| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2004;110:3472-3479.)
© 2004 American Heart Association, Inc.
Molecular Cardiology |
From the Center of Vascular Biology and Department of Pathology (J.H., X.Z., A.C.N., D.P.H.) and the Department of Medicine (M.P., A.M.G.), Weill Medical College of Cornell University, New York, NY.
Correspondence to Jihong Han, PhD, Center of Vascular Biology/Department of Pathology, Weill Medical College of Cornell University, 1300 York Ave, New York, NY 10021. E-mail jhan{at}med.cornell.edu
Received February 2, 2004; de novo received March 25, 2004; revision received September 3, 2004; accepted September 14, 2004.
| Abstract |
|---|
|
|
|---|
Methods and Results We found that pitavastatin significantly increased SR-BI mRNA and protein expression in a macrophage cell line in a concentration- and time-dependent manner. It also increased SR-BI expression in both mouse peritoneal and human monocyte-derived macrophages. Associated with increased SR-BI expression, pitavastatin enhanced macrophage HDL binding, uptake of [14C]cholesteryl oleate/HDL, and efflux of [3H]cholesterol to HDL. Pitavastatin abolished the inhibition of macrophage SR-BI expression by cholesterol biosynthetic intermediates. It also restored SR-BI expression inhibited by lipopolysaccharide and tumor necrosis factor-
through its inactivation of the transcription factor nuclear factor-
B.
Conclusions Our data demonstrate that pitavastatin can stimulate macrophage SR-BI expression by reduction of cholesterol biosynthetic intermediates and antiinflammatory action and suggest additional pleiotropic effects of statins by which they may reduce the incidence of coronary heart disease.
Key Words: statins macrophages scavenger receptors lipoproteins
| Introduction |
|---|
|
|
|---|
The bidirectional flux of cholesterol across the plasma membrane requires the specific receptor for HDL binding.3 Scavenger receptor class B type I (SR-BI), a member of the family of class B scavenger receptors including CD36 and lysosomal integral membrane protein-II (LIMP-II), has been shown to have high affinity for HDL binding and moderate affinity for other lipoproteins, such as native LDL, acetylated LDL, oxidized LDL, and anionic phospholipid vesicles.4 In various cell types, SR-BI can bind HDL reversibly and mediate cholesterol efflux and cholesteryl ester uptake.5,6 A direct relationship has been observed between the flux rate of cholesterol through HDL and the levels of SR-BI expression.5
SR-BI is highly expressed in several tissues and cell types, including monocyte/macrophages.4 It has been thought to play an important role in the development of human atherosclerotic lesions, because high expression of SR-BI protects proatherogenic mice against lesion development, whereas disruption of SR-BI accelerates the onset of atherosclerosis.7,8 SR-BI expression can be affected by monocyte/macrophage differentiation and by several molecules, such as probucol, polyunsaturated fatty acids, cellular cholesterol levels, testosterone, lipopolysaccharide (LPS), oxidized LDL, and the cytokines tumor necrosis factor-
(TNF-
) and interferon-
(IFN-
).4
Statins, potent inhibitors of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase, significantly reduce total and LDL cholesterol levels in the blood and decrease the incidence of coronary heart disease in patients.9 Other pleiotropic effects of statins in the vessel wall include10 (1) increasing endothelial NO synthase (eNOS) activity and tissue-type plasminogen activator (tPA); (2) decreasing plasminogen activator inhibitor-1 (PAI-1), endothelin-1, proinflammatory cytokine (interleukin [IL]-1ß, IL-6) expression, and LDL oxidation; (3) reducing migration and proliferation of smooth muscle cells; and (4) reducing matrix metalloproteinases (MMPs), inducible NO synthetase (iNOS), and monocyte chemoattractant 1 (MCP-1).
Pitavastatin (NK-104, CAS 147526-32-7; monocalcium bis [(3R,5S,6E)-7-(2-cyclopropyl-4-(4-fluorophenyl)-3-quiolyl)-3,5-dihydroxy-6-heptenoate] is a recently developed HMG-CoA reductase inhibitor. It significantly reduces serum total and LDL cholesterols and triglycerides, whereas it moderately increases HDL cholesterol.11 Recently, we reported that this statin significantly decreased the oxidized LDL receptor CD36.12 Downregulation of macrophage CD36 expression by pitavastatin was defined through a novel mechanism, because it can suppress peroxisome proliferatoractivated receptor-
(PPAR-
) expression while increasing phosphorylation of PPAR-
. Here, we have investigated the impact of pitavastatin on macrophage SR-BI expression in an attempt to more fully define its role in cholesterol metabolism. We demonstrate that pitavastatin can increase SR-BI expression through its influence on cholesterol biosynthetic intermediates and the inflammatory response.
| Methods |
|---|
|
|
|---|
85%. To collect peritoneal macrophages, mice were injected with 3 mL of 4% thioglycolate and maintained with access to water and normal chow for 5 days. Mice were euthanized by decapitation, after which peritoneal macrophages were collected from the mouse abdomen by lavage with PBS. Cells were cultured in complete RPMI 1640 medium for 3 hours, and all floating cells were removed. Adhesive cells continued to be cultured with complete RPMI medium for 2 additional days and were treated as indicated.
To isolate human monocytes, blood was drawn from a healthy donor and then mixed (5:1) with dextran sedimentation mixture (15 g dextran, MW 500 000, 15 g D-glucose, and 4.5 g NaCl in 500 mL distilled water and filtered through a 0.2-µm filter). The mixture was incubated for 60 minutes at room temperature to sediment red cells. The upper plasma layer containing lymphocytes was collected and centrifuged for 10 minutes at 1000 rpm. The cell pellet was resuspended with serum-free RPMI medium and dispensed on top of Ficoll-Paque at room temperature. After centrifugation for 20 minutes at 2250 rpm, cells at the interface were carefully collected and washed twice with serum-free RPMI medium. Cells were then suspended in RPMI medium containing 20% FCS in FCS-precoated dishes. After 4 hours in culture, floating cells were removed, and the remaining cells were allowed to complete the monocyte/macrophage differentiation process for 7 days more.
Rabbit polyclonal anti-human/mouse SR-BI antibody was purchased from Novus Biologicals Inc. Antinuclear factor (NF)-
B p65 and antiI
B-
antibodies were purchased from Santa Cruz Biotechnology Inc. NF-
B DNA binding activity assay kits were purchased from Active-Motif, Inc. Chemicals were obtained from Sigma-Aldrich Co.
Isolation of Total RNA, Purification of Poly(A+) RNA, and Northern Blot
Cells were lysed in RNAzol B (Tel-Test, Inc), chloroform was extracted, and total RNA was precipitated in isopropanol. After it had been washed with 80% and 100% ethanol, the dried pellet of total RNA was dissolved in distilled water and quantified. The poly(A+) RNA was purified from 100 µg of total RNA by use of the PolyATtract mRNA Isolation System III (Promega).
Poly(A+) RNA was loaded on 1% formaldehyde agarose gel. After electrophoresis, Poly(A+) RNA was transferred to a Zeta-probe GT Genomic Tested Blotting Membrane (Bio-Rad Laboratories) in 10x SSC by capillary force overnight. The blot was UV-crosslinked for 2 minutes, then prehybridized with Hybrisol I (Oncor, Inc) for 30 minutes before the addition of a 32P-randomly primed labeling probe for mouse SR-BI or GAPDH. After overnight hybridization, the membrane was washed for 2x 20 minutes with 2x SSC and 0.2% SDS, and for 2x 20 minutes with 0.2x SSC and 0.2% SDS at 55°C. The blot was autoradiographed by exposure to a x-ray film (X-Omat AR, Kodak). The semiquantitative assay of autoradiograms was assessed by densitometric scanning with a UMAX UC630 flatbed scanner attached to a Macintosh IIci (Apple Computer) running NIH Image software. The probe for mouse SR-BI was generated by reverse transcriptionpolymerase chain reaction (RT-PCR) based on the published sequence.13 The sequences of 5'- and 3'- oligonucleotides used were TCGGCGTTGTCATGATCCTC (121-141) and GGTTCATAAAAGCACGCTGG (551-571), respectively.
Analysis of HDL Binding, Efflux of Free Cholesterol, and Influx of Cholesteryl Ester
HDLs (1.063 to 1.210 g/mL) were isolated from normal human plasma by sequential ultracentrifugation, dialyzed against PBS containing 0.3 mmol/L EDTA, sterilized by filtration through a 0.22-µm filter, and stored under N2 gas at 4°C. Protein content was determined by the methods of Lowry.14
To perform the binding of HDL to macrophages, HDL was fluorescein-conjugated with a reactive succinimidyl-ester of carboxyl-fluorescein by use of a labeling kit purchased from Princeton Separations. After treatment, macrophages (
1x106 cells/sample) were washed twice with cold PBS and then incubated with 20 µg/mL of labeled HDL in serum-free medium for 2 hours at 4°C. After washing twice with PBS, cells were subjected to fluorescence-activated cell sorting (FACS) (Coulter FACScan) to determine the binding of HDL to macrophages.
Efflux of free cholesterol from macrophages and influx of cholesteryl ester to macrophages after treatments were conducted according to a previous description.15
Analysis of SR-BI, NF-
B p65, and I
B-
Expression by Western Blotting and SR-BI Surface Expression by FACS
After treatment, macrophages were washed twice with cold PBS, then scraped and lysed in ice-cold lysis buffer (50 mmol/L Tris, pH 7.5, 150 mmol/L NaCl, 1% Triton X-100, 1% sodium deoxychlorate, 1 mmol/L PMSF, 50 mmol/L sodium fluoride, 1 mmol/L sodium orthovanadate, 50 µg/mL aprotinin, and 50 µg/mL leupeptin). Lysate was sonicated for 20 cycles, then microcentrifuged for 15 minutes at 4°C, and the supernatant was transferred to a new test tube. After the content had been determined, proteins were loaded and separated on 12% SDS-PAGE and transferred onto nylon-enhanced nitrocellulose membrane. The membranes were blocked with a solution of 0.1% Tween 20/PBS (PBS-T) containing 5% fat-free milk for 1 hour, then incubated with either rabbit polyclonal antiSR-BI (1:2000), antiNF-
B (1:200), or antiI
B-
(1:200) antibody, respectively, for 2 hours at room temperature, followed by a washing for 3x 10 minutes with PBS-T buffer. The blot was reblocked with PBS-T containing 5% milk followed by incubation with horseradish peroxidase conjugated goat anti-rabbit IgG for another hour at room temperature. After washing 3x10 minutes with PBS-T, the membrane was incubated for 1 minute in a mixture of equal volumes of Western blot chemiluminescence reagents 1 and 2 and then exposed to film before development.
To analyze SR-BI surface expression, human monocyte-derived macrophages were scraped and washed twice with PBS containing 1% FCS. Approximately 1x106 cells from each sample were blocked for 30 minutes at room temperature with PBS containing 5% goat serum. After the washing, cells were incubated with rabbit antiSR-BI antibody (1:100) for 1 hour at room temperature. Cells were then incubated with goat anti-rabbit fluorescein isothiocyanate (FITC)-conjugated IgG (1:50) for 45 minutes. After a washing with PBS, cells were subjected to flow cytometric evaluation.
Extraction of Nuclear Proteins and Electrophoretic Mobility Shift Assay of NF-
B DNA Binding Activity
After treatments, cells were washed twice with cold PBS and then resuspended in 400 µL of cold buffer A (mmol/L: 10 HEPES, pH 7.9, 10 KCl, 0.1 EDTA, 0.1 EGTA, 1 DTT, and 0.5 PMSF). After 15 minutes incubation on ice, cell suspensions were added to 25 µL of 10% NP-40 and vortexed vigorously for 10 seconds. The supernatant was removed after spinning for 30 seconds at 13 000 rpm. The pellet was resuspended in 100 µL cold buffer C (20 mmol/L HEPES, pH 7.91, 400 mmol/L KCl, 1 mmol/L EDTA, 1 mmol/L EGTA, 1 mmol/L DTT, 1 mmol/L PMSF, 10 µg/mL leupeptin, and 10 µg/mL aprotinin) and kept on ice for 15 minutes. The mixture was spun again for 15 minutes at 13 000 rpm with a microfuge, and the supernatant was collected as nuclear proteins. Nuclear proteins were divided into aliquots and kept at 80°C.
To determine the DNA binding activity of NF-
B, the corresponding oligo probe was end-labeled with
-[32P]-ATP by T4 polynucleotide kinase and purified with a MicroSpin G-25 column. Reaction of nuclear proteins (8 µg/sample) and 32P-labeled oligo probe was completed according to the manufacturers instructions. Reaction mixture was loaded on precooled, 5% polyacrylamide (38:2) native gel. The complex of nuclear proteinDNA probe was separated from the unbound probe by electrophoresis and detected by radiography after the gel was air-dried.
Determination of Secreted TNF-
in Cultured Medium by ELISA
Macrophages were cultured in 60-mm dishes until
90% confluence. Cells were washed with serum-free medium and then remained in the serum-free medium with treatments. The cultured medium was collected at different times after treatment and spun for 5 minutes with a Microfuge. The supernatant was saved, and TNF-
was detected by ELISA (the assay kit was purchased from BD Biosciences). The secreted TNF-
in culture medium was calculated on the basis of a standard curve of given TNF-
concentrations and expressed as ng/mL medium, with triplicate assays for each sample.
Data Analysis
All experiments were repeated at least 3 times, and representative results are presented. Data were analyzed by paired t test in an assay of cholesterol efflux, influx of cholesteryl oleate, and TNF-
secretion.
| Results |
|---|
|
|
|---|
3-fold). To determine whether the induction of SR-BI protein by pitavastatin also occurred at the transcriptional level, we analyzed the RNA transcript by Northern blot and found that SR-BI mRNA was also concentration-dependently increased by pitavastatin (Figure 1B).
|
To study the dynamic changes of SR-BI expression in response to pitavastatin treatments, macrophages were treated with 10 µmol/L pitavastatin for various times and analyzed for SR-BI protein expression by Western blot (Figure 1C). The induction of SR-BI expression by pitavastatin was observed as early as 1 hour after treatment, suggesting a rapid response. Maximal induction occurred after 12 hours of treatment, and it was maintained for 24 hours after treatment.
We also determined whether other well-established statins could alter SR-BI protein expression in macrophages. Simvastatin, pravastatin, and rosuvastatin also significantly induced macrophage SR-BI expression (Figure 1D).
The functional consequences of increased SR-BI expression in response to pitavastatin were evaluated by determination of HDL binding to macrophages, efflux of free cholesterol to HDL from macrophages, and influx of cholesteryl oleate/HDL to macrophages. Figure 2 demonstrates that pitavastatin significantly increased HDL binding to macrophages (Figure 2A), and it also enhanced the efflux of free cholesterol to HDL from macrophages and uptake of cholesteryl oleate/HDL by macrophages (Figure 2B).
|
To investigate the physiological relevance of statins on macrophage SR-BI expression, we isolated peritoneal macrophages from mice and treated them with pitavastatin overnight. SR-BI expression was determined by Western blot (Figure 3A). Pitavastatin significantly induced peritoneal macrophage SR-BI expression in a concentration-dependent manner. The stimulative effect of pitavastatin on macrophage SR-BI expression was further demonstrated by increased SR-BI surface expression in human monocyte-derived macrophages that were previously treated with 1 and 5 µmol/L of pitavastatin (Figure 3B).
|
Inhibition of mevalonate synthesis by statins may also prevent the synthesis of other important isoprenoid intermediates of the cholesterol biosynthetic pathway,10 ie, farnesylpyrophosphate (FPP) and geranylgeranylpyrophosphate (GGPP). We reasoned that pitavastatin could induce macrophage SR-BI expression through its effect on these intermediates. To test this hypothesis, we examined the effects of mevalonate on macrophage SR-BI expression. Mevalonate decreased macrophage SR-BI protein expression only at a relative high concentration (50 µmol/L), and such inhibition was abolished by pitavastatin (Figure 4A). Another intermediate (FPP) for cholesterol biosynthesis also showed moderate inhibitory effects on macrophage SR-BI expression, but the effects were seen at much lower concentrations (1 and 5 µmol/L, Figure 4B). GGPP, a key intermediate to geranylgeranylate proteins involving in cell signaling cascades, was also influenced by pitavastatin action. Figure 4C showed that GGPP moderately suppressed macrophage SR-BI expression. This action was blocked by pitavastatin, and similar findings were observed with ubiquinone (Coenzyme Q10, Figure 4D). In addition, we observed that inhibition of geranylgeranylation (by a geranylgeranyl transferase I inhibitor, GGTI-287), but not inhibition of farnesylation (by a farnesyl transferase inhibitor, FTI-277), significantly induced macrophage SR-BI expression (data not shown), suggesting that pitavastatin induced macrophage SR-BI expression through inhibition of small G proteins of the Rho family rather than the Ras family. These results suggest that cholesterol biosynthetic intermediates may play an important role in the regulation of macrophage SR-BI expression.
|
It was shown previously that LPS and TNF-
suppress SR-BI expression in different cell types with unclear mechanisms.16 In our studies, we treated macrophages with LPS or TNF-
in the presence or absence of inhibitors for NF-
B, a transcriptional activator of many proinflammatory proteins. Both LPS and TNF-
suppressed more than 50% of SR-BI expression. Although NF-
B inhibitors alone did not show effects on SR-BI expression, they significantly blocked the inhibitory actions of LPS and TNF-
on SR-BI expression (Figure 5). These data indicate that LPS and TNF-
can decrease SR-BI expression through their activation of NF-
B. LPS more likely inhibits macrophage SR-BI expression through its stimulation of TNF-
production in macrophages, because the secretion of TNF-
in response to LPS treatment was rapid. After 2 hours of treatment with 200 ng/mL LPS, we detected that the concentration of TNF-
in serum-free cultured medium was 32.5±2.3 ng/mL, compared with undetectable levels of TNF-
in control cells even after 10 hours of incubation.
|
To determine whether the induction of macrophage SR-BI expression by pitavastatin may have occurred as a result of some antiinflammatory action, we first determined whether pitavastatin could block the inhibitory actions of LPS and TNF-
on SR-BI expression. We found that LPS and TNF-
significantly decreased SR-BI expression; pitavastatin partially blocked LPS action but totally overwhelmed the TNF-
action on macrophage SR-BI expression (Figure 6).
|
Finally, to investigate this possibility further, we determined whether pitavastatin could alter NF-
B DNA binding activity using electrophoretic mobility shift assay. Figure 7A demonstrates that pitavastatin reduced more than 50% of NF-
B DNA binding activity in J774 macrophages. We further determined whether pitavastatin was able to regulate expression of NF-
B complex proteins. NF-
B p65 expression was moderately decreased, but I
B-
expression was significantly increased, by pitavastatin (Figure 7B). The opposite effects of pitavastatin on these 2 proteins could lead to the decreased NF-
B DNA binding activity.
|
| Discussion |
|---|
|
|
|---|
The effects of pitavastatin on SR-BI expression through the influence on cholesterol biosynthesis are consistent with our previous report that lipid loading of macrophages can reduce SR-BI expression.15 In addition to macrophages, reducing intracellular cholesterol levels by ß-cyclodextran demonstrates a reverse relationship between SR-BI expression and the cellular cholesterol pool in an adrenal cell line (Y1-BS1).18 It is noteworthy that although macrophages express HMG-CoA reductase,19 pitavastatin moderately reduces macrophage cholesterol levels (
10% to 15% decreases have been observed compared with control after overnight incubation with 10 µmol/L of pitavastatin; data not shown). The cellular impact of pitavastatin on levels of cholesterol biosynthetic intermediates in macrophages is unclear. Cells that have been treated with these intermediates have decreased SR-BI expression (
20% to 30%, Figure 4). Furthermore, cotreatment with pitavastatin and these intermediates can induce SR-BI expression to a degree comparable to that by pitavastatin alone, suggesting that an additional mechanism is involved in the regulation of macrophage SR-BI expression by pitavastatin.
Antiinflammatory effects of statins include the inhibition of leukocyte-endothelium interactions, the reduction of the expression of adhesion molecules such as intercellular adhesion molecule-1, and the suppression of the production of proinflammatory cytokines (IL-1ß, IL-6, and cyclooxygenase-2).10 The effects of statins on TNF-
are controversial. Lovastatin inhibits LPS-induced expression of TNF-
in rat primary astrocytes, microglia, and macrophages,20 but it synergizes antiproliferative activity in MmB16 melanoma cells and L1210 leukemia cells,21 antitumor effects against Ha-rastransformed murine tumor,22 and induction of E-selectin, intercellular adhesion molecule-1, and vascular adhesion molecule-1 in endothelial cells with TNF-
.23 Although atorvastatin suppresses TNF-
production in Th1 cells,24 it works cooperatively with TNF-
to stimulate the generation of PAI-1 in PMA- or TGF-ß1/1
,25-dihydroxyvitamin D3differentiated HL-60 cells.25 Atorvastatin has no effect on TNF-
production in familial hypercholesterolemia patients.26 Rosuvastatin decreases TNF-
expression in apoE*3-Leiden transgenic female mice,27 whereas cerivastatin has no effect on human macrophage TNF-
production.28 In contrast, Kiener et al29 reported that atorvastatin, lovastatin, and simvastatin can stimulate the production of TNF-
in human monocytes. To determine whether pitavastatin increased macrophage SR-BI expression by altering TNF-
levels, we first assessed the amount of TNF-
in culture medium after pitavastatin treatment. Consistent with some of the above-described observations, we did not see changes in TNF-
levels by pitavastatin in our cells up to 10 hours of treatment (data not shown); however, after treatment for 14 hours, we observed a moderate increase in TNF-
. For instance, TNF-
levels were 0.064±0.051, 0.136±0.054, and 3.153±1.18 ng/mL in control and 1- and 5-µmol/L pitavastatintreated samples, respectively (significantly different from control at P<0.05). Greater increases in TNF-
levels were observed with longer treatments of cells, and the induction was concentration-dependent (data not shown). We also observed that pitavastatin failed to block LPS-induced TNF-
production (data not shown). We believe that these data suggest that induction of macrophage SR-BI expression by pitavastatin is not through its effect on macrophage TNF-
production. Compared with the rapid increase in SR-BI expression, pitavastatin increased TNF-
at a very slow rate. This action does not negatively affect SR-BI induction, because we observed that pitavastatin significantly blocked the inhibition of SR-BI expression by TNF-
and LPS. These data also suggest the existence of other mechanism(s) by which pitavastatin can induce SR-BI expression.
NF-
B is a transcriptional factor that regulates many genes, including proinflammatory cytokines.30 Our data showing that NF-
B inhibitors restore macrophage SR-BI expression that is initially inhibited by LPS or TNF-
(Figure 5) imply that NF-
B might be involved in the induction of SR-BI expression by pitavastatin. Indeed, we observed that pitavastatin functioned as an NF-
B inhibitor to restore SR-BI expression that was initially inhibited by LPS or TNF-
(Figure 6). Statins have been reported to reduce NF-
B activity in several cell types.31,32 We consistently detected that pitavastatin inhibited NF-
B activity in macrophages and that this inhibitory action was because of increased I
B-
expression and decreased NF-
B p65 expression (Figure 7). We interpret our results to indicate that the impact of pitavastatin on NF-
B activity may play a more important role in addition to its effects on cholesterol biosynthetic intermediates in its induction of macrophage SR-BI expression.
Finally, PPAR-
, a transcriptional factor in the regulation of fatty acid metabolism, diabetes, inflammation, and atherosclerosis,33 plays a critical role in the regulation of CD36 expression. However, its role in the regulation of SR-BI expression is controversial. Although some PPAR-
ligands have been reported to increase SR-BI expression34 and stimulate HMG-CoA reductase activity in macrophages,35 we have observed that most PPAR-
ligands do not have any effect on macrophage SR-BI expression. In contrast, we observed that ciglitazone can have strong inhibitory effects on macrophage SR-BI expression (unpublished observations). Previously, we reported that pitavastatin decreased macrophage PPAR-
expression at both the RNA and protein levels. This statin can increase mitogen-activated protein kinase activity and the level of phosphorylated PPAR-
, a negative regulator for its target genes.12 Therefore, we believe that the induction of macrophage SR-BI expression by pitavastatin does not occur primarily through PPAR-
but rather through cholesterol biosynthetic intermediates and NF-
B activity. These findings suggest additional pleiotropic effects of this during atherosclerotic foam cell development.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
2. Hill SA, McQueen MJ. Reverse cholesterol transport: a review of the process and its clinical implications. Clin Biochem. 1997; 30: 517525.[CrossRef][Medline] [Order article via Infotrieve]
3. Fidge NH. High density lipoprotein receptors, binding proteins, and ligands. J Lipid Res. 1999; 40: 187201.
4. Krieger M. Scavenger receptor class B type I is a multiligand HDL receptor that influences diverse physiologic systems. J Clin Invest. 2001; 108: 793797.[CrossRef][Medline] [Order article via Infotrieve]
5. Ji Y, Jian B, Wang N, Sun Y, de la Llera Moya M, Phillips MC, Rothblat GH, Swaney JB, Tall AR. Scavenger receptor BI promotes high density lipoprotein-mediated cellular cholesterol efflux. J Biol Chem. 1997; 272: 2098220985.
6. Temel RE, Trigatti B, DeMattos RB, Azhar S, Krieger M, Williams DL. Scavenger receptor class B, type I (SR-BI) is the major route for the delivery of high density lipoprotein cholesterol to the steroidogenic pathway in cultured mouse adrenocortical cells. Proc Natl Acad Sci U S A. 1997; 94: 1360013605.
7. Arai T, Wang N, Bezouevski M, Welch C, Tall AR. Decreased atherosclerosis in heterozygous low density lipoprotein receptor-deficient mice expressing the scavenger receptor BI transgene. J Biol Chem. 1999; 274: 23662371.
8. Braun A, Trigatti BL, Post MJ, Sato K, Simons M, Edelberg JM, Rosenberg RD, Schrenzel M, Krieger M. Loss of SR-BI expression leads to the early onset of occlusive atherosclerotic coronary artery disease, spontaneous myocardial infarctions, severe cardiac dysfunction, and premature death in apolipoprotein E-deficient mice. Circ Res. 2002; 90: 270276.
9. Sowers JR. Effects of statins on the vasculature: implications for aggressive lipid management in the cardiovascular metabolic syndrome. Am J Cardiol. 2003; 91: 14B22B.[CrossRef][Medline] [Order article via Infotrieve]
10. Liao JK. Beyond lipid lowering: the role of statins in vascular protection. Int J Cardiol. 2002; 86: 518.[CrossRef][Medline] [Order article via Infotrieve]
11. Noji Y, Higashikata T, Inazu A, Nohara A, Ueda K, Miyamoto S, Kajinami K, Takegoshi T, Koizumi J, Mabuchi H. Long-term treatment with pitavastatin (NK-104), a new HMG-CoA reductase inhibitor, of patients with heterozygous familial hypercholesterolemia. Atherosclerosis. 2002; 163: 157164.[CrossRef][Medline] [Order article via Infotrieve]
12. Han J, Zhou Y, Yokoyama T, Hajjar DP, Gotto AM Jr, Nicholson AC. Pitavastatin down-regulates expression of the macrophages type B scavenger receptor, CD36. Circulation. 2004; 109: 790796.
13. Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH, Krieger M. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor. Science. 1996; 271: 518520.[Abstract]
14. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951; 193: 265275.
15. Han J, Nicholson AC, Zhou X, Feng J, Gotto AM Jr, Hajjar DP. Oxidized low density lipoprotein decreases macrophage expression of scavenger receptor B-I. J Biol Chem. 2001; 276: 1656716572.
16. Buechler C, Ritter M, Quoc CD, Agildere A, Schmitz G. Lipopolysaccharide inhibits the expression of the scavenger receptor Cla-1 in human monocytes and macrophages. Biochem Biophys Res Commun. 1999; 262: 251254.[CrossRef][Medline] [Order article via Infotrieve]
17. Tsuruoka H, Khovidhunkit W, Brown BE, Fluhr JW, Elias PM, Feingold KR. Scavenger receptor class B type I is expressed in cultured keratinocytes and epidermis: regulation in response to changes in cholesterol homeostasis and barrier requirements. J Biol Chem. 2002; 277: 29162922.
18. Sun Y, Wang N, Tall AR. Regulation of adrenal scavenger receptor-BI expression by ACTH and cellular cholesterol pools. J Lipid Res. 1999; 40: 17991805.
19. Patel DD, Knight BL. The effect of mevalonate on 3-hydroxy-3-methylglutaryl-CoA reductase activity and the absolute rate of cholesterol biosynthesis in human monocyte-derived macrophages. Eur J Biochem. 1985; 153: 117123.[Medline] [Order article via Infotrieve]
20. Pahan K, Sheikh FG, Namboodiri AM, Singh I. Lovastatin and phenylacetate inhibit the induction of nitric oxide synthase and cytokines in rat primary astrocytes, microglia, and macrophages. J Clin Invest. 1997; 100: 26712679.[Medline] [Order article via Infotrieve]
21. Sora MK, Kruszewski AA, Stoklosa T, Czyzyk J, Lasek W, Malejczyk J, Jakobisiak M. Synergistic antiproliferative activity of tumor necrosis factor
(TNF-
) and lovastatin. Arch Immunol Ther Exp. 1994; 42: 269274.
22. Feleszko W, Balkowiec EZ, Sieberth E, Marczak M, Dabrowska A, Giermasz A, Czajka A, Jakóbisiak M. Lovastatin and tumor necrosis factor-
exhibit potentiated antitumor effects against Ha-ras-transformed murine tumor via inhibition of tumor-induced angiogenesis. Int J Cancer. 1999; 81: 560567.[CrossRef][Medline]
[Order article via Infotrieve]
23. Schmidt A, Goepfert C, Feitsma K, Buddecke E. Lovastatin-stimulated superinduction of E-selectin, ICAM-1 and VCAM-1 in TNF-
activated human vascular endothelial cells. Atherosclerosis. 2002; 164: 5764.[CrossRef][Medline]
[Order article via Infotrieve]
24. Youssef S, Stüve O, Patarroyo JC, Ruiz PJ, Radosevich JL, Hur RM, Bravo M, Mitchell DJ, Sobel RA, Steinman L, Zamvil SS. The HMG-CoA reductase inhibitor, atorvastatin, promotes a Th2 bias and reverses paralysis in central nervous system autoimmune disease. Nature. 2002; 420: 7884.[CrossRef][Medline] [Order article via Infotrieve]
25. Lopez S, Peiretti F, Bonardo B, Deprez-Beauclair P, Laouenan H, Juhan-Vague I, Nalbone G. Effect of atorvastatin on plasminogen activator inhibitor type-1 synthesis in human monocytes/macrophages. J Cardiovasc Pharmacol. 2001; 37: 762768.[CrossRef][Medline] [Order article via Infotrieve]
26. Mohrschladt MF, Weverling-Rijnsburger AWE, de Man FHAF, Stoeken DJ, Sturk A, Smelt AHM, Westendorp RGJ. Hyperlipoproteinemia affects cytokine production in whole blood samples ex vivo: the influence of lipid-lowering therapy. Atherosclerosis. 2000; 148: 413419.[CrossRef][Medline] [Order article via Infotrieve]
27. Kleemann R, Princen HM, Emeis JJ, Jukema JW, Fontijn RD, Horrevoets AJG, Kooistra T, Havekes LM. Rosuvastatin reduces atherosclerosis development beyond and independent of its plasma cholesterol-lowering effect in APOE*3-Leiden transgenic mice: evidence for anti-inflammatory effects of rosuvastatin. Circulation. 2003; 108: 13681374.
28. Kothe H, Dalhoff K, Rupp J, Müller A, Kreuzer J, Maass M, Katus HA. Hydroxymethylglutaryl coenzyme A reductase inhibitors modify the inflammatory response of human macrophages and endothelial cells infected with Chlamydia pneumoniae. Circulation. 2000; 101: 17601763.
29. Kiener PA, Davis PM, Murray JL, Youssef S, Rankin BM, Kowala M. Stimulation of inflammatory responses in vitro and in vivo by lipophilic HMG-CoA reductase inhibitors. Int Immunopharmacol. 2001; 1: 105118.[CrossRef][Medline] [Order article via Infotrieve]
30. Tak PP, Firestein GS. NF-
B: a key role in inflammatory diseases. J Clin Invest. 2001; 107: 711.[CrossRef][Medline]
[Order article via Infotrieve]
31. Dichtl W, Dulak J, Frick M, Alber HF, Schwarzacher SP, Ares MPS, Nilsson J, Pachinger O, Weidinger F. HMG-CoA reductase inhibitors regulate inflammatory transcription factors in human endothelial and vascular smooth muscle cells. Arterioscler Thromb Vasc Biol. 2003; 23: 5863.
32. Ortego M, Bustos C, Hernández-Presa MA, Tuñón J, Díaz C, Hernández G, Egido J. Atorvastatin reduces NF-
B activation and chemokine expression in vascular smooth muscle cells and mononuclear cells. Atherosclerosis. 1999; 147: 253261.[CrossRef][Medline]
[Order article via Infotrieve]
33. Willson TM, Lambert MH, Kliewer SA. Peroxisome proliferator-activated receptor
and metabolic disease. Annu Rev Biochem. 2001; 70: 341367.[CrossRef][Medline]
[Order article via Infotrieve]
34. Chinetti G, Gbaguidi FG, Griglio S, Mallat Z, Antonucci M, Poulain P, Chapman J, Fruchart JC, Tedgui A, Najib-Fruchart J, Staels B. CLA-1/SR-BI is expressed in atherosclerotic lesion macrophages and regulated by activators of peroxisome proliferator-activated receptors. Circulation. 2000; 101: 24112417.
35. Iida KT, Kawakami Y, Suzuki H, Sone H, Shimano H, Toyoshima H, Okuda Y, Yamada M. PPAR
ligands, troglitazone and pioglitazone, up-regulate expression of HMG-CoA synthase and HMG-CoA reductase gene in THP-1 macrophages. FEBS Lett. 2002; 520: 177181.[CrossRef][Medline]
[Order article via Infotrieve]
This article has been cited by other articles:
![]() |
X. Zhou, W. He, Z. Huang, A. M. Gotto Jr., D. P. Hajjar, and J. Han Genetic Deletion of Low Density Lipoprotein Receptor Impairs Sterol-induced Mouse Macrophage ABCA1 Expression: A NEW SREBP1-DEPENDENT MECHANISM J. Biol. Chem., January 25, 2008; 283(4): 2129 - 2138. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tsuchiya, T. Yoshimoto, Y. Hirono, T. Tateno, T. Sugiyama, and Y. Hirata Angiotensin II induces monocyte chemoattractant protein-1 expression via a nuclear factor-{kappa}B-dependent pathway in rat preadipocytes Am J Physiol Endocrinol Metab, October 1, 2006; 291(4): E771 - E778. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Argmann, J. Y. Edwards, C. G. Sawyez, C. H. O'Neil, R. A. Hegele, J. G. Pickering, and M. W. Huff Regulation of Macrophage Cholesterol Efflux through Hydroxymethylglutaryl-CoA Reductase Inhibition: A ROLE FOR RhoA IN ABCA1-MEDIATED CHOLESTEROL EFFLUX J. Biol. Chem., June 10, 2005; 280(23): 22212 - 22221. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2004 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |