Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2004;110:3360-3366
Published online before print November 15, 2004, doi: 10.1161/01.CIR.0000147775.50954.AA
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
110/21/3360    most recent
01.CIR.0000147775.50954.AAv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hui, Y.
Right arrow Articles by Funk, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hui, Y.
Right arrow Articles by Funk, C. D.
Related Collections
Right arrow Animal models of human disease
Right arrow Endothelium/vascular type/nitric oxide
Right arrow Other Vascular biology
Right arrowRelated Article

(Circulation. 2004;110:3360-3366.)
© 2004 American Heart Association, Inc.


Vascular Medicine

Directed Vascular Expression of Human Cysteinyl Leukotriene 2 Receptor Modulates Endothelial Permeability and Systemic Blood Pressure

Yiqun Hui, MD, PhD; Yan Cheng, MD, PhD; Isabella Smalera, MS; Wenying Jian, MS; Lawrence Goldhahn, BS; Garret A. FitzGerald, MD; Colin D. Funk, PhD

From the Center for Experimental Therapeutics and Department of Pharmacology (Y.H., Y.C., W.J., L.G., G.A.F., C.D.F.), University of Pennsylvania, Philadelphia, Pa; Merck Research Laboratories, Department of Cardiovascular Diseases, Rahway, NJ (I.S.); and the Departments of Physiology and Biochemistry, Queen’s University, Kingston, Ontario, Canada (C.D.F.).

Correspondence to Colin D. Funk, PhD, Department of Physiology, Queen’s University, Kingston, ON K7L 3N6 Canada. E-mail funkc{at}post.queensu.ca

Received May 14, 2004; revision received August 9, 2004; accepted August 23, 2004.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— The proinflammatory and vascular actions of cysteinyl leukotrienes (CysLTs) are mediated by 2 receptors: cysteinyl leukotriene 1 receptor (CysLT1R) and cysteinyl leukotriene 2 receptor (CysLT2R). However, the distinct contribution of CysLT2R to the vascular actions of CysLTs has not been addressed.

Methods and Results— We generated an endothelial cell–specific human CysLT2R (EC-hCysLT2R) transgenic (TG) mouse model using the Tie2 promoter/enhancer. Strong expression of hCysLT2R in TG lung and endothelial cells, detected by real-time polymerase chain reaction, markedly enhanced CysLT-stimulated intracellular calcium mobilization compared with endogenous expression in cells from nontransgenic mice. The permeability response to exogenous LTC4 and to endogenous CysLTs evoked by passive cutaneous anaphylaxis was augmented in TG mice. The rapid, systemic pressor response to intravenous LTC4 was also diminished in TG mice coincidentally with augmented production of nitric oxide.

Conclusions— The development of EC-hCysLT2R mice has permitted detection of distinct vascular effects of CysLTs, which can be mediated via the CysLT2R in vivo.


Key Words: leukotrienes • receptors • endothelium • edema • blood pressure


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cysteinyl leukotrienes (CysLTs), leukotriene C4 (LTC4), leukotriene D4 (LTD4), and leukotriene E4 (LTE4), have been well established as inflammatory mediators since their discovery 25 years ago.1 Their major effects include smooth muscle constriction, enhancement of vascular permeability, promotion of mucus secretion, and eosinophil recruitment,2 all characteristic signs of allergic asthma. CysLTs mediate their actions via 2 receptors: the cysteinyl leukotriene 1 receptor (CysLT1R) and the cysteinyl leukotriene 2 receptor (CysLT2R).3,4 Selective CysLT1R antagonists have been developed that block the majority of CysLT effects in asthmatic airways and are commonly used in the treatment of asthma and allergic rhinitis.5,6 The absence of CysLT2R-selective antagonists and appropriate animal models has contributed to our lack of understanding of the functional roles of this receptor subtype.

Both human and mouse CysLT1R7–10 and CysLT2R11–15 genes were cloned in recent years and transiently expressed in heterologous systems. They belong to a subfamily of G protein–coupled receptors with 30 to 40% homology between the receptor subtypes. The rank order agonist affinities are as follows: LTD4>LTC4>LTE4 for CysLT1R and LTC4= LTD4>LTE4 for CysLT2R. CysLT1R couples to Gq/11 and/or Gi/o in various cell types, whereas CysLT2R couples to Gq and activation elicits intracellular calcium mobilization. CysLT1R is expressed primarily in bronchial smooth muscle cells; peripheral blood leukocytes, including eosinophils and monocytes; and mast cells, as reflected by mRNA and immunoreactivity analyses. CysLT2R, surprisingly, exhibits high expression in heart and coronary vessels and a diffuse pattern in brain, with expression also detected in adrenal gland, eosinophils, monocytes, and mast cells. The contrasting patterns of receptor expression imply distinct functions for CysLT receptors.

Evidence for at least 2 CysLT receptor subtypes in pulmonary vasculature, in both smooth muscle cells and endothelium, has been presented on the basis of pharmacological studies.16,17 Cultured human coronary endothelial cells (ECs)18 and human umbilical vein ECs express CysLT2R but lack CysLT1R.19,20 CysLTs can induce surface expression of P-selectin in human umbilical vein ECs21,22 that is not blocked by CysLT1R antagonists.22 Moreover, CysLT receptors on human pulmonary vessel endothelium mediate relaxation that is not modified by CysLT1R antagonists.16 These data are consistent with the existence of a functionally important CysLT2R on ECs. Both CysLT1R-knockout mice23 and mice in which the human CysLT1R is overexpressed in airway and vascular smooth muscle24 have been generated. However, no models are extant in which expression of CysLT2R has been manipulated. We have generated mice in which the human CysLT2R is overexpressed in ECs and report effects on endothelial integrity and blood pressure (BP) regulation mediated by this receptor subtype in vivo.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Generation of EC-Specific Human CysLT2R Transgenic Mice
EC-specific expression was achieved via the Tie2 promoter/enhancer (gift from Dr. T. Sato, University of Texas Southwestern Medical Center, Dallas, Tex). A 2.1-kb Tie2 promoter fragment was subcloned into pBluescript SK+ flanked by the hCysLT2R coding region, SV40 polyadenylation signal sequence, and the 10.1-kb complete Tie2 enhancer sequence. A 13.5-kb fragment was released from the vector by SalI digestion, purified by Elutip-D columns (Schleicher & Schuell BioScience), and microinjected into the pronuclei of fertilized zygotes from C57BL/6xSJL F1 mice (obtained from Jackson Laboratory, Bar Harbor, Me). Injections were performed at the University of Pennsylvania Transgenic and Chimeric Mouse Facility. Founders and their hemizygous transgene-positive progeny were genotyped by polymerase chain reaction (PCR) using hCysLT2R specific primers (forward, 5'-TGCTCCTGGACAGTGGCTCTGAG-3'; reverse, 5'-GCTCCTTATACTCTTGTTTCCTTTCTCAACC-3') or by Southern blot analysis with a [32P]-labeled hCysLT2R-specific probe and were backcrossed with C57BL/6 mice. Littermates of a common genetic background between the ages of 10 to 14 weeks were used for all in vivo studies under anesthesia (ketamine 100 mg/kg, acepromazine 3 mg/kg). Animal protocols were approved by the Animal Care and Use Committee at the University of Pennsylvania.

Transgene Integration Detection by Inverse PCR
Csp6I cut genomic DNA (150 ng) was self-circularized with T4 ligase (2 Weiss units) at 16°C for 16 hours and used for first-round PCR with forward ACACGTCTAACCTCAGCATCTGG and reverse ACTATGAAGCCAGGAGTGGTGC primers within the Tie2 promoter. The mixture (1:1000) was subjected to nested PCR using AGGAGGGCGGGTGGTTG and GGGAATGGATTAAGAGTTCAAGGTC primers. The nested PCR products were gel-purified, cloned into pCR2.1-TOPO vector, and sequenced.

PCR Analyses
For reverse transcription (RT)-PCR, total RNA (2 µg) prepared with RNeasy Mini Kit (Qiagen), treated with DNaseI, was reverse transcribed with the SuperScript First-Strand Synthesis System (Invitrogen), and PCR was performed with the hCysLT2R primers mentioned above. For real-time assays, cDNA was prepared with TaqMan transcription reagents, and PCR reactions were prepared in SYBR Green PCR Master Mix. DNA targets were amplified and analyzed with an ABI Prism 7000 Sequence Detection System (Applied Biosystems). Mouse GAPDH (CATGGCCTTCCGTGTTCCTA; ATGCCTGCTTCACCACCTTCT), mouse CysLT1R (GCAAGTGGCTCTTTGGTGACT; AAGATGCTACAATAGAGGTTAACGTACAA), mouse CysLT2R (CATGTGTATGCCTGATGTCTACCA; CATTTGCCGTACCCAGTCTCA), and human CysLT2R (TGCAACCATCCATCTCCGTAT; TGTGCAGTTCCTGCTGTTGTTAT) were amplified. The mCysLT1R, mCysLT2R, and hCysLT2R mRNA levels were normalized to GAPDH. No significant differences in GAPDH levels were detected between different samples when the same amount of total RNA was used (data not shown).

Isolation of Murine Primary Lung ECs
Lung ECs (LECs) were prepared from 4- to 8-week-old mice.25 Immunofluorescence analyses were performed as described previously,26 using rabbit anti-human CD 62P polyclonal antibody (1 µg/mL; Becton Dickinson). The uptake of acetylated LDL-DiI complex (DiI-Ac-LDL, Molecular Probes) was used to characterize the ECs.

Isolation of Murine Primary Aortic Smooth Muscle Cells
Mouse aorta strips with the intima scraped off were cultured under a glass cover slide in DMEM/F-12 medium containing 20% FBS, 0.5% penicillin-streptomycin, and 1% L-glutamine. The cover slide and aorta were removed after 10 days, and smooth muscle cells were characterized by anti–{alpha}-smooth muscle actin–FITC conjugate (Sigma) staining.

Intracellular Calcium Mobilization
LECs (passage 5) from transgenic (TG) and nontransgenic (NTG) mice were seeded in a 384-well clear black plate at a density of 10 000 cells/well in a volume of 25 µL and allowed to adhere overnight. Cells were loaded with 25 µL Calcium 3 No Wash Dye (Molecular Devices) supplemented with probenecid and incubated at 37°C, 5% CO2, for 1 hour, followed by LT/vehicle addition. Calcium fluorescent signals were monitored for 5 minutes by a Fluorometric Imaging Plate Reader (FLIPR, Molecular Devices) and corrected with background readings from adjacent wells.

Vascular Ear Permeability Assay
Anesthetized mice received 200 µL of 2% Evans blue dye in PBS injected via the tail vein. Immediately thereafter, the right ear was injected intradermally with LTC4 (Cayman Chemical Co) in 10 µL saline containing either 0.1% or 0.5% ethanol vehicle, whereas the left ear was injected with vehicle. Animals were euthanized after 15 minutes by CO2 inhalation. A 6-mm ear biopsy (Acu-Punch, Acuderm Inc) was soaked in formamide (750 µL) overnight at 55°C, and extracted Evans blue dye was measured by absorbance at 610 nm with a Beckman DU-600 spectrophotometer.

Passive Cutaneous Anaphylaxis Assay
Anesthetized mice received intradermal injections of 40 ng monoclonal anti-dinitrophenyl IgE in 20 µL saline in the right ear and 20 µL saline in the left ear. After 24 hours, animals were administered dinitrophenyl–human serum albumin (200 µg) in 200 µL 1% Evans blue dye (in PBS) via the tail vein, and 30 minutes later, ear tissues were analyzed for dye leakage as described above.

Mean Arterial BP Measurements
The right internal jugular vein and left carotid artery of anesthetized mice were cannulated with PE-10 tubing. The arterial catheter was connected to a Capto SP844 pressure transducer, and BP was monitored continuously with a PowerLab/8SP system. Mice were injected via the right internal jugular vein with LTC4 (0.3, 1, or 3 µg/kg in 4 mL/kg saline). The same volume of saline was injected before LTC4 administration to exclude volume-mediated BP changes.

Measurement of Plasma Nitric Oxide Metabolites
Mice were injected with 1 µg/kg of LTC4 (0.25 µg/mL in saline) via the tail vein, and blood (100 µL) was drawn from the saphenous vein with a Microvette 200 LH (Sarstedt) at times 0, 5 minutes, and 30 minutes after LTC4 injection. Plasma total nitrate/nitrite was measured with a fluorometric assay kit (Cayman Chemical Co) according to the manufacturer’s instructions.

Statistics
Analyses were performed by Student’s t test or 1-way ANOVA using Graph Pad Prism software. A value of P<0.05 was considered significant. Data are presented as mean±SEM.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Identification of EC-hCysLT2R TG Mice
The Tie2 promoter and complete enhancer27 were used to achieve EC-specific expression of hCysLT2R (Figure 1A). Four founder mice (mice 3, 4, 10, and 15) were identified from a total of 21 screened offspring. One female died during delivery, and 2 other founder lines were excluded from additional studies because of mosaicism and low-level hCysLT2R expression, similar to endogenous mCysLT2R mRNA levels. Mice from founder line 4 exhibited high-level hCysLT2R expression (see below), and hemizygous mice from this line were used for all subsequent studies. Transgene copy number analysis indicated {approx}7 copies integrated into the mouse genome in a head-to-tail orientation (Figure 1B) at chromosome 6 B1 region (34 557 689 bp) (Figure 1C) within a gene-sparse region. The closest gene, bisphosphoglycerate mutase, is 109 kb distant at proximal location 34 419 267 to 34 448 521 bp. The integration of the transgene did not physically disrupt any genes and would not be expected to exert any nonspecific integration effects.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. Generation of EC-specific hCysLT2R TG mice. A, TG construct. B, Southern blot to assess transgene copies. Titrated amounts of TG plasmid were mixed with NTG genomic DNA to construct a standard curve. Genomic DNAs from TG and NTG mice were digested with XbaI and hybridized with [32P]hCysLT2R probe. C, Transgene incorporation in chromosome 6 B1 region. Open arrows show copy number and orientation of transgene.

hCysLT2R Expression in TG Mice
Expression of hCysLT2R mRNA in lung tissue of TG mice was subjected to real-time PCR analyses and found to be 200-fold higher than endogenous mCysLT2R levels. Expression of mCysLT2R in TG mice did not change relative to NTG mice (Figure 2A). Northern blot analysis detected a strong 2-kb band transcript in TG but not NTG lung (Figure 2B). hCysLT2R mRNA in TG liver was not detected but may have been masked by the abundance of hepatocyte mRNA.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 2. Human CysLT2R transgene expression. A, hCysLT2R expression in TG lung detected by real-time PCR and compared with mCysLT2R expression in both TG and NTG lungs. B, Northern blot detection of a {approx}2-kb hCysLT2R transcript (bottom) in indicated tissues and cells. RNA loading is shown in top panel by 28S and 18S bands. C, hCysLT2R specific expression in TG LECs. Primary LECs were stained for P-selectin (a, x40) and DiI-Ac-LDL uptake (c, x20); primary ASMCs were stained for {alpha}-actin (d, x40) and also P-selectin (b, x40) as a negative control for ECs. Nuclei were stained blue with DAPI. hCysLT2R expression was detected by RT-PCR. RT–, controls without addition of reverse transcriptase were used to show no PCR contamination from multicopied transgene in genomic DNA. Presence of aorta (intima and media only) transcript and absence of ASMC transcript indicate EC-restricted expression. ASMC genomic DNA (gDNA) control was used to show presence of transgene.

LECs (99% positive for the endothelial cell–specific marker P-selectin staining and DiI-Ac-LDL uptake) and aortic smooth muscle cells (ASMCs; >90% positive for {alpha}-actin) were cultured and used to determine the specificity of transgene expression by RT-PCR. hCysLT2R expression was detected as a 532-bp band in TG lung, LECs, and aorta but not in ASMCs (Figure 2C). However, expression in cultured LECs was diminished compared with lung tissue (Figure 2B), possibly because of gene silencing by in vitro culture.

CysLTs Elicit Robust Intracellular Calcium Mobilization Responses in TG LECs
We determined whether intracellular calcium mobilization induced by CysLTs could be augmented in TG LECs through Gq to evaluate the functionality of EC-hCysLT2R. Whereas LECs from NTG mice showed a minimal response to 1 µmol/L LTC4 and LTD4, TG LECs responded to both agonists with a prominent calcium signal peak. Cells of both genotypes did not respond to LTE4 or LTB4 (Figure 3A). Figure 3B reveals the time course of the fluorescence signal induced by LTC4 and LTD4. LTD4 produced a small and transient signal in NTG LECs, whereas LTC4 produced a small but sustained response. The signal intensity in TG LECs by LTC4/LTD4 was of much greater magnitude than in NTG LECs and was sustained during the recording period (3 minutes) for LTC4 but returned to baseline within 70 seconds with LTD4 stimulation.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 3. CysLTs induce stronger intracellular calcium mobilization responses in TG LECs than in NTG LECs. Calcium responses were measured by fluorescence assay as described in Methods. A, Fluorescence peak produced on compound (1 µmol/L each) addition is presented as mean±SEM (n=4 to 6) and analyzed by 1-way ANOVA. ***P<0.0001. B, Time course of fluorescence signal induced by LTC4 and LTD4. LT addition is indicated by arrow.

EC-hCysLT2R TG Mice Exhibit Enhanced Vascular Permeability in Response to CysLTs
We investigated the role of CysLT2R in mediating vascular permeability changes as measured by Evans blue dye extravasation. Exogenous LTC4 administration elicited an increase in vascular permeability in both NTG and TG mice within 15 minutes. Whereas the permeability change in NTG mice was small, the response in TG mice was potentiated by {approx}90% (n=7 to 8; P<0.05) and {approx}5-fold (n=11 to 12; P<0.0001) in response to 1 and 5 ng LTC4, respectively (Figure 4A). Dye extravasation caused by CysLTs produced endogenously by activated mast cells in passive cutaneous anaphylaxis was augmented by {approx}80% (n=7 to 9; P<0.05) in TG mice compared with NTG littermates 30 minutes after antigen challenge (Figure 4B). Expression of hCysLT2R in the TG ear vascular bed was verified by real-time PCR (Figure 4C). Neither mCysLT1R nor mCysLT2R endogenous expression levels were changed in TG ears. These results indicate that CysLT2R can mediate CysLT-induced permeability changes.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 4. EC-hCysLT2R TG mice exhibit enhanced vascular permeability responses as measured by Evans blue dye extravasation. Vascular permeability change was calculated as difference in absorbance at 610 nm between right (LTC4 or IgE-treated) and left (vehicle-treated) ears. Values are presented as mean±SEM and analyzed by unpaired Student’s t test. A, Dye leakage induced by exogenous LTC4 1 (n=7 to 8) or 5 (n=11 to 12) ng measured at 15 minutes. Right, Representative result from littermates after LTC4 5 ng injection. B, Passive cutaneous anaphylaxis assay to measure endogenous CysLT-generated vascular permeability at 30 minutes (n=7 to 9). C, CysLT receptor expression in ear tissue measured by real-time PCR.

LTC4-Induced Systemic Pressor Effect in NTG Mice Is Diminished in EC-hCysLT2R TG Mice
Mean arterial pressure (MAP) was monitored continuously in anesthetized mice. Baseline MAP did not differ between NTG and TG mice (data not shown). LTC4 administered systemically caused an immediate rise in MAP that gradually fell to baseline within 3 to 15 minutes in NTG mice (Figure 5A, top, and B). Average MAP increased 15%, 20%, and 23% on 0.3 µg/kg, 1 µg/kg, and 3 µg/kg LTC4 infusion, respectively. Although the overall BP response followed a similar time course in TG littermates, MAP changed significantly compared with the NTG controls (+7%, n=5 to 6, P<0.05; –8%, n=6 to 8, P<0.005; and +4%, n=5, P<0.001) at the respective LTC4 infusion concentrations (Figure 5A, bottom, and B).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 5. LTC4-induced systemic pressor effect observed in NTG mice is diminished in EC-hCysLT2R TG mice. Mean arterial BP was monitored in mice by a pressure transducer connected to a catheter in left carotid artery. NTG and TG mice received a bolus injection of LTC4 0.3 (n=5 or 6), 1 (n=6 or 8), or 3 (n=5) µg/kg. A, Representative BP tracing from NTG and TG littermates on 1 µg/kg LTC4 systemic administration. Infusion of LTC4 is marked by bars. Baseline BP is readout before injection. BP change is difference between peak/trough after injection and baseline. B, BP percentage change after LTC4 administration compared with baseline in NTG and TG littermates. Values are presented as mean±SEM and analyzed by unpaired Student’s t test, respectively. *P<0.05, **P<0.005, ***P<0.001.

Plasma NO Metabolites Are Increased in EC-hCysLT2R TG Mice
The response of plasma NO metabolites to LTC4 1 µg/kg systemic infusion was evaluated. Baseline levels did not differ between NTG and TG mice (data not shown). Total nitrate/nitrite increased marginally after LTC4 injection and remained stable at this level for at least 30 minutes in NTG mice. The increase in these metabolites was significantly potentiated in plasma obtained from TG mice (n=8; P<0.05; Figure 6).



View larger version (11K):
[in this window]
[in a new window]
 
Figure 6. LTC4 induces enhanced NO release in EC-hCysLT2R TG mice. Blood (100 µL) from NTG and TG mice was drawn from saphenous vein before (baseline) and 5 minutes and 30 minutes after LTC4 (1 µg/kg in saline) tail-vein injection. Plasma level of nitrate/nitrite (NOx) was measured by fluorometric assay. Results are presented as percentage change of NOx after LTC4 administration compared with baseline. Values are presented as mean+SEM (n=8) and analyzed by unpaired Student’s t test at each time point.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
We have established the first TG animal model designed to study CysLT2R function. We confirmed increased endothelial expression of the hCysLT2R transcript in TG mice and the functionality of this receptor by measuring CysLT-induced calcium mobilization. The only available pharmacological antagonist for CysLT2R, BAY u9773, also weakly antagonizes the CysLT1R and acts as a partial agonist at the CysLT2R.28 These properties have precluded its use in defining in vivo CysLT2R functions.

Increased vascular permeability is a feature of inflammation. CysLTs induce a rapid dose-dependent plasma extravasation from postcapillary venules, 1000 times more potent than histamine,29 which can be inhibited by CysLT1R antagonists.30 Moreover, CysLT1R-deficient mice display decreased plasma leakage in passive cutaneous anaphylaxis,23 indicating that CysLT1R is the major mediator of CysLT action in this process. However, BAY u9773 is more efficient than a CysLT1R antagonist in reducing edema in a guinea pig brain perfusion assay in vitro,31 raising the possibility of a contribution from the CysLT2R. The results of our studies in EC-hCysLT2R mice are consistent with this hypothesis, because permeability in the ear vasculature was augmented in TG mice. Indeed, this response may be dominantly transduced via the CysLT2R in heart and brain, where this receptor subtype predominates. Histamine and many other G protein–coupled receptors that couple to Gq induce the loss of endothelial barrier function through a calcium-dependent pathway, leading to junctional disassembly,32 a pathway that may be in operation in EC-hCysLT2R mice.

CysLTs evoke contradictory effects on vascular tone, depending on the species and the experimental preparations,33 with both endothelium- and smooth muscle–dependent effects. Although the endothelium usually contributes to CysLT-mediated relaxation and smooth muscle to direct contractile responses, the resolution of these actions as a change in BP has been difficult to predict. For instance, intravenous injection of LTD4 exerts a pressor effect in conscious rats,34 whereas both LTC4 and LTD4 decrease arterial pressure in anesthetized guinea pigs. However, high doses of the CysLTs paradoxically increase BP for a period of time, followed by transient hypotension in unanesthetized guinea pigs.35 The effects of CysLTs on vascular tone and BP have not been examined previously in mice. We found that LTC4 increased MAP in NTG mice in a dose-dependent manner. However, this pressor effect was significantly reduced or even paradoxically reversed (LTC4 1 µg/kg) in EC-hCysLT2R mice, substantiating an apparent relaxant role for endothelial CysLT2R in BP regulation during inflammation or anaphylaxis. The BP response in TG mice failed to reveal dose dependency, further suggesting the complex nature in CysLT-mediated vascular tone regulation. Wild-type mice express both CysLT1R and CysLT2R in cultured LECs and ASMCs at comparable levels (data not shown). Although Brink et al36 summarized pharmacological characterization of CysLT receptors in different vascular preparations, the limitations of currently available pharmacological probes constrain predictions of receptor subtype–specific vascular responses to CysLTs in vivo.

Mechanisms for endothelium-mediated CysLT-generated vasodilation appear to involve NO and/or prostacyclin synthesis. NO release may be more important in human and porcine pulmonary veins16,37 and canine splanchnic vein,38 whereas prostacyclin may be the major mediator for human pulmonary artery dilation.17 Thus, CysLT receptors may couple to different signaling pathways in ECs in a vascular bed–specific manner, leading to decreased peripheral resistance and/or decreased venous return and cardiac output. We speculate that these pathways might account for the systemic hypotensive effect generated by overexpressed hCysLT2R on endothelium.

Our observation that NO metabolites increase marginally in NTG mice and to a much greater extent in EC-hCysLT2R mice in response to LTC4 corroborates previous studies showing NO involvement in CysLT responses in various vascular preparations. Endothelial NO synthase activation is calcium dependent,39 which is consistent with hCysLT2R function to elevate cellular calcium through Gq. However, BP responses to LTC4 were immediate and returned to baseline within 15 minutes, in contrast to NO metabolite levels in TG mice, which increased steadily over a 30-minute period. Because NO and related nitrogen oxides interact with a large array of molecules and shuttle between tissues, plasma, and red blood cells,40 the time needed for NO metabolites to "equilibrate" between different compartments in vivo might be longer than the effective duration of NO produced during LTC4 stimulation. NO might also be formed in TG mice for purposes other than vascular tone regulation.

In summary, we demonstrate that EC-hCysLT2R mice have augmented vascular permeability and reduced pressor responses to CysLTs. This mouse model may mimic pathophysiological settings in which endothelial CysLT2R can be induced, for example, by cytokines.19 Endothelial CysLT2R may exacerbate inflammation by increasing vascular permeability and possibly by recruiting more neutrophils through enhanced P-selectin expression. It may participate in severe hypotensive responses in life-threatening anaphylaxis. Moreover, augmented CysLT2R-dependent NO formation could interact with superoxide to form peroxynitrite in settings in which vascular inflammation coincides with increased oxidant stress, such as in atherosclerosis and ischemia-reperfusion injury.40 Manipulated expression of the CysLT2R in vivo is likely to reveal further the importance of this potential drug target in cardiovascular biology.


*    Acknowledgments
 
This study was supported by NIH grant HL-58464 and Canadian Institutes of Health Research grant MOP68930 (to Dr Funk) and HL-62250 (to Dr FitzGerald). Dr Funk holds a Canada Research Chair in Molecular, Cellular, and Physiological Medicine. We thank Dr Thomas N. Sato for kindly providing us with plasmids containing the mouse Tie2 promoter and enhancer, Dr Jean Richa at the University of Pennsylvania Transgenic and Chimeric Mouse Facility for generation of transgenic founders, and Drs Jisong Cui and Annie Zhao for support with the calcium assays.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Murphy RC, Hammarstrom S, Samuelsson B. Leukotriene C: a slow-reacting substance from murine mastocytoma cells. Proc Natl Acad Sci U S A. 1979; 76: 4275–4279.[Abstract/Free Full Text]

2. Samuelsson B. Leukotrienes: mediators of immediate hypersensitivity reactions and inflammation. Science. 1983; 220: 568–575.[Abstract/Free Full Text]

3. Coleman RA, Eglen RM, Jones RL, et al. Prostanoid and leukotriene receptors: a progress report from the IUPHAR working parties on classification and nomenclature. Adv Prostaglandin Thromboxane Leukot Res. 1995; 23: 283–285.[Medline] [Order article via Infotrieve]

4. Hui Y, Funk CD. Cysteinyl leukotriene receptors. Biochem Pharmacol. 2002; 64: 1549–1557.[CrossRef][Medline] [Order article via Infotrieve]

5. Drazen JM, Israel E, O’Byrne PM. Treatment of asthma with drugs modifying the leukotriene pathway. N Engl J Med. 1999; 340: 197–206.[Free Full Text]

6. Grayson MH, Korenblat PE. The emerging role of leukotriene modifiers in allergic rhinitis. Am J Respir Med. 2003; 2: 441–450.[Medline] [Order article via Infotrieve]

7. Lynch KR, O’Neill GP, Liu Q, et al. Characterization of the human cysteinyl leukotriene CysLT1 receptor. Nature. 1999; 399: 789–793.[CrossRef][Medline] [Order article via Infotrieve]

8. Sarau HM, Ames RS, Chambers J, et al. Identification, molecular cloning, expression, and characterization of a cysteinyl leukotriene receptor. Mol Pharmacol. 1999; 56: 657–663.[Abstract/Free Full Text]

9. Maekawa A, Kanaoka Y, Lam BK, et al. Identification in mice of two isoforms of the cysteinyl leukotriene 1 receptor that result from alternative splicing. Proc Natl Acad Sci U S A. 2001; 98: 2256–2261.[Abstract/Free Full Text]

10. Martin V, Sawyer N, Stocco R, et al. Molecular cloning and functional characterization of murine cysteinyl-leukotriene 1 (CysLT(1)) receptors. Biochem Pharmacol. 2001; 62: 1193–1200.[CrossRef][Medline] [Order article via Infotrieve]

11. Heise CE, O’Dowd BF, Figueroa DJ, et al. Characterization of the human cysteinyl leukotriene 2 receptor. J Biol Chem. 2000; 275: 30531–30536.[Abstract/Free Full Text]

12. Takasaki J, Kamohara M, Matsumoto M, et al. The molecular characterization and tissue distribution of the human cysteinyl leukotriene CysLT(2) receptor. Biochem Biophys Res Commun. 2000; 274: 316–322.[CrossRef][Medline] [Order article via Infotrieve]

13. Nothacker HP, Wang Z, Zhu Y, et al. Molecular cloning and characterization of a second human cysteinyl leukotriene receptor: discovery of a subtype selective agonist. Mol Pharmacol. 2000; 58: 1601–1608.[Medline] [Order article via Infotrieve]

14. Hui Y, Yang G, Galczenski H, et al. The murine cysteinyl leukotriene 2 (CysLT2) receptor: cDNA and genomic cloning, alternative splicing, and in vitro characterization. J Biol Chem. 2001; 276: 47489–47495.[Abstract/Free Full Text]

15. Ogasawara H, Ishii S, Yokomizo T, et al. Characterization of mouse cysteinyl leukotriene receptors mCysLT1 and mCysLT2: differential pharmacological properties and tissue distribution. J Biol Chem. 2002; 277: 18763–18768.[Abstract/Free Full Text]

16. Ortiz JL, Gorenne I, Cortijo J, et al. Leukotriene receptors on human pulmonary vascular endothelium. Br J Pharmacol. 1995; 115: 1382–1386.[Medline] [Order article via Infotrieve]

17. Back M, Norel X, Walch L, et al. Prostacyclin modulation of contractions of the human pulmonary artery by cysteinyl-leukotrienes. Eur J Pharmacol. 2000; 401: 389–395.[CrossRef][Medline] [Order article via Infotrieve]

18. Kamohara M, Takasaki J, Matsumoto M, et al. Functional characterization of cysteinyl leukotriene CysLT(2) receptor on human coronary artery smooth muscle cells. Biochem Biophys Res Commun. 2001; 287: 1088–1092.[CrossRef][Medline] [Order article via Infotrieve]

19. Lötzer K, Spanbroek R, Hildner M, et al. Differential leukotriene receptor expression and calcium responses in endothelial cells and macrophages indicate 5-lipoxygenase-dependent circuits of inflammation and atherogenesis. Arterioscler Thromb Vasc Biol. 2003; 23: e32–e36.[Abstract/Free Full Text]

20. Sjöstrom M, Johansson AS, Schröder O, et al. Dominant expression of the CysLT2 receptor accounts for calcium signaling by cysteinyl leukotrienes in human umbilical vein endothelial cells. Arterioscler Thromb Vasc Biol. 2003; 23: e37–e41.[Abstract/Free Full Text]

21. Datta YH, Romano M, Jacobson BC, et al. Peptido-leukotrienes are potent agonists of von Willebrand factor secretion and P-selectin surface expression in human umbilical vein endothelial cells. Circulation. 1995; 92: 3304–3311.[Abstract/Free Full Text]

22. Pedersen KE, Bochner BS, Undem BJ. Cysteinyl leukotrienes induce P-selectin expression in human endothelial cells via a non-CysLT1 receptor-mediated mechanism. J Pharmacol Exp Ther. 1997; 281: 655–662.[Abstract/Free Full Text]

23. Maekawa A, Austen KF, Kanaoka Y. Targeted gene disruption reveals the role of cysteinyl leukotriene 1 receptor in the enhanced vascular permeability of mice undergoing acute inflammatory responses. J Biol Chem. 2002; 277: 20820–20824.[Abstract/Free Full Text]

24. Yang G, Haczku A, Chen H, et al. Transgenic smooth muscle expression of the human CysLT1 receptor induces enhanced responsiveness of murine airways to leukotriene D4. Am J Physiol. 2004; 286: L992–L1001.

25. Lim YC, Garcia-Cardena G, Allport JR, et al. Heterogeneity of endothelial cells from different organ sites in T-cell subset recruitment. Am J Pathol. 2003; 162: 1591–1601.[Abstract/Free Full Text]

26. Chen XS, Zhang YY, Funk CD. Determinants of 5-lipoxygenase nuclear localization using green fluorescent protein/5-lipoxygenase fusion proteins. J Biol Chem. 1998; 273: 31237–31244.[Abstract/Free Full Text]

27. Schlaeger TM, Bartunkova S, Lawitts JA, et al. Uniform vascular-endothelial-cell-specific gene expression in both embryonic and adult transgenic mice. Proc Natl Acad Sci U S A. 1997; 94: 3058–3063.[Abstract/Free Full Text]

28. Labat C, Ortiz JL, Norel X, et al. A second cysteinyl leukotriene receptor in human lung. J Pharmacol Exp Ther. 1992; 263: 800–805.[Abstract/Free Full Text]

29. Dahlen SE, Bjork J, Hedqvist P, et al. Leukotrienes promote plasma leakage and leukocyte adhesion in postcapillary venules: in vivo effects with relevance to the acute inflammatory response. Proc Natl Acad Sci U S A. 1981; 78: 3887–3891.[Abstract/Free Full Text]

30. Bochnowicz S, Underwood DC. Dose-dependent mediation of leukotriene D4-induced airway microvascular leakage and bronchoconstriction in the guinea pig. Prostaglandins Leukot Essent Fatty Acids. 1995; 52: 403–411.[CrossRef][Medline] [Order article via Infotrieve]

31. Di Gennaro A, Carnini C, Buccellati C, et al. Cysteinyl-leukotriene receptor activation in brain inflammatory reactions and cerebral edema formation: a role for transcellular biosynthesis of cysteinyl leukotrienes. FASEB J. 2004; 18: 842–844.[Abstract/Free Full Text]

32. Tiruppathi C, Minshall RD, Paria BC, et al. Role of Ca2+ signaling in the regulation of endothelial permeability. Vasc Pharmacol. 2003; 39: 173–185.

33. Walch L, Norel X, Gascard JP, et al. Functional studies of leukotriene receptors in vascular tissues. Am J Respir Crit Care Med. 2000; 161: S107–S111.[Free Full Text]

34. Eimerl J, Siren AL, Feuerstein G. Systemic and regional hemodynamic effects of leukotrienes D4 and E4 in the conscious rat. Am J Physiol. 1986; 251: H700–H709.[Medline] [Order article via Infotrieve]

35. Drazen JM, Austen KF, Lewis RA, et al. Comparative airway and vascular activities of leukotrienes C-1 and D in vivo and in vitro. Proc Natl Acad Sci U S A. 1980; 77: 4354–4358.[Abstract/Free Full Text]

36. Brink C, Dahlen SE, Drazen J, et al. International Union of Pharmacology XXXVII. Nomenclature for leukotriene and lipoxin receptors. Pharmacol Rev. 2003; 55: 195–227.[Abstract/Free Full Text]

37. Back M, Walch L, Norel X, et al. Modulation of vascular tone and reactivity by nitric oxide in porcine pulmonary arteries and veins. Acta Physiol Scand. 2002; 174: 9–15.[CrossRef][Medline] [Order article via Infotrieve]

38. Pawloski JR, Chapnick BM. Leukotrienes C4 and D4 are potent endothelium-dependent relaxing agents in canine splanchnic venous capacitance vessels. Circ Res. 1993; 73: 395–404.[Abstract/Free Full Text]

39. Fleming I, Busse R. Signal transduction of eNOS activation. Cardiovasc Res. 1999; 43: 532–541.[Abstract/Free Full Text]

40. Beckman JS, Koppenol WH. Nitric oxide, superoxide, and peroxynitrite: the good, the bad, and the ugly. Am J Physiol. 1996; 271: C1424–C1437.[Medline] [Order article via Infotrieve]


Related Article:


Circulation 2004 110: 3289. [Extract] [Full Text]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
W. Jiang, S. R. Hall, M. P.W. Moos, R. Y. Cao, S. Ishii, K. O. Ogunyankin, L. G. Melo, and C. D. Funk
Endothelial Cysteinyl Leukotriene 2 Receptor Expression Mediates Myocardial Ischemia-Reperfusion Injury
Am. J. Pathol., March 1, 2008; 172(3): 592 - 602.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
M. Peters-Golden and W. R. Henderson Jr.
Leukotrienes
N. Engl. J. Med., November 1, 2007; 357(18): 1841 - 1854.
[Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
D. F. P. Leite, J. Echevarria-Lima, S. C. Ferreira, J. B. Calixto, and V. M. Rumjanek
ABCC transporter inhibition reduces zymosan-induced peritonitis
J. Leukoc. Biol., September 1, 2007; 82(3): 630 - 637.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Woszczek, L.-Y. Chen, S. Nagineni, S. Alsaaty, A. Harry, C. Logun, R. Pawliczak, and J. H. Shelhamer
IFN-{gamma} Induces Cysteinyl Leukotriene Receptor 2 Expression and Enhances the Responsiveness of Human Endothelial Cells to Cysteinyl Leukotrienes
J. Immunol., April 15, 2007; 178(8): 5262 - 5270.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Uzonyi, K. Lotzer, S. Jahn, C. Kramer, M. Hildner, E. Bretschneider, D. Radke, M. Beer, R. Vollandt, J. F. Evans, et al.
Cysteinyl leukotriene 2 receptor and protease-activated receptor 1 activate strongly correlated early genes in human endothelial cells
PNAS, April 18, 2006; 103(16): 6326 - 6331.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
110/21/3360    most recent
01.CIR.0000147775.50954.AAv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hui, Y.
Right arrow Articles by Funk, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hui, Y.
Right arrow Articles by Funk, C. D.
Related Collections
Right arrow Animal models of human disease
Right arrow Endothelium/vascular type/nitric oxide
Right arrow Other Vascular biology
Right arrowRelated Article