| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2004;110:3360-3366.)
© 2004 American Heart Association, Inc.
Vascular Medicine |
From the Center for Experimental Therapeutics and Department of Pharmacology (Y.H., Y.C., W.J., L.G., G.A.F., C.D.F.), University of Pennsylvania, Philadelphia, Pa; Merck Research Laboratories, Department of Cardiovascular Diseases, Rahway, NJ (I.S.); and the Departments of Physiology and Biochemistry, Queens University, Kingston, Ontario, Canada (C.D.F.).
Correspondence to Colin D. Funk, PhD, Department of Physiology, Queens University, Kingston, ON K7L 3N6 Canada. E-mail funkc{at}post.queensu.ca
Received May 14, 2004; revision received August 9, 2004; accepted August 23, 2004.
| Abstract |
|---|
|
|
|---|
Methods and Results We generated an endothelial cellspecific human CysLT2R (EC-hCysLT2R) transgenic (TG) mouse model using the Tie2 promoter/enhancer. Strong expression of hCysLT2R in TG lung and endothelial cells, detected by real-time polymerase chain reaction, markedly enhanced CysLT-stimulated intracellular calcium mobilization compared with endogenous expression in cells from nontransgenic mice. The permeability response to exogenous LTC4 and to endogenous CysLTs evoked by passive cutaneous anaphylaxis was augmented in TG mice. The rapid, systemic pressor response to intravenous LTC4 was also diminished in TG mice coincidentally with augmented production of nitric oxide.
Conclusions The development of EC-hCysLT2R mice has permitted detection of distinct vascular effects of CysLTs, which can be mediated via the CysLT2R in vivo.
Key Words: leukotrienes receptors endothelium edema blood pressure
| Introduction |
|---|
|
|
|---|
Both human and mouse CysLT1R710 and CysLT2R1115 genes were cloned in recent years and transiently expressed in heterologous systems. They belong to a subfamily of G proteincoupled receptors with 30 to 40% homology between the receptor subtypes. The rank order agonist affinities are as follows: LTD4>LTC4>LTE4 for CysLT1R and LTC4= LTD4>LTE4 for CysLT2R. CysLT1R couples to Gq/11 and/or Gi/o in various cell types, whereas CysLT2R couples to Gq and activation elicits intracellular calcium mobilization. CysLT1R is expressed primarily in bronchial smooth muscle cells; peripheral blood leukocytes, including eosinophils and monocytes; and mast cells, as reflected by mRNA and immunoreactivity analyses. CysLT2R, surprisingly, exhibits high expression in heart and coronary vessels and a diffuse pattern in brain, with expression also detected in adrenal gland, eosinophils, monocytes, and mast cells. The contrasting patterns of receptor expression imply distinct functions for CysLT receptors.
Evidence for at least 2 CysLT receptor subtypes in pulmonary vasculature, in both smooth muscle cells and endothelium, has been presented on the basis of pharmacological studies.16,17 Cultured human coronary endothelial cells (ECs)18 and human umbilical vein ECs express CysLT2R but lack CysLT1R.19,20 CysLTs can induce surface expression of P-selectin in human umbilical vein ECs21,22 that is not blocked by CysLT1R antagonists.22 Moreover, CysLT receptors on human pulmonary vessel endothelium mediate relaxation that is not modified by CysLT1R antagonists.16 These data are consistent with the existence of a functionally important CysLT2R on ECs. Both CysLT1R-knockout mice23 and mice in which the human CysLT1R is overexpressed in airway and vascular smooth muscle24 have been generated. However, no models are extant in which expression of CysLT2R has been manipulated. We have generated mice in which the human CysLT2R is overexpressed in ECs and report effects on endothelial integrity and blood pressure (BP) regulation mediated by this receptor subtype in vivo.
| Methods |
|---|
|
|
|---|
Transgene Integration Detection by Inverse PCR
Csp6I cut genomic DNA (150 ng) was self-circularized with T4 ligase (2 Weiss units) at 16°C for 16 hours and used for first-round PCR with forward ACACGTCTAACCTCAGCATCTGG and reverse ACTATGAAGCCAGGAGTGGTGC primers within the Tie2 promoter. The mixture (1:1000) was subjected to nested PCR using AGGAGGGCGGGTGGTTG and GGGAATGGATTAAGAGTTCAAGGTC primers. The nested PCR products were gel-purified, cloned into pCR2.1-TOPO vector, and sequenced.
PCR Analyses
For reverse transcription (RT)-PCR, total RNA (2 µg) prepared with RNeasy Mini Kit (Qiagen), treated with DNaseI, was reverse transcribed with the SuperScript First-Strand Synthesis System (Invitrogen), and PCR was performed with the hCysLT2R primers mentioned above. For real-time assays, cDNA was prepared with TaqMan transcription reagents, and PCR reactions were prepared in SYBR Green PCR Master Mix. DNA targets were amplified and analyzed with an ABI Prism 7000 Sequence Detection System (Applied Biosystems). Mouse GAPDH (CATGGCCTTCCGTGTTCCTA; ATGCCTGCTTCACCACCTTCT), mouse CysLT1R (GCAAGTGGCTCTTTGGTGACT; AAGATGCTACAATAGAGGTTAACGTACAA), mouse CysLT2R (CATGTGTATGCCTGATGTCTACCA; CATTTGCCGTACCCAGTCTCA), and human CysLT2R (TGCAACCATCCATCTCCGTAT; TGTGCAGTTCCTGCTGTTGTTAT) were amplified. The mCysLT1R, mCysLT2R, and hCysLT2R mRNA levels were normalized to GAPDH. No significant differences in GAPDH levels were detected between different samples when the same amount of total RNA was used (data not shown).
Isolation of Murine Primary Lung ECs
Lung ECs (LECs) were prepared from 4- to 8-week-old mice.25 Immunofluorescence analyses were performed as described previously,26 using rabbit anti-human CD 62P polyclonal antibody (1 µg/mL; Becton Dickinson). The uptake of acetylated LDL-DiI complex (DiI-Ac-LDL, Molecular Probes) was used to characterize the ECs.
Isolation of Murine Primary Aortic Smooth Muscle Cells
Mouse aorta strips with the intima scraped off were cultured under a glass cover slide in DMEM/F-12 medium containing 20% FBS, 0.5% penicillin-streptomycin, and 1% L-glutamine. The cover slide and aorta were removed after 10 days, and smooth muscle cells were characterized by anti
-smooth muscle actinFITC conjugate (Sigma) staining.
Intracellular Calcium Mobilization
LECs (passage 5) from transgenic (TG) and nontransgenic (NTG) mice were seeded in a 384-well clear black plate at a density of 10 000 cells/well in a volume of 25 µL and allowed to adhere overnight. Cells were loaded with 25 µL Calcium 3 No Wash Dye (Molecular Devices) supplemented with probenecid and incubated at 37°C, 5% CO2, for 1 hour, followed by LT/vehicle addition. Calcium fluorescent signals were monitored for 5 minutes by a Fluorometric Imaging Plate Reader (FLIPR, Molecular Devices) and corrected with background readings from adjacent wells.
Vascular Ear Permeability Assay
Anesthetized mice received 200 µL of 2% Evans blue dye in PBS injected via the tail vein. Immediately thereafter, the right ear was injected intradermally with LTC4 (Cayman Chemical Co) in 10 µL saline containing either 0.1% or 0.5% ethanol vehicle, whereas the left ear was injected with vehicle. Animals were euthanized after 15 minutes by CO2 inhalation. A 6-mm ear biopsy (Acu-Punch, Acuderm Inc) was soaked in formamide (750 µL) overnight at 55°C, and extracted Evans blue dye was measured by absorbance at 610 nm with a Beckman DU-600 spectrophotometer.
Passive Cutaneous Anaphylaxis Assay
Anesthetized mice received intradermal injections of 40 ng monoclonal anti-dinitrophenyl IgE in 20 µL saline in the right ear and 20 µL saline in the left ear. After 24 hours, animals were administered dinitrophenylhuman serum albumin (200 µg) in 200 µL 1% Evans blue dye (in PBS) via the tail vein, and 30 minutes later, ear tissues were analyzed for dye leakage as described above.
Mean Arterial BP Measurements
The right internal jugular vein and left carotid artery of anesthetized mice were cannulated with PE-10 tubing. The arterial catheter was connected to a Capto SP844 pressure transducer, and BP was monitored continuously with a PowerLab/8SP system. Mice were injected via the right internal jugular vein with LTC4 (0.3, 1, or 3 µg/kg in 4 mL/kg saline). The same volume of saline was injected before LTC4 administration to exclude volume-mediated BP changes.
Measurement of Plasma Nitric Oxide Metabolites
Mice were injected with 1 µg/kg of LTC4 (0.25 µg/mL in saline) via the tail vein, and blood (100 µL) was drawn from the saphenous vein with a Microvette 200 LH (Sarstedt) at times 0, 5 minutes, and 30 minutes after LTC4 injection. Plasma total nitrate/nitrite was measured with a fluorometric assay kit (Cayman Chemical Co) according to the manufacturers instructions.
Statistics
Analyses were performed by Students t test or 1-way ANOVA using Graph Pad Prism software. A value of P<0.05 was considered significant. Data are presented as mean±SEM.
| Results |
|---|
|
|
|---|
7 copies integrated into the mouse genome in a head-to-tail orientation (Figure 1B) at chromosome 6 B1 region (34 557 689 bp) (Figure 1C) within a gene-sparse region. The closest gene, bisphosphoglycerate mutase, is 109 kb distant at proximal location 34 419 267 to 34 448 521 bp. The integration of the transgene did not physically disrupt any genes and would not be expected to exert any nonspecific integration effects.
|
hCysLT2R Expression in TG Mice
Expression of hCysLT2R mRNA in lung tissue of TG mice was subjected to real-time PCR analyses and found to be 200-fold higher than endogenous mCysLT2R levels. Expression of mCysLT2R in TG mice did not change relative to NTG mice (Figure 2A). Northern blot analysis detected a strong 2-kb band transcript in TG but not NTG lung (Figure 2B). hCysLT2R mRNA in TG liver was not detected but may have been masked by the abundance of hepatocyte mRNA.
|
LECs (99% positive for the endothelial cellspecific marker P-selectin staining and DiI-Ac-LDL uptake) and aortic smooth muscle cells (ASMCs; >90% positive for
-actin) were cultured and used to determine the specificity of transgene expression by RT-PCR. hCysLT2R expression was detected as a 532-bp band in TG lung, LECs, and aorta but not in ASMCs (Figure 2C). However, expression in cultured LECs was diminished compared with lung tissue (Figure 2B), possibly because of gene silencing by in vitro culture.
CysLTs Elicit Robust Intracellular Calcium Mobilization Responses in TG LECs
We determined whether intracellular calcium mobilization induced by CysLTs could be augmented in TG LECs through Gq to evaluate the functionality of EC-hCysLT2R. Whereas LECs from NTG mice showed a minimal response to 1 µmol/L LTC4 and LTD4, TG LECs responded to both agonists with a prominent calcium signal peak. Cells of both genotypes did not respond to LTE4 or LTB4 (Figure 3A). Figure 3B reveals the time course of the fluorescence signal induced by LTC4 and LTD4. LTD4 produced a small and transient signal in NTG LECs, whereas LTC4 produced a small but sustained response. The signal intensity in TG LECs by LTC4/LTD4 was of much greater magnitude than in NTG LECs and was sustained during the recording period (3 minutes) for LTC4 but returned to baseline within 70 seconds with LTD4 stimulation.
|
EC-hCysLT2R TG Mice Exhibit Enhanced Vascular Permeability in Response to CysLTs
We investigated the role of CysLT2R in mediating vascular permeability changes as measured by Evans blue dye extravasation. Exogenous LTC4 administration elicited an increase in vascular permeability in both NTG and TG mice within 15 minutes. Whereas the permeability change in NTG mice was small, the response in TG mice was potentiated by
90% (n=7 to 8; P<0.05) and
5-fold (n=11 to 12; P<0.0001) in response to 1 and 5 ng LTC4, respectively (Figure 4A). Dye extravasation caused by CysLTs produced endogenously by activated mast cells in passive cutaneous anaphylaxis was augmented by
80% (n=7 to 9; P<0.05) in TG mice compared with NTG littermates 30 minutes after antigen challenge (Figure 4B). Expression of hCysLT2R in the TG ear vascular bed was verified by real-time PCR (Figure 4C). Neither mCysLT1R nor mCysLT2R endogenous expression levels were changed in TG ears. These results indicate that CysLT2R can mediate CysLT-induced permeability changes.
|
LTC4-Induced Systemic Pressor Effect in NTG Mice Is Diminished in EC-hCysLT2R TG Mice
Mean arterial pressure (MAP) was monitored continuously in anesthetized mice. Baseline MAP did not differ between NTG and TG mice (data not shown). LTC4 administered systemically caused an immediate rise in MAP that gradually fell to baseline within 3 to 15 minutes in NTG mice (Figure 5A, top, and B). Average MAP increased 15%, 20%, and 23% on 0.3 µg/kg, 1 µg/kg, and 3 µg/kg LTC4 infusion, respectively. Although the overall BP response followed a similar time course in TG littermates, MAP changed significantly compared with the NTG controls (+7%, n=5 to 6, P<0.05; 8%, n=6 to 8, P<0.005; and +4%, n=5, P<0.001) at the respective LTC4 infusion concentrations (Figure 5A, bottom, and B).
|
Plasma NO Metabolites Are Increased in EC-hCysLT2R TG Mice
The response of plasma NO metabolites to LTC4 1 µg/kg systemic infusion was evaluated. Baseline levels did not differ between NTG and TG mice (data not shown). Total nitrate/nitrite increased marginally after LTC4 injection and remained stable at this level for at least 30 minutes in NTG mice. The increase in these metabolites was significantly potentiated in plasma obtained from TG mice (n=8; P<0.05; Figure 6).
|
| Discussion |
|---|
|
|
|---|
Increased vascular permeability is a feature of inflammation. CysLTs induce a rapid dose-dependent plasma extravasation from postcapillary venules, 1000 times more potent than histamine,29 which can be inhibited by CysLT1R antagonists.30 Moreover, CysLT1R-deficient mice display decreased plasma leakage in passive cutaneous anaphylaxis,23 indicating that CysLT1R is the major mediator of CysLT action in this process. However, BAY u9773 is more efficient than a CysLT1R antagonist in reducing edema in a guinea pig brain perfusion assay in vitro,31 raising the possibility of a contribution from the CysLT2R. The results of our studies in EC-hCysLT2R mice are consistent with this hypothesis, because permeability in the ear vasculature was augmented in TG mice. Indeed, this response may be dominantly transduced via the CysLT2R in heart and brain, where this receptor subtype predominates. Histamine and many other G proteincoupled receptors that couple to Gq induce the loss of endothelial barrier function through a calcium-dependent pathway, leading to junctional disassembly,32 a pathway that may be in operation in EC-hCysLT2R mice.
CysLTs evoke contradictory effects on vascular tone, depending on the species and the experimental preparations,33 with both endothelium- and smooth muscledependent effects. Although the endothelium usually contributes to CysLT-mediated relaxation and smooth muscle to direct contractile responses, the resolution of these actions as a change in BP has been difficult to predict. For instance, intravenous injection of LTD4 exerts a pressor effect in conscious rats,34 whereas both LTC4 and LTD4 decrease arterial pressure in anesthetized guinea pigs. However, high doses of the CysLTs paradoxically increase BP for a period of time, followed by transient hypotension in unanesthetized guinea pigs.35 The effects of CysLTs on vascular tone and BP have not been examined previously in mice. We found that LTC4 increased MAP in NTG mice in a dose-dependent manner. However, this pressor effect was significantly reduced or even paradoxically reversed (LTC4 1 µg/kg) in EC-hCysLT2R mice, substantiating an apparent relaxant role for endothelial CysLT2R in BP regulation during inflammation or anaphylaxis. The BP response in TG mice failed to reveal dose dependency, further suggesting the complex nature in CysLT-mediated vascular tone regulation. Wild-type mice express both CysLT1R and CysLT2R in cultured LECs and ASMCs at comparable levels (data not shown). Although Brink et al36 summarized pharmacological characterization of CysLT receptors in different vascular preparations, the limitations of currently available pharmacological probes constrain predictions of receptor subtypespecific vascular responses to CysLTs in vivo.
Mechanisms for endothelium-mediated CysLT-generated vasodilation appear to involve NO and/or prostacyclin synthesis. NO release may be more important in human and porcine pulmonary veins16,37 and canine splanchnic vein,38 whereas prostacyclin may be the major mediator for human pulmonary artery dilation.17 Thus, CysLT receptors may couple to different signaling pathways in ECs in a vascular bedspecific manner, leading to decreased peripheral resistance and/or decreased venous return and cardiac output. We speculate that these pathways might account for the systemic hypotensive effect generated by overexpressed hCysLT2R on endothelium.
Our observation that NO metabolites increase marginally in NTG mice and to a much greater extent in EC-hCysLT2R mice in response to LTC4 corroborates previous studies showing NO involvement in CysLT responses in various vascular preparations. Endothelial NO synthase activation is calcium dependent,39 which is consistent with hCysLT2R function to elevate cellular calcium through Gq. However, BP responses to LTC4 were immediate and returned to baseline within 15 minutes, in contrast to NO metabolite levels in TG mice, which increased steadily over a 30-minute period. Because NO and related nitrogen oxides interact with a large array of molecules and shuttle between tissues, plasma, and red blood cells,40 the time needed for NO metabolites to "equilibrate" between different compartments in vivo might be longer than the effective duration of NO produced during LTC4 stimulation. NO might also be formed in TG mice for purposes other than vascular tone regulation.
In summary, we demonstrate that EC-hCysLT2R mice have augmented vascular permeability and reduced pressor responses to CysLTs. This mouse model may mimic pathophysiological settings in which endothelial CysLT2R can be induced, for example, by cytokines.19 Endothelial CysLT2R may exacerbate inflammation by increasing vascular permeability and possibly by recruiting more neutrophils through enhanced P-selectin expression. It may participate in severe hypotensive responses in life-threatening anaphylaxis. Moreover, augmented CysLT2R-dependent NO formation could interact with superoxide to form peroxynitrite in settings in which vascular inflammation coincides with increased oxidant stress, such as in atherosclerosis and ischemia-reperfusion injury.40 Manipulated expression of the CysLT2R in vivo is likely to reveal further the importance of this potential drug target in cardiovascular biology.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
2. Samuelsson B. Leukotrienes: mediators of immediate hypersensitivity reactions and inflammation. Science. 1983; 220: 568575.
3. Coleman RA, Eglen RM, Jones RL, et al. Prostanoid and leukotriene receptors: a progress report from the IUPHAR working parties on classification and nomenclature. Adv Prostaglandin Thromboxane Leukot Res. 1995; 23: 283285.[Medline] [Order article via Infotrieve]
4. Hui Y, Funk CD. Cysteinyl leukotriene receptors. Biochem Pharmacol. 2002; 64: 15491557.[CrossRef][Medline] [Order article via Infotrieve]
5. Drazen JM, Israel E, OByrne PM. Treatment of asthma with drugs modifying the leukotriene pathway. N Engl J Med. 1999; 340: 197206.
6. Grayson MH, Korenblat PE. The emerging role of leukotriene modifiers in allergic rhinitis. Am J Respir Med. 2003; 2: 441450.[Medline] [Order article via Infotrieve]
7. Lynch KR, ONeill GP, Liu Q, et al. Characterization of the human cysteinyl leukotriene CysLT1 receptor. Nature. 1999; 399: 789793.[CrossRef][Medline] [Order article via Infotrieve]
8. Sarau HM, Ames RS, Chambers J, et al. Identification, molecular cloning, expression, and characterization of a cysteinyl leukotriene receptor. Mol Pharmacol. 1999; 56: 657663.
9. Maekawa A, Kanaoka Y, Lam BK, et al. Identification in mice of two isoforms of the cysteinyl leukotriene 1 receptor that result from alternative splicing. Proc Natl Acad Sci U S A. 2001; 98: 22562261.
10. Martin V, Sawyer N, Stocco R, et al. Molecular cloning and functional characterization of murine cysteinyl-leukotriene 1 (CysLT(1)) receptors. Biochem Pharmacol. 2001; 62: 11931200.[CrossRef][Medline] [Order article via Infotrieve]
11. Heise CE, ODowd BF, Figueroa DJ, et al. Characterization of the human cysteinyl leukotriene 2 receptor. J Biol Chem. 2000; 275: 3053130536.
12. Takasaki J, Kamohara M, Matsumoto M, et al. The molecular characterization and tissue distribution of the human cysteinyl leukotriene CysLT(2) receptor. Biochem Biophys Res Commun. 2000; 274: 316322.[CrossRef][Medline] [Order article via Infotrieve]
13. Nothacker HP, Wang Z, Zhu Y, et al. Molecular cloning and characterization of a second human cysteinyl leukotriene receptor: discovery of a subtype selective agonist. Mol Pharmacol. 2000; 58: 16011608.[Medline] [Order article via Infotrieve]
14. Hui Y, Yang G, Galczenski H, et al. The murine cysteinyl leukotriene 2 (CysLT2) receptor: cDNA and genomic cloning, alternative splicing, and in vitro characterization. J Biol Chem. 2001; 276: 4748947495.
15. Ogasawara H, Ishii S, Yokomizo T, et al. Characterization of mouse cysteinyl leukotriene receptors mCysLT1 and mCysLT2: differential pharmacological properties and tissue distribution. J Biol Chem. 2002; 277: 1876318768.
16. Ortiz JL, Gorenne I, Cortijo J, et al. Leukotriene receptors on human pulmonary vascular endothelium. Br J Pharmacol. 1995; 115: 13821386.[Medline] [Order article via Infotrieve]
17. Back M, Norel X, Walch L, et al. Prostacyclin modulation of contractions of the human pulmonary artery by cysteinyl-leukotrienes. Eur J Pharmacol. 2000; 401: 389395.[CrossRef][Medline] [Order article via Infotrieve]
18. Kamohara M, Takasaki J, Matsumoto M, et al. Functional characterization of cysteinyl leukotriene CysLT(2) receptor on human coronary artery smooth muscle cells. Biochem Biophys Res Commun. 2001; 287: 10881092.[CrossRef][Medline] [Order article via Infotrieve]
19. Lötzer K, Spanbroek R, Hildner M, et al. Differential leukotriene receptor expression and calcium responses in endothelial cells and macrophages indicate 5-lipoxygenase-dependent circuits of inflammation and atherogenesis. Arterioscler Thromb Vasc Biol. 2003; 23: e32e36.
20. Sjöstrom M, Johansson AS, Schröder O, et al. Dominant expression of the CysLT2 receptor accounts for calcium signaling by cysteinyl leukotrienes in human umbilical vein endothelial cells. Arterioscler Thromb Vasc Biol. 2003; 23: e37e41.
21. Datta YH, Romano M, Jacobson BC, et al. Peptido-leukotrienes are potent agonists of von Willebrand factor secretion and P-selectin surface expression in human umbilical vein endothelial cells. Circulation. 1995; 92: 33043311.
22. Pedersen KE, Bochner BS, Undem BJ. Cysteinyl leukotrienes induce P-selectin expression in human endothelial cells via a non-CysLT1 receptor-mediated mechanism. J Pharmacol Exp Ther. 1997; 281: 655662.
23. Maekawa A, Austen KF, Kanaoka Y. Targeted gene disruption reveals the role of cysteinyl leukotriene 1 receptor in the enhanced vascular permeability of mice undergoing acute inflammatory responses. J Biol Chem. 2002; 277: 2082020824.
24. Yang G, Haczku A, Chen H, et al. Transgenic smooth muscle expression of the human CysLT1 receptor induces enhanced responsiveness of murine airways to leukotriene D4. Am J Physiol. 2004; 286: L992L1001.
25. Lim YC, Garcia-Cardena G, Allport JR, et al. Heterogeneity of endothelial cells from different organ sites in T-cell subset recruitment. Am J Pathol. 2003; 162: 15911601.
26. Chen XS, Zhang YY, Funk CD. Determinants of 5-lipoxygenase nuclear localization using green fluorescent protein/5-lipoxygenase fusion proteins. J Biol Chem. 1998; 273: 3123731244.
27. Schlaeger TM, Bartunkova S, Lawitts JA, et al. Uniform vascular-endothelial-cell-specific gene expression in both embryonic and adult transgenic mice. Proc Natl Acad Sci U S A. 1997; 94: 30583063.
28. Labat C, Ortiz JL, Norel X, et al. A second cysteinyl leukotriene receptor in human lung. J Pharmacol Exp Ther. 1992; 263: 800805.
29. Dahlen SE, Bjork J, Hedqvist P, et al. Leukotrienes promote plasma leakage and leukocyte adhesion in postcapillary venules: in vivo effects with relevance to the acute inflammatory response. Proc Natl Acad Sci U S A. 1981; 78: 38873891.
30. Bochnowicz S, Underwood DC. Dose-dependent mediation of leukotriene D4-induced airway microvascular leakage and bronchoconstriction in the guinea pig. Prostaglandins Leukot Essent Fatty Acids. 1995; 52: 403411.[CrossRef][Medline] [Order article via Infotrieve]
31. Di Gennaro A, Carnini C, Buccellati C, et al. Cysteinyl-leukotriene receptor activation in brain inflammatory reactions and cerebral edema formation: a role for transcellular biosynthesis of cysteinyl leukotrienes. FASEB J. 2004; 18: 842844.
32. Tiruppathi C, Minshall RD, Paria BC, et al. Role of Ca2+ signaling in the regulation of endothelial permeability. Vasc Pharmacol. 2003; 39: 173185.
33. Walch L, Norel X, Gascard JP, et al. Functional studies of leukotriene receptors in vascular tissues. Am J Respir Crit Care Med. 2000; 161: S107S111.
34. Eimerl J, Siren AL, Feuerstein G. Systemic and regional hemodynamic effects of leukotrienes D4 and E4 in the conscious rat. Am J Physiol. 1986; 251: H700H709.[Medline] [Order article via Infotrieve]
35. Drazen JM, Austen KF, Lewis RA, et al. Comparative airway and vascular activities of leukotrienes C-1 and D in vivo and in vitro. Proc Natl Acad Sci U S A. 1980; 77: 43544358.
36. Brink C, Dahlen SE, Drazen J, et al. International Union of Pharmacology XXXVII. Nomenclature for leukotriene and lipoxin receptors. Pharmacol Rev. 2003; 55: 195227.
37. Back M, Walch L, Norel X, et al. Modulation of vascular tone and reactivity by nitric oxide in porcine pulmonary arteries and veins. Acta Physiol Scand. 2002; 174: 915.[CrossRef][Medline] [Order article via Infotrieve]
38. Pawloski JR, Chapnick BM. Leukotrienes C4 and D4 are potent endothelium-dependent relaxing agents in canine splanchnic venous capacitance vessels. Circ Res. 1993; 73: 395404.
39. Fleming I, Busse R. Signal transduction of eNOS activation. Cardiovasc Res. 1999; 43: 532541.
40. Beckman JS, Koppenol WH. Nitric oxide, superoxide, and peroxynitrite: the good, the bad, and the ugly. Am J Physiol. 1996; 271: C1424C1437.[Medline] [Order article via Infotrieve]
Related Article:
Circulation 2004 110: 3289.
This article has been cited by other articles:
![]() |
W. Jiang, S. R. Hall, M. P.W. Moos, R. Y. Cao, S. Ishii, K. O. Ogunyankin, L. G. Melo, and C. D. Funk Endothelial Cysteinyl Leukotriene 2 Receptor Expression Mediates Myocardial Ischemia-Reperfusion Injury Am. J. Pathol., March 1, 2008; 172(3): 592 - 602. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Peters-Golden and W. R. Henderson Jr. Leukotrienes N. Engl. J. Med., November 1, 2007; 357(18): 1841 - 1854. [Full Text] [PDF] |
||||
![]() |
D. F. P. Leite, J. Echevarria-Lima, S. C. Ferreira, J. B. Calixto, and V. M. Rumjanek ABCC transporter inhibition reduces zymosan-induced peritonitis J. Leukoc. Biol., September 1, 2007; 82(3): 630 - 637. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Woszczek, L.-Y. Chen, S. Nagineni, S. Alsaaty, A. Harry, C. Logun, R. Pawliczak, and J. H. Shelhamer IFN-{gamma} Induces Cysteinyl Leukotriene Receptor 2 Expression and Enhances the Responsiveness of Human Endothelial Cells to Cysteinyl Leukotrienes J. Immunol., April 15, 2007; 178(8): 5262 - 5270. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Uzonyi, K. Lotzer, S. Jahn, C. Kramer, M. Hildner, E. Bretschneider, D. Radke, M. Beer, R. Vollandt, J. F. Evans, et al. Cysteinyl leukotriene 2 receptor and protease-activated receptor 1 activate strongly correlated early genes in human endothelial cells PNAS, April 18, 2006; 103(16): 6326 - 6331. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2004 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |