inhibition of ERK1/2 and p38 phosphorylation blocked the effect of NADH oxidase on TNF-{alpha} expression. Isolated mouse hearts were perfused with LPS (5 µg/mL) alone or in the presence of apocynin for 1 hour. Myocardial TNF-{alpha} production was decreased in gp91phox-deficient or apocynin-treated hearts compared with those of wild type (P<0.05). To investigate the role of gp91phox-containing NADH oxidase in endotoxemia, mice were treated with LPS (4 mg/kg IP) for 4 and 24 hours, and their heart function was measured with a Langendorff system. Deficiency of gp91phox significantly attenuated LPS-induced myocardial depression (P<0.05).

Conclusions— gp91phox-Containing NADH oxidase is pivotal in LPS-induced TNF-{alpha} expression and cardiac depression. Effects of NADH oxidase activation are mediated by ERK1/2 and p38 MAPK pathway. The present results suggest that gp91phox-containing NADH oxidase may represent a potential therapeutic target for myocardial dysfunction in sepsis.


Key Words: lipids • hormones • myocytes • myocardial infarction


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Lipopolysaccharide (LPS) of Gram-negative bacteria induces expression of tumor necrosis factor-{alpha} (TNF-{alpha}), a proinflammatory cytokine, in cardiomyocytes.1–4 Previous studies have demonstrated that cardiomyocytes are the major local source of TNF-{alpha} in the myocardium during sepsis.4 TNF-{alpha} is responsible for myocardial depression induced by endotoxemia.4,5 Thus, modulation of local myocardial TNF-{alpha} levels produced by cardiomyocytes may be of therapeutic significance in sepsis-induced myocardial dysfunction.4 Mechanisms by which LPS induces TNF-{alpha} expression in cardiomyocytes are not fully understood. It is well established that the effects of LPS are mediated via toll-like receptors.6 We have recently demonstrated that activation of p38 mitogen-activated protein kinase (MAPK) is required for LPS-induced TNF-{alpha} expression in cardiomyocytes3,4; however, LPS signaling downstream of toll-like receptors and upstream of MAPK remains largely unknown in cardiomyocytes.

NADPH or NADH oxidase is an inducible electron transport system found in cells that transfer reducing equivalents from NADPH or NADH to oxygen, which results in superoxide anion (O2) generation.7 The enzyme complex comprises 2 membrane subunits (gp91phox and p22phox, which form flavocytochrome b558) and at least 4 cytosolic proteins (p40phox, p47phox, p67phox, and Rac1/2, which form the cytosolic complex). NAD(P)H oxidase is a highly regulated enzyme. In the resting cells, the cytosolic complex is separated from the membrane-bound catalytic core. On stimulation, the cytosolic component p47phox becomes phosphorylated, and the cytosolic complex migrates to the membrane, where it binds to cytochrome b558 to assemble into an active oxidase.7 NAD(P)H oxidase expression has also been demonstrated in cardiomyocytes8,9 and has been considered as a critical determinant of the redox state of the myocardium.8–11 In response to LPS, NAD(P)H oxidase activity and O2 production are markedly increased in the heart12,13; however, the contribution of the NADH oxidase to TNF-{alpha} expression in LPS-stimulated cardiomyocytes remains unknown, and the role of NADH oxidase in septic myocardial depression has not been investigated. In addition, the membrane subunit of NADH oxidase, gp91phox (Nox2), has at least 3 other homologs, Nox1, Nox3, and Nox4.14 Both gp91phox and Nox4 are expressed in cardiomyocytes.15 A recent study suggested a differential response of the cardiac Nox isoforms, gp91phox and Nox4, to different pathological stimuli for cardiac hypertrophy15; however, the role of gp91phox in sepsis-induced cytokine induction and myocardial dysfunction has not been investigated.

In the present study, we aimed to investigate the role of gp91phox-containing NADH oxidase signaling in LPS-induced TNF-{alpha} expression and myocardial dysfunction induced by endotoxemia. To achieve this goal, experiments were performed on gp91phox-deficient (gp91phox–/–) mice and wild-type mice with cardiomyocyte culture, isolated-heart, and whole-animal approaches. Our results showed that gp91phox-containing NADH oxidase plays an important role in cardiomyocyte TNF-{alpha} expression and cardiac dysfunction during LPS stimulation.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Animals and Preparation of Neonatal Mouse Cardiomyocytes
The breeding pairs of C57BL/6 wild-type and gp91phox–/– mice (C57BL/6 background) were purchased from Jackson Laboratory. A breeding program was performed to produce neonates. All animals were used in accordance with the guidelines of the Animal Care Committee at the University of Western Ontario, Canada. The neonatal cardiomyocytes were prepared and cultured according to methods we described previously.16

Transfections
Small interfering RNAs (siRNAs) for ERK1 and p38{alpha} MAPK were purchased from Santa Cruz Biotechnology, and a universal control siRNA was obtained from Qiagen. The transfection of siRNA was performed in cardiomyocytes with TransMessenger transfection reagent (Qiagen) according to the manufacturer’s instructions. One microliter of siRNA (10 µmol/L) was used for each well of cells (48-well plate). After transfection, cells were maintained in normal culture medium for another 48 hours before LPS treatment.

Reagents
LPS (Salmonella typhosa), diphenyleneiodonium (DPI), apocynin, N-acetylcysteine (NAC), tempol, 1,3-dimethyl-2-thiourea (DMTU), ß-NADH, lucigenin, PD98059, and SB203580 were purchased from Sigma.

Measurement of TNF-{alpha} Protein
Concentrations of TNF-{alpha} protein were determined with a mouse TNF-{alpha} ELISA kit (ALPCO Diagnostics) as in our previous reports.3,4

Measurement of Superoxide Generation (O2)
NADH-dependent O2 generation was measured in cell lysates by lucigenin-enhanced chemiluminescence (20 µg of protein, 100 µmol/L ß-NADH, 5 µmol/L lucigenin) with a multilabel counter (Victor3 Wallac).8 Some experiments were performed in the presence of superoxide dismutase (SOD; Sigma). The light signal was monitored for 5 seconds, and counts per second (CPS) were presented as NADH oxidase activity that was SOD inhibitable.

Analysis of TNF-{alpha}, gp91phox, and MAPK mRNA by Reverse-Transcriptase–Polymerase Chain Reaction
Total RNA was extracted from cardiomyocytes with the TriZol reagent (Gibco-BRL) according to the manufacturer’s instructions. Semiquantitative reverse-transcriptase–polymerase chain reaction (RT-PCR) for TNF-{alpha} was performed as described previously.3 The DNA oligonucleotide primers for gp91phox, ERK1, and p38{alpha} MAPK were as follows: gp91phox (Accession No. U43384), 5' ACGCCCTTTGCCTCCATTCT 3' (sense) and 5' GCTTCAGGGCCACACAGG AA 3' (antisense); ERK1 (Accession No. BC029712), 5'-TCC AAG GGC TAC ACC AAA TC-3' (sense) and 5'-GCT CCA TGT CGA AGG TGA AT-3' (antisense); and p38-{alpha} (Accession No. NM_011951), 5'-TAC CAC GAC CCT GAT GAT GA-3' (sense) and 5'-GCC AAG GAC CAT TCA CAA CT-3' (antisense).

Western Blot Analysis
A total of 30 µg of protein in each sample was subjected to SDS-PAGE with 10% gels, followed by electrotransfer to nitrocellulose membranes. Expression of gp91phox protein was determined by probing the blots with specific antibodies against gp91phox (Signal Transduction, 1/2000), followed by enhanced chemiluminescence detection. Gp91phox protein was detected as a 67-kDa band.

Measurement of ERK1/2 and p38 MAPK Phosphorylation
Assessment of the phosphorylation status of ERK1/2 and p38 MAPK in cardiomyocytes was accomplished by Western blotting (see above) with antibodies against ERK1/2/ phospho-ERK1/2 and p38/phospho-p38 MAPK (New England BioLabs, 1/1000), respectively, as described previously.3

Isolated Mouse Heart Preparations
Adult mouse (male aged 2.5 months) hearts were isolated and perfused in a Langendorff-system with Krebs-Henseleit buffer at 2 mL/min constant flow. The perfusion buffer was maintained at 37°C and bubbled continuously with a mixture of 95% O2 and 5% CO2. Myocardial function was assessed by a previously described method with modifications.17,18 Briefly, a 6-0 silk suture was placed through the apex of the left ventricle and threaded through a light-weight rigid coupling rod, which was connected to a force-displacement transducer (FT03) to record tension and heart rate. The heart work was calculated by multiplying the force (g) by the heart rate (bpm). Maximal and minimal first derivatives of force (+dF/dtmax and –dF/dtmin) as the rate of contraction and relaxation were analyzed by PowerLab Chart program (AD Instruments).

Statistical Analysis
All data are given as mean±SD. Differences between 2 groups were compared by unpaired Student t test. For multigroup comparisons, ANOVA followed by Student-Newman-Keuls test was performed. A value of P<0.05 was considered statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Effects of LPS on NADH Oxidase Expression and NADH Oxidase Activity in Cardiomyocytes
To examine the role of gp91phox-containing NADH oxidase activity in LPS-induced oxidative stress, we measured gp91phox expression and NADH oxidase activity in cardiomyocytes. As shown in Figure 1, LPS treatment increased gp91phox mRNA and protein expression. The upregulation of NADH oxidase expression induced by LPS was associated with an increase in O2 generation, which was SOD-inhibitable. These data showed that LPS increases NADH oxidase activity in cardiomyocytes.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 1. Upregulation of gp91phox expression and superoxide (O2) generation in LPS-stimulated cardiomyocytes. Cardiomyocytes were incubated with vehicle or LPS (10 µg/mL) for 0.5, 2, and 4 hours. A, Representative RT-PCR amplification for gp91phox mRNA and GAPDH mRNA expression from 3 independent experiments. B, gp91phox protein was determined by Western blot analysis at 4 hours after LPS treatment. Upper panel shows representative blot for gp91phox protein. Lower panel is quantification of gp91phox protein levels. C, O2 generation in cardiomyocytes was measured by lucigenin-enhanced chemiluminescence 2 hours after LPS treatment. Data are mean±SD of 3 to 5 independent experiments. *P<0.05 vs control.

LPS-Induced TNF-{alpha} Expression in gp91phox–/– Cardiomyocytes
To investigate the role of gp91phox-containing NADH oxidase in TNF-{alpha} expression in LPS-stimulated cardiomyocytes, cardiomyocytes from gp91phox–/– mice were used. In response to LPS, TNF-{alpha} protein and mRNA expression in gp91phox–/– cardiomyocytes were decreased by 49% and 39%, respectively, compared with wild-type cardiomyocytes (P<0.05; Figures 2A and 2B). This was associated with a significant decrease in O2 generation in gp91phox–/– cardiomyocytes (P<0.05; Figure 2C).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 2. TNF-{alpha} expression and O2 generation in wild-type (WT) and gp91phox–/– cardiomyocytes after LPS stimulation. A and B, Cardiomyocytes were treated with LPS (0.2 µg/mL) for 4 hours. A, Representative RT-PCR amplification for TNF-{alpha} and GAPDH mRNA from 3 independent experiments. B, TNF-{alpha} protein measurement by ELISA. C, Cardiomyocytes were treated with LPS (10 µg/mL) for 2 hours, and O2 generation was determined by lucigenin-enhanced chemiluminescence. Data are mean±SD of 3 independent experiments. *P<0.05 vs WT.

Effects of NADH Oxidase Inhibitor on LPS-Induced TNF-{alpha} Expression in Cardiomyocytes
The contribution of NADH oxidase to TNF-{alpha} expression in response to LPS was also examined by using its pharmacological inhibitors, DPI and apocynin. The inhibitory effects of DPI and apocynin on NADH oxidase were confirmed by measuring NADH-dependent O2 generation (data not shown). As shown in Figure 3, either DPI or apocynin abolished LPS-induced TNF-{alpha} protein and mRNA expression. These data suggest that LPS induces TNF-{alpha} expression via NADH oxidase activation in cardiomyocytes.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Effects of DPI and apocynin on TNF-{alpha} expression in LPS-stimulated cardiomyocytes. Cardiomyocytes were incubated with LPS (10 µg/mL) in presence or absence of DPI (20 and 50 µmol/L) or apocynin (1 mmol/L) for 4 hours. A, Representative RT-PCR amplification for TNF-{alpha} mRNA and GAPDH mRNA expression from 3 independent experiments. DPI (20 µmol/L) inhibited LPS-induced TNF-{alpha} mRNA expression. B, DPI inhibited LPS-induced TNF-{alpha} protein levels in dose-dependent manner. C, Apocynin inhibited LPS-induced TNF-{alpha} protein levels. TNF-{alpha} protein levels in B and C were determined in culture medium by ELISA. Data are mean±SD of 3 to 5 independent experiments. *P<0.05 vs LPS alone.

We further determined the contribution of O2 in LPS-induced TNF-{alpha} expression. A scavenger of O2, the membrane-permeable SOD mimetic tempol, was used in LPS-stimulated cardiomyocytes. Tempol decreased LPS-induced TNF-{alpha} production in a dose-dependent manner (Figure 4A). To confirm this finding, another antioxidant, NAC, was used. Similarly, NAC dose-dependently suppressed TNF-{alpha} expression in LPS-stimulated cardiomyocytes (Figure 4B). Superoxide can form hydroxyl radicals via the Haber-Weiss reaction.19 To examine whether hydroxyl radicals played a role in LPS-induced TNF-{alpha} expression, a hydroxyl radical scavenger, DMTU, was used. As shown in Figure 4C, incubation with DMTU dose-dependently blocked LPS-induced TNF-{alpha} expression. Thus, NADH oxidase-produced O2, hydroxyl radicals, and oxidative stress contributed to TNF-{alpha} expression in LPS-stimulated cardiomyocytes.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 4. Effects of tempol, NAC, and DMTU on LPS-induced TNF-{alpha} expression in cardiomyocytes. Cardiomyocytes were treated with LPS (10 µg/mL) in presence or absence of tempol (0.5 and 1 mmol/L), NAC (2.5 and 5 mmol/L), or DMTU (10 and 25 mmol/L) for 4 hours. TNF-{alpha} protein was measured in culture medium by ELISA. Tempol (A), NAC (B), and DMTU (C) dose-dependently inhibited LPS-induced TNF-{alpha} protein levels. Data are mean±SD of 3 independent experiments. *P<0.05 vs LPS alone.

Role of NADH Oxidase in LPS-Induced ERK1/2 and p38 MAPK in Cardiomyocytes
We have shown that p38 MAPK activation is essential for LPS-induced TNF-{alpha} expression in cardiomyocytes.3,4 This was also demonstrated in the present study in which treatment with the p38 inhibitor SB203580 completely blocked LPS-induced TNF-{alpha} production (Figure 5A). To further investigate the role of ERK1/2 activation in LPS-induced TNF-{alpha} expression, cardiomyocytes were treated with PD98059, which blocks ERK1/2 signaling. PD98059 abrogated TNF-{alpha} expression in LPS-stimulated cardiomyocytes (Figure 5A). The effect of p38 and ERK1/2 MAPK on TNF-{alpha} expression was further confirmed by specific downregulation of MAPK with siRNAs against p38{alpha} and ERK1. siRNA treatment selectively suppressed p38{alpha} and ERK1 expression, as demonstrated by semiquantitative RT-PCR (data not shown), and decreased LPS-induced TNF-{alpha} expression by 24% and 50.8%, respectively (Figure 5B). The data showed that both p38 and ERK activation are required for TNF-{alpha} expression. To determine whether NADH oxidase activation leads to p38 and ERK1/2 activation in response to LPS, phosphorylation of p38 and ERK1/2 MAPK was measured after inhibition of NADH oxidase by DPI. As shown in Figure 5C, DPI treatment significantly blunted phosphorylation of p38 and ERK1/2 stimulated by LPS. These results suggest that NADH oxidase signaling-induced TNF-{alpha} expression is mediated through ERK1/2 and p38 MAPK activation.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 5. TNF-{alpha} expression and phosphorylation of ERK1/2 and p38 MAPK in LPS-stimulated cardiomyocytes. A, Cardiomyocytes were maintained in normal culture medium for 48 hours, followed by incubation of LPS (10 µg/mL) with and without PD98059 (20 µmol/L) or SB203580 (10 µmol/L) for 4 hours. TNF-{alpha} protein was measured in culture medium. B, Effects of specific downregulation of MAPK on LPS-induced TNF-{alpha} expression. Cardiomyocytes were transfected with siRNAs for ERK1 and p38 MAPK (see Methods). After siRNA treatment, cardiomyocytes were incubated with vehicle or LPS (10 µg/mL) for 4 hours. TNF-{alpha} protein was measured in culture medium. C, Effect of DPI on phosphorylation of ERK1/2 and p38 MAPK. Cardiomyocytes were incubated with LPS (10 µg/mL) with and without DPI (20 µmol/L) for 30 minutes. Levels of phosphorylated ERK1/2 and p38 MAPK relative to their total MAPK were determined. Representative Western blot for phosphorylated and total ERK1/2 and p38 MAPK from 3 independent experiments was shown. Data are mean±SD of 3 independent experiments. *P<0.05 vs LPS.

Role of NADH Oxidase in LPS-Induced TNF-{alpha} Expression in Isolated Hearts
To demonstrate the role of gp91phox-containing NADH oxidase in LPS-induced TNF-{alpha} expression at the organ level, mouse hearts isolated from gp91phox–/– and wild-type mice were perfused with LPS in the presence or absence of apocynin for 1 hour. The perfusates were collected and assayed for TNF-{alpha} production. Deficiency of gp91phox and apocynin treatment significantly decreased TNF-{alpha} production by 53% and 74% (Figure 6), respectively, which indicates that gp91phox-containing NADH oxidase also played an important role in adult hearts in terms of TNF-{alpha} production induced by LPS.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 6. TNF-{alpha} protein production in LPS-perfused hearts from gp91phox–/– and wild-type (WT) mice. Mouse hearts isolated from gp91phox–/– and WT mice were perfused with LPS (5 µg/mL) with and without apocynin (250 µmol/L) for 1 hour. Perfusates (50 µL) were assayed for TNF-{alpha} protein production. Data are mean±SD; n=3 to 6 per group. *P<0.05 vs LPS in WT mice.

Role of NADH Oxidase in Myocardial Dysfunction of Endotoxemia
To explore the role of gp91phox-containing NADH oxidase in myocardial depression induced by endotoxemia, gp91phox–/– and wild-type mice were given vehicle or LPS (4 mg/kg IP). Four or 24 hours later, cardiac function was assessed in isolated hearts to avoid systemic reflex influences. Although there was no change in heart rate, heart work and rate of contraction were significantly reduced in endotoxemic mice compared with sham animals at both time points (Figures 7 and 8Down), which indicates myocardial depression. Lack of gp91phox restored heart work and rate of contraction and relaxation without affecting heart rate in endotoxemic mice (Figures 7 and 8Down). These results demonstrated that gp91phox contributed to myocardial dysfunction at both early (4 hours) and late (24 hours) stages of endotoxemia in mice.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 7. Cardiac function in gp91phox–/– and wild-type (WT) mice after 4 hours of LPS treatment (4 mg/kg IP). Mouse hearts were isolated and perfused in Langendorff system. Contractile function of heart was determined. Changes in heart rate (A), heart work (B), rate of contraction (+dF/dtmax, C), and relaxation (–dF/dtmin, D) are presented. Data are mean±SD, n=6 to 8 per group. *P<0.05 vs sham in WT; {dagger}P<0.05 vs LPS in WT.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 8. Cardiac function in gp91phox–/– and wild-type (WT) mice after 24 hours of LPS treatment (4 mg/kg IP). Mouse hearts were isolated and perfused in a Langendorff system. Contractile function of heart was determined. Changes in heart rate (A), heart work (B), rate of contraction (+dF/dtmax, C), and relaxation (–dF/dtmin, D) are presented. Data are mean±SD, n=6 to 8 per group. *P<0.05 vs sham in WT; {dagger}P<0.05 vs LPS in WT.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The present study used cardiomyocytes, isolated hearts, and an in vivo model of endotoxemia to investigate the role of NADH oxidase in LPS-induced TNF-{alpha} expression. We demonstrated for the first time that gp91phox, a subunit of NADH oxidase, plays an important role in myocardial depression induced by endotoxemia and that gp91phox-containing NADH oxidase signaling contributes to LPS-stimulated TNF-{alpha} expression in cardiomyocytes. The effect of gp91phox-containing NADH oxidase was mediated through p38 and ERK1/2 MAPK signaling pathway. The present study provides definitive evidence that LPS-induced myocardial dysfunction is mediated by gp91phox-containing NADH oxidase. Activation of NADH oxidase represents a novel signaling pathway by which LPS induces p38 and ERK1/2 MAPK, leading to TNF-{alpha} expression in cardiomyocytes.

NADH Oxidase Activation in Sepsis
NAD(P)H oxidase has been shown to be a major source of oxidative stress in the myocardium.8–11 The upregulation of NAD(P)H oxidase activity has been observed in human failing hearts.20 NAD(P)H oxidase-derived O2 production has been demonstrated to contribute to various cardiovascular diseases, including cardiac hypertrophy,11 hypertension,21 and atherosclerosis.22,23 In sepsis, NAD(P)H oxidase activation in neutrophils plays a major role in mediating sepsis-induced acute lung injury.24,25 O2 production by NAD(P)H oxidase is involved in the pathogenesis of endothelial dysfunction,26 platelet-endothelial cell adhesion in intestinal venules,27 and production of peroxynitrite and prostaglandin E2 in activated rat microglia.28,29 Recent studies have shown that NAD(P)H oxidase plays an important role in LPS-induced TNF-{alpha} expression and neurotoxicity in microglia and astrocytes.30,31 In the heart, NAD(P)H oxidase activity and O2 production are increased in response to LPS stimulation.12,13 However, a causal relationship between NAD(P)H oxidase activation and myocardial dysfunction during sepsis has not been reported. In the present study, LPS-induced myocardial dysfunction was restored in gp91phox–/– mice. The present results demonstrated that gp91phox-containing NADH oxidase activity contributes to myocardial depression in endotoxemia. Mechanisms by which gp91phox-containing NADH oxidase mediates myocardial dysfunction are not fully understood. Data from the present study suggest that LPS activates gp91phox-containing NADH oxidase, which increases oxidative stress and TNF-{alpha} production in cardiomyocytes, leading to myocardial dysfunction.

NADH Oxidase Signaling in TNF-{alpha} Expression in LPS-Stimulated Cardiomyocytes
TNF-{alpha} has been shown to be a major factor responsible for myocardial depression during endotoxemia4,5; however, mechanisms by which LPS induces TNF-{alpha} expression in cardiomyocytes are not fully understood. The present study aimed to investigate the role of NADH oxidase in LPS-induced TNF-{alpha} expression in cardiomyocytes. Using cultured neonatal mouse cardiomyocytes and isolated heart preparations, we demonstrated the following. First, LPS increased gp91phox expression and O2 generation. Second, deficiency of gp91phox blunted TNF-{alpha} production in response to LPS. Third, the blocking of NADH oxidase activity abrogated LPS-induced TNF-{alpha} expression. The effect of NADH oxidase was mediated through O2 generation, hydroxyl radicals, and related oxidative stress, because either the O2 scavenger tempol, the hydroxyl radical scavenger DMTU, or the antioxidant NAC dose-dependently inhibited LPS-induced TNF-{alpha} expression. These results strongly support a pivotal role of gp91phox-containing NADH oxidase signaling in TNF-{alpha} expression in LPS-stimulated cardiomyocytes.

A deficiency of gp91phox blunted LPS-induced TNF-{alpha} production, whereas NADH oxidase inhibitors abrogated TNF-{alpha} production in cardiomyocytes, which suggests the presence of an alternative Nox isoform. Indeed, a previous study showed that the heart expresses at least 2 Nox isoforms, gp91phox and Nox4.15 Nox4 isoform was also detected in both wild-type and gp91phox–/– cardiomyocytes in the present study (data not shown). Further studies are required to investigate the contribution of different Nox isoforms in myocardial TNF-{alpha} expression during LPS stimulation.

NADH Oxidase in MAPK Activation by LPS
We have demonstrated that p38 MAPK is required for TNF-{alpha} expression in LPS-stimulated cardiomyocytes.3,4 MAPK is sensitive to oxidative stress. In the present study, our working hypothesis was that the signaling pathway downstream of NADH oxidase involves ERK1/2 and p38 MAPK activation. Consistent with this hypothesis, we showed that inhibition of NADH oxidase attenuated ERK1/2 and p38 MAPK phosphorylation in LPS-stimulated cardiomyocytes. Selective inhibition of ERK1 and p38{alpha} with their respective siRNAs significantly attenuated LPS-induced TNF-{alpha} expression. The present study suggests that LPS increases NADH oxidase activity, which increases oxidative stress and hydroxyl radicals through O2 generation. Increased oxidative stress and hydroxyl radicals subsequently lead to activation of ERK1/2 and p38 MAPK, which upregulates TNF-{alpha} expression in cardiomyocytes (Figure 9).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 9. Schematic NADH oxidase signaling pathway leading to TNF-{alpha} expression during LPS stimulation in cardiomyocytes. LPS activates gp91phox-containing NADH oxidase via toll-like receptor 4 (TLR4) and produces O2, which increases phosphorylation of ERK1/2 and p38 MAPK. Activation of MAPK results in TNF-{alpha} expression, which leads to myocardial dysfunction. LBP indicates LPS binding protein.

In summary, the present study provided definitive evidence that gp91phox-containing NADH oxidase activity is pivotal in LPS-induced TNF-{alpha} expression in the heart. This signaling pathway involves O2 generation and activation of ERK1/2 and p38 MAPK. Moreover, gp91phox-containing NADH oxidase contributes to myocardial dysfunction during endotoxemia (Figure 9). The present study suggests that NADH oxidase may represent a novel therapeutic target for TNF-{alpha} expression and myocardial dysfunction in sepsis.


*    Acknowledgments
 
This study was supported by grants awarded to Dr Qingping Feng from the Canadian Institutes of Health Research (MOP-64395) and the Heart & Stroke Foundation of Ontario (T-4923). Dr Feng is a recipient of a Premier’s Research Excellence Award (PREA) from the Province of Ontario. We thank Xuemei Xu for her expert technical assistance in cardiomyocyte culture.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Kapadia S, Lee J, Torre-Amione G, Birdsall HH, Ma TS, Mann DL. Tumor necrosis factor-alpha gene and protein expression in adult feline myocardium after endotoxin administration. J Clin Invest. 1995; 96: 1042–1052.[Medline] [Order article via Infotrieve]

2. Grandel U, Fink L, Blum A, Heep M, Buerke M, Kraemer HJ, Mayer K, Bohle RM, Seeger W, Grimminger F, Sibelius U. Endotoxin-induced myocardial tumor necrosis factor-alpha synthesis depresses contractility of isolated rat hearts: evidence for a role of sphingosine and cyclooxygenase-2–derived thromboxane production. Circulation. 2002; 102: 2758–2764.

3. Peng T, Lu X, Lei M, Feng Q. Endothelial nitric-oxide synthase enhances lipopolysaccharide-stimulated tumor necrosis factor-alpha expression via cAMP-mediated p38 MAPK pathway in cardiomyocytes. J Biol Chem. 2003; 278: 8099–8105.[Abstract/Free Full Text]

4. Peng T, Lu X, Lei M, Moe GW, Feng Q. Inhibition of p38 MAPK decreases myocardial TNF-alpha expression and improves myocardial function and survival in endotoxemia. Cardiovasc Res. 2003; 59: 893–900.[Abstract/Free Full Text]

5. Kumar A, Krieger A, Symeoneides S, Kumar A, Parrillo JE. Myocardial dysfunction in septic shock, part II: role of cytokines and nitric oxide. J Cardiothorac Vasc Anesth. 2001; 15: 485–511.[CrossRef][Medline] [Order article via Infotrieve]

6. Knuefermann P, Nemoto S, Baumgarten G, Misra A, Sivasubramanian N, Carabello BA, Vallejo JG. Cardiac inflammation and innate immunity in septic shock: is there a role for toll-like receptors? Chest. 2002; 121: 1329–1336.[Abstract/Free Full Text]

7. Babior BM, Lambeth JD, Nauseef W. The neutrophil NADPH oxidase. Arch Biochem Biophys. 2002; 397: 342–344.[CrossRef][Medline] [Order article via Infotrieve]

8. Mohazzab HK, Kaminski PM, Wolin MS. Lactate and PO2 modulate superoxide anion production in bovine cardiac myocytes: potential role of NADH oxidase. Circulation. 1997; 96: 614–620.[Abstract/Free Full Text]

9. Xiao L, Pimentel DR, Wang J, Singh K, Colucci WS, Sawyer DB. Role of reactive oxygen species and NAD(P)H oxidase in alpha1-adrenoceptor signaling in adult rat cardiac myocytes. Am J Physiol Cell Physiol. 2002; 282: C926–C934.[Abstract/Free Full Text]

10. Li JM, Gall NP, Grieve DJ, Chen M, Shah AM. Activation of NADPH oxidase during progression of cardiac hypertrophy to failure. Hypertension. 2002; 40: 477–484.[Abstract/Free Full Text]

11. Bendall JK, Cave AC, Heymes C, Gall N, Shah AM. Pivotal role of a gp91phox-containing NADPH oxidase in angiotensin II–induced cardiac hypertrophy in mice. Circulation. 2002; 105: 293–296.[Abstract/Free Full Text]

12. Khadour FH, Panas D, Ferdinandy P, Schulze C, Csont T, Lalu MM, Wildhirt SM, Schulz R. Enhanced NO and superoxide generation in dysfunctional hearts from endotoxemic rats. Am J Physiol Heart Circ Physiol. 2002; 283: H1108–H1115.[Abstract/Free Full Text]

13. Ben-Shaul V, Lomnitski L, Nyska A, Zurovsky Y, Bergman M, Grossman S. The effect of natural antioxidants, NAO and apocynin, on oxidative stress in the rat heart following LPS challenge. Toxicol Lett. 2001; 123: 1–10.[Medline] [Order article via Infotrieve]

14. Lambeth JD, Cheng G, Arnold RS, Edens WA. Novel homologs of gp91phox. Trends Biochem Sci. 2000; 25: 459–461.[CrossRef][Medline] [Order article via Infotrieve]

15. Byrne JA, Grieve DJ, Bendall JK, Li JM, Gove C, Lambeth JD, Cave AC, Shah AM. Contrasting roles of NADPH oxidase isoforms in pressure-overload versus angiotensin II–induced cardiac hypertrophy. Circ Res. 2003; 93: 802–805.[Abstract/Free Full Text]

16. Song W, Lu X, Feng Q. Tumor necrosis factor-alpha induces apoptosis via inducible nitric oxide synthase in neonatal mouse cardiomyocytes. Cardiovasc Res. 2000; 45: 595–602.[Abstract/Free Full Text]

17. Tada H, Thompson CI, Recchia FA, Loke KE, Ochoa M, Smith CJ, Shesely EG, Kaley G, Hintze TH. Myocardial glucose uptake is regulated by nitric oxide via endothelial nitric oxide synthase in Langendorff mouse heart. Circ Res. 2000; 86: 270–274.[Abstract/Free Full Text]

18. Sumeray MS, Rees DD, Yellon DM. Infarct size and nitric oxide synthase in murine myocardium. J Mol Cell Cardiol. 2000; 32: 35–42.[CrossRef][Medline] [Order article via Infotrieve]

19. Koppenol WH. The Haber-Weiss cycle: 70 years later. Redox Rep. 2001; 6: 229–234.[CrossRef][Medline] [Order article via Infotrieve]

20. Heymes C, Bendall JK, Ratajczak P, Cave AC, Samuel JL, Hasenfuss G, Shah AM. Increased myocardial NADPH oxidase activity in human heart failure. J Am Coll Cardiol. 2003; 41: 2164–2171.[Abstract/Free Full Text]

21. Rajagopalan S, Kurz S, Munzel T, Tarpey M, Freeman BA, Griendling KK, Harrison DG. Angiotensin II–mediated hypertension in the rat increases vascular superoxide production via membrane NADH/NADPH oxidase activation: contribution to alterations of vasomotor tone. J Clin Invest. 1996; 97: 1916–1923.[Medline] [Order article via Infotrieve]

22. Meyer JW, Schmitt ME. A central role for the endothelial NADPH oxidase in atherosclerosis. FEBS Lett. 2000; 472: 1–4.[CrossRef][Medline] [Order article via Infotrieve]

23. Warnholtz A, Nickenig G, Schulz E, Macharzina R, Brasen JH, Skatchkov M, Heitzer T, Stasch JP, Griendling KK, Harrison DG, Bohm M, Meinertz T, Munzel T. Increased NADH-oxidase–mediated superoxide production in the early stages of atherosclerosis: evidence for involvement of the renin–angiotensin system. Circulation. 1999; 99: 2027–2033.[Abstract/Free Full Text]

24. Wang W, Suzuki Y, Tanigaki T, Rank DR, Raffin TA. Effect of the NADPH oxidase inhibitor apocynin on septic lung injury in guinea pigs. Am J Respir Crit Care Med. 1994; 150: 1449–1452.[Abstract]

25. Gao XP, Standiford TJ, Rahman A, Newstead M, Holland SM, Dinauer MC, Liu QH, Malik AB. Role of NADPH oxidase in the mechanism of lung neutrophil sequestration and microvessel injury induced by Gram-negative sepsis: studies in p47phox–/– and gp91phox–/– mice. J Immunol. 2002; 168: 3974–3982.[Abstract/Free Full Text]

26. Brandes RP, Koddenberg G, Gwinner W, Kim D, Kruse HJ, Busse R, Mugge A. Role of increased production of superoxide anions by NAD(P)H oxidase and xanthine oxidase in prolonged endotoxemia. Hypertension. 1999; 33: 1243–1249.[Abstract/Free Full Text]

27. Cerwinka WH, Cooper D, Krieglstein CF, Ross CR, McCord JM, Granger DN. Superoxide mediates endotoxin-induced platelet–endothelial cell adhesion in intestinal venules. Am J Physiol Heart Circ Physiol. 2003; 284: H535–H541.[Abstract/Free Full Text]

28. Bal-Price A, Matthias A, Brown GC. Stimulation of the NADPH oxidase in activated rat microglia removes nitric oxide but induces peroxynitrite production. J Neurochem. 2002; 80: 73–80.[CrossRef][Medline] [Order article via Infotrieve]

29. Wang T, Qin L, Liu B, Liu Y, Wilson B, Eling TE, Langenbach R, Taniura S, Hong JS. Role of reactive oxygen species in LPS-induced production of prostaglandin E2 in microglia. J Neurochem. 2004; 88: 939–947.[CrossRef][Medline] [Order article via Infotrieve]

30. Pawate S, Shen Q, Fan F, Bhat NR. Redox regulation of glial inflammatory response to lipopolysaccharide and interferon-gamma. J Neurosci Res. 2004; 77: 540–551.[CrossRef][Medline] [Order article via Infotrieve]

31. Qin L, Liu Y, Wang T, Wei SJ, Block ML, Wilson B, Liu B, Hong JS. NADPH oxidase mediates lipopolysaccharide-induced neurotoxicity and proinflammatory gene expression in activated microglia. J Biol Chem. 2004; 279: 1415–1421.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
DiabetesHome page
E. Shen, Y. Li, Y. Li, L. Shan, H. Zhu, Q. Feng, J. M. O. Arnold, and T. Peng
Rac1 Is Required for Cardiomyocyte Apoptosis During Hyperglycemia
Diabetes, October 1, 2009; 58(10): 2386 - 2395.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
Y. Li, Y. Li, Q. Feng, M. Arnold, and T. Peng
Calpain activation contributes to hyperglycaemia-induced apoptosis in cardiomyocytes
Cardiovasc Res, October 1, 2009; 84(1): 100 - 110.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
X. Li, Y. Li, L. Shan, E Shen, R. Chen, and T. Peng
Over-expression of calpastatin inhibits calpain activation and attenuates myocardial dysfunction during endotoxaemia
Cardiovasc Res, July 1, 2009; 83(1): 72 - 79.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
L. Hammoud, D. E. Burger, X. Lu, and Q. Feng
Tissue inhibitor of metalloproteinase-3 inhibits neonatal mouse cardiomyocyte proliferation via EGFR/JNK/SP-1 signaling
Am J Physiol Cell Physiol, April 1, 2009; 296(4): C735 - C745.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
X. Palomer, D. Alvarez-Guardia, R. Rodriguez-Calvo, T. Coll, J. C. Laguna, M. M. Davidson, T. O. Chan, A. M. Feldman, and M. Vazquez-Carrera
TNF-{alpha} reduces PGC-1{alpha} expression through NF-{kappa}B and p38 MAPK leading to increased glucose oxidation in a human cardiac cell model
Cardiovasc Res, March 1, 2009; 81(4): 703 - 712.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
T. Peng, T. Zhang, X. Lu, and Q. Feng
JNK1/c-fos inhibits cardiomyocyte TNF-{alpha} expression via a negative crosstalk with ERK and p38 MAPK in endotoxaemia
Cardiovasc Res, March 1, 2009; 81(4): 733 - 741.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
H. Yuan, C. N. Perry, C. Huang, E. Iwai-Kanai, R. S. Carreira, C. C. Glembotski, and R. A. Gottlieb
LPS-induced autophagy is mediated by oxidative signaling in cardiomyocytes and is associated with cytoprotection
Am J Physiol Heart Circ Physiol, February 1, 2009; 296(2): H470 - H479.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
T. Peng, E Shen, J. Fan, Y. Zhang, J. M. O. Arnold, and Q. Feng
Disruption of phospholipase C{gamma}1 signalling attenuates cardiac tumor necrosis factor-{alpha} expression and improves myocardial function during endotoxemia
Cardiovasc Res, April 1, 2008; 78(1): 90 - 97.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Yang, J. Wu, C. M. Martin, P. R. Kvietys, and T. Rui
Important role of p38 MAP kinase/NF-{kappa}B signaling pathway in the sepsis-induced conversion of cardiac myocytes to a proinflammatory phenotype
Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H994 - H1001.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
L. Hammoud, F. Xiang, X. Lu, F. Brunner, K. Leco, and Q. Feng
Endothelial nitric oxide synthase promotes neonatal cardiomyocyte proliferation by inhibiting tissue inhibitor of metalloproteinase-3 expression
Cardiovasc Res, July 15, 2007; 75(2): 359 - 368.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
N. Geoghegan-Morphet, D. Burger, X. Lu, V. Sathish, T. Peng, S. M. Sims, and Q. Feng
Role of neuronal nitric oxide synthase in lipopolysaccharide-induced tumor necrosis factor-alpha expression in neonatal mouse cardiomyocytes
Cardiovasc Res, July 15, 2007; 75(2): 408 - 416.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
C.-C. Yang, M.-C. Ma, C.-T. Chien, M.-S. Wu, W.-K. Sun, and C.-F. Chen
Hypoxic preconditioning attenuates lipopolysaccharide-induced oxidative stress in rat kidneys
J. Physiol., July 1, 2007; 582(1): 407 - 419.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
E. Lepic, D. Burger, X. Lu, W. Song, and Q. Feng
Lack of endothelial nitric oxide synthase decreases cardiomyocyte proliferation and delays cardiac maturation
Am J Physiol Cell Physiol, December 1, 2006; 291(6): C1240 - C1246.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
K. Nakahira, H. P. Kim, X. H. Geng, A. Nakao, X. Wang, N. Murase, P. F. Drain, X. Wang, M. Sasidhar, E. G. Nabel, et al.
Carbon monoxide differentially inhibits TLR signaling pathways by regulating ROS-induced trafficking of TLRs to lipid rafts
J. Exp. Med., October 2, 2006; 203(10): 2377 - 2389.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
D. Burger, M. Lei, N. Geoghegan-Morphet, X. Lu, A. Xenocostas, and Q. Feng
Erythropoietin protects cardiomyocytes from apoptosis via up-regulation of endothelial nitric oxide synthase
Cardiovasc Res, October 1, 2006; 72(1): 51 - 59.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
111/13/1637    most recent
01.CIR.0000160366.50210.E9v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Peng, T.
Right arrow Articles by Feng, Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peng, T.
Right arrow Articles by Feng, Q.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Cardiomyopathy
Related Collections
Right arrow Contractile function
Right arrow Animal models of human disease
Right arrow Physiological and pathological control of gene expression
Right arrow Oxidant stress