Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2004;110:3300-3305
Published online before print November 8, 2004, doi: 10.1161/01.CIR.0000147780.30124.CF
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
110/21/3300    most recent
01.CIR.0000147780.30124.CFv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abbott, J. D.
Right arrow Articles by Giordano, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abbott, J. D.
Right arrow Articles by Giordano, F. J.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Bone Marrow Transplantation
*Heart Attack
*Stem Cells
Related Collections
Right arrow Gene expression
Right arrow Growth factors/cytokines
Right arrow Ischemic biology - basic studies

(Circulation. 2004;110:3300-3305.)
© 2004 American Heart Association, Inc.


Coronary Heart Disease

Stromal Cell–Derived Factor-1{alpha} Plays a Critical Role in Stem Cell Recruitment to the Heart After Myocardial Infarction but Is Not Sufficient to Induce Homing in the Absence of Injury

J. Dawn Abbott, MD; Yan Huang, PhD; Dingang Liu, MD; Reed Hickey, BS; Diane S. Krause, MD, PhD; Frank J. Giordano, MD

From the Departments of Cardiology (J.D.A., Y.H., D.L., R.H., F.J.G.) and Laboratory Medicine (D.S.K.), Yale University Medical School, New Haven, Conn.

Correspondence to Frank J. Giordano, BCMM 439, 295 Congress Ave, New Haven, CT 06510. E-mail frank.giordano{at}yale.edu

Received April 24, 2004; revision received June 21, 2004; accepted August 3, 2004.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— After myocardial infarction (MI), bone marrow–derived cells (BMDCs) are found within the myocardium. The mechanisms determining BMDC recruitment to the heart remain unclear. We investigated the role of stromal cell–derived factor-1{alpha} (SDF-1) in this process.

Methods and Results— MI produced in mice by coronary ligation induced SDF-1 mRNA and protein expression in the infarct and border zone and decreased serum SDF-1 levels. By quantitative polymerase chain reaction, 48 hours after intravenous infusion of donor-lineage BMDCs, there were 80.5±15.6% more BDMCs in infarcted hearts compared with sham-operated controls (P<0.01). Administration of AMD3100, which specifically blocks binding of SDF-1 to its endogenous receptor CXCR4, diminished BMDC recruitment after MI by 64.2±5.5% (P<0.05), strongly suggesting a requirement for SDF-1 in BMDC recruitment to the infarcted heart. Forced expression of SDF-1 in the heart by adenoviral gene delivery 48 hours after MI doubled BMDC recruitment over MI alone (P<0.001) but did not enhance recruitment in the absence of MI, suggesting that SDF-1 can augment, but is not singularly sufficient for, BDMC recruitment to the heart. Gene expression analysis after MI revealed increased levels of several genes in addition to SDF-1, including those for vascular endothelial growth factor, matrix metalloproteinase-9, intercellular adhesion molecule-1, and vascular cell adhesion molecule-1, which might act in concert with SDF-1 to recruit BMDCs to the injured heart.

Conclusion— SDF-1/CXCR4 interactions play a crucial role in the recruitment of BMDCs to the heart after MI and can further increase homing in the presence, but not in the absence, of injury.


Key Words: cell adhesion molecules • cells • growth factors • myocardial infarction


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Peripheral and bone marrow–derived stem cells (BMDCs) are a promising therapy for the treatment of ischemic cardiomyopathy. Although the differentiation capacity of BMDCs directly injected into the heart after myocardial infarction (MI) is controversial, they result in improved ventricular function,1–3 which may be due to production of cytokines that potentially restore heart function and vascularization.4 Early experience with autologous unfractionated bone marrow (BM) via the endocardial and intracoronary routes has been promising with respect to improvement in ischemic parameters.5,6 The invasive nature of BM harvest and subsequent cardiac delivery, however, has limited the clinical utility of cell therapies. An alternative approach to stem cell (SC) therapy is to manipulate the natural factors responsible for homing to sites of injury.

Myocardial ischemia mobilizes and potentially homes BMDCs. Circulating endothelial progenitor cells increase after cardiac ischemia or vascular injury.7,8 After MI, BMDCs are detected in the peri-infarct region as endothelial cells and rarely, myocytes.3,9 In addition, SCs delivered intravenously within 24 hours of MI engraft in the heart and have a similar differentiation capacity.10,11 The observation that the SCs localize to the peri-infarct region suggests the presence of local chemotactic factors such as stromal cell–derived factor-1{alpha} (SDF-1).

SDF-1 and its receptor CXCR4 are required for BMDC homing to the BM.12 SDF-1 is also involved in stress-induced recruitment of SCs to the liver and neointima.13,14 The role of SDF-1 in coronary artery disease is less clear. Although SDF-1 is expressed in atherosclerotic plaques, circulating levels of the chemokine are decreased in unstable coronary syndromes.15,16 SDF-1 is upregulated in the heart early after MI, and exogenous expression late after MI increases vascular density and improves ventricular function when granulocyte colony stimulating factor is coadministered, which may result in adverse side effects such as in-stent restenosis.17,18 In ischemic hindlimbs, exogenous SDF-1 did not promote limb salvage in the absence of delivered endothelial precursor cells but did decrease endothelial cell apoptosis.19

To clarify the role of SDF-1 in SC recruitment to the myocardium, we quantified the accumulation of systemically delivered BMDCs with overexpression of SDF-1 in the presence and absence of myocardial injury. Using the chemokine receptor CXCR4 antagonist AMD3100, we assessed the effect of blocking the SDF-1/CXCR4 interaction on the homing of delivered SCs. In addition, we examined the expression of factors potentially involved in the homing and retention of stem cells in the myocardium, including SC factor (SCF), vascular cell adhesion molecule-1 (VCAM-1), intercellular adhesion molecule-1 (ICAM-1), vascular endothelial growth factor (VEGF), and matrix metalloproteinase-9 (MMP-9).


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Construction of Adenoviral Vectors
Murine SDF-1{alpha} was released from the expression vector pORF5 (InvivoGen) and cloned into pACCMV.pLpASR–. Replication-deficient, recombinant adenovirus (AdV)-5 vectors were generated as previously described.20 An AdV clone containing full-length SDF-1 (AdV.SDF) was confirmed by polymerase chain reaction (PCR). The control AdV was similarly constructed to contain a red fluorescent gene in the same shuttle vector (AdV.CONT). The AdV.SDF titer was 1.51x1011 plaque-forming units (PFU)/mL, and the titer for AdV.CONT was 2.3x1011 PFU/mL.

Animal Studies
Mice were cared for in accordance with National Institutes of Health guidelines, and all procedures were approved by the Yale University Animal Care and Use Committee.

Murine MI and Viral Transduction
Female, 8-week-old SCID mice (NOD-CB17-Prkdc scid/j, Jackson Laboratory, Bar Harbor, Me) were used for experiments involving cell transplantation (n=28), and CD-1 mice (Charles River, Wilmington, Mass) were used for gene and protein expression experiments (n=46). Mice were anesthetized with xylazine (5 mg/kg IP, Boehringer Ingelheim) and ketamine hydrochloride (100 mg/kg IP, Fort Dodge Animal Health). The mice were intubated and ventilated (Harvard Apparatus), and the heart was exposed through a lateral thoracotomy. With the aid of a surgical microscope (Leica MZ95), a 7-0 silk suture was placed blindly to occlude the left anterior descending coronary artery to produce an MI. Before chest closure, infarction was confirmed by observation of a demarcation of injury with blanching of the myocardium. Sham surgery involved the same cardiac exposure without placement of the coronary suture. For AdV delivery, 1x109 PFU of AdV.SDF-1 or AdV.CONT diluted in 15 µL of phosphate-buffered saline (PBS), or PBS alone, was injected into the left ventricular wall alone or immediately after MI into the peri-infarct zone.

The CD-1 hearts were harvested 48 hours after AdV transduction and at 48, 72, and 96 hours and 7 days after MI. The atria and right ventricular free wall were removed, and the entire left ventricle was frozen in LN2 for isolation of protein and RNA. In 1 subset of the CD-1 hearts harvested 48 hours after MI, only the infarct and peri-infarct regions of the left ventricle were harvested for RNA to determine whether local and global left ventricular gene expression differed.

BM Isolation and Lineage Depletion
Donor BMCs were harvested from 8- to 12-week-old, knock-in MLC-2v cre mice (±) as previously described.21 These mice are heterozygous for green fluorescent protein (GFP) cDNA, thereby allowing identification of donor cells by PCR on genomic DNA. Lineage-negative (Lin–) BM was obtained by depletion with the use of magnetic columns (Miltenyi Biotec Inc) and biotinylated, lineage-specific antibodies (anti-CD4, -CD8, -CD11, -B220, -Gr1, and -Ter119; Pharmingen). This method results in <2% Lin+ cells confirmed by flow cytometry.

SCID mice underwent intravenous delivery of 3x105 Lin– BMCs in the internal jugular vein in all experiments 48 hours after MI and/or AdV transduction. Seventy-two hours after SC delivery, heart was harvested, the atria and right ventricular free wall were removed, and the entire left ventricle was frozen in LN2 for subsequent DNA isolation to quantify homing as described later.

In Vivo Inhibition of CXCR4
To block SDF-1–induced homing of delivered cells after MI, we used the bicyclam AMD3100 (Sigma), a potent and specific antagonist of the chemokine receptor CXCR4.22 Before intravenous delivery, Lin– BMCs were incubated for 30 minutes at 37°C with 5 µg/mL AMD3100. The cells were washed in PBS and then immediately delivered intravenously.

Flow Cytometric Analysis
Fluorescence-activated cell sorting (FACS) detection of CXCR4 expression was performed on Lin– BM stem cells immediately after isolation with the use of phycoerythrin-conjugated anti-CXCR4 (PharMingen) and assayed on a FACS system (FACscan, Becton Dickinson).

Migration Assay
To investigate cell migration in response to SDF-1 and CXCR4 inhibition with AMD3100, a modified Boyden chamber assay was performed with a 96-well, microchemotaxis chamber (NeuroProbe) with 5-µm pores. Murine SDF-1 (PharMingen) diluted to 100 ng/mL or medium alone was placed in the lower half of the chemotaxis chamber. Lin– BMCs were incubated for 30 minutes at 37±C with or without 5 µg/mL AMD3100. The cells were resuspended in Iscove’s modified Dulbecco’s medium with or without SDF-1 100 ng/mL and placed on the upper compartment. After incubation at 37°C for 2 hours and subsequent dilution in a known concentration of fluorescent beads (Spherotech), the number of migrated cells was measured by flow cytometry.

PCR for Quantification of Homing
Genomic DNA was isolated from left ventricular myocardial tissue with the Easy-DNA kit (Invitrogen). In brief, the frozen tissue was pulverized, resuspended in the DNA isolation solutions, and incubated overnight at 60°C with 100 µg of protein degrader. After DNA precipitation, samples were treated with 40 µg/mL RNase for 30 minutes at 37°C. GFP primers were as follows: forward, 5'-GATGGCCCTGTCCTTTTACCA-3' and reverse, 5'-TTTCGTTGGGATCTTTCGAAA-3'), and that for a fluorogenic GFP probe was 5' HEX ACAACCATTACCTGTCCACACAATCTGCC BHQ-1 3', Biosearch Technologies). The DNA Engine Opticon 2 Continuous Fluorescence Detection System was used (MJ Research, Inc). PCR began with a 1-minute, 94°C denaturation step followed by 40 cycles at 94°C for 30 seconds, 58°C for 1 minute, and 72°C for 1 minute.

ELISA for Murine SDF-1{alpha} and VEGF
Quantitative immunoassays were used for both SDF-1 and VEGF, according to the manufacturer’s protocol (R&D Systems). Blood was obtained by cardiac aspiration and serum was isolated after clotting. Tissue extracts from heart and liver were prepared by homogenization and lysis with 25 mmol/L Tris, 1% Triton X-100, 0.5 mmol/L EDTA, 150 mmol/L NaCl, 10 mmol/L NaF, and a protease inhibitor cocktail (Roche Mannheim). Recombinant murine SDF-1 and murine VEGF supplied with the kits were used to generate standard curves. Total protein was quantified by the Bradford assay.

Immunohistochemistry for Detection of SDF-1 Expression
Immunohistochemistry for SDF-1 was performed on myocardial tissue harvested 48 hours after infarction and frozen in OCT compound. Frozen 8-µm sections were fixed in acetone. Endogenous peroxidase and biotin were blocked (Vector Laboratories), and rabbit anti-mouse SDF-1{alpha} (RDI, diluted 1:100 in 1% blocking serum) was added for 30 minutes. Rabbit anti-mouse IgG (H+L) served as a negative control (Jackson Immunoresearch). Biotinylated goat anti-rabbit IgG was applied for 30 minutes, and the slides were developed with avidin:biotinylated enzyme complex and diaminobenzidine, according to the manufacturer’s instructions (Vector Laboratories), counterstained with hematoxylin, and mounted in mounting medium (Vectamount).

Gene Expression Analysis
Myocardial RNA was stabilized, homogenized, and initially extracted with RNA STAT-60 (Tel-test, Inc). The RNA was further purified over RNA columns, and DNA was removed by on-column DNase digestion with an RNase-free DNase set (Qiagen). cDNA was generated with random primers. Quantitative reverse transcription (RT)–PCR was carried out with SYBR Green JumpStart Taq Ready Mix (Sigma) on 10 ng of cDNA template and normalized for glyceraldehyde 3-phosphate dehydrogenase (GAPDH). PCR products were confirmed by examination of agarose gels. The following oligonucleotides were used as primers: for SDF-1 forward, 5'-A C C A G T C A G C C T G A G C T A C C-3' and reverse, 5'-C A C T T T A A T T T C G G G T C A A T G C-3'; for CXCR-4 forward, 5'-T C A G T C A G G G G G A T G A C A G G-3' and reverse, 5'-T G G C C C T T G G A G T G T G A C A G C-3'; for VEGFA forward, 5'-A A G G A G A G C A G A A G T C C C A T G A-3' and reverse, 5'-C A C A G G A C G G C T T G A A G A T G T-3'; for SCF forward, 5'-C T G C G G G A A T C C T G T G A C T G-3' and reverse, 5'-C C A G A A G A G T A G T C A A G C T G A G-3'; for VCAM forward, 5'- T C T C T C A G G A A A T G C C A C C C-3' and reverse, 5'-C A C A G C C A A T A G C A G C A C A C-3'; for ICAM forward, 5'-G G C A C C C A G C A G A A G T T G T T-3' and reverse, 5'-C C T C A G T C A C C T C T A C C A A G-3'; for MMP-9 forward, 5'-A G A A G C A G T C T C T A C G G C C G-3' and reverse, 5'-T G A T G G T C C C A C T T G A G G C C-3'; and for GAPDH forward, 5'-A C A G C A A C T C C C A C T C T T C C-3' and reverse, 5'-G C C T C T C T T G C T C A G T G T C C-3'.

Gene expression data are expressed as the change in percentage or copy number over baseline. For quantification of SDF-1 copy number, a standard curve was generated with the SDF plasmid for AdV production (9145 bp) and the formula C=G/(MX/A), where C=copy number, M=number of base pairs, X=682 g/mol, A=Avogadro’s constant (6x1023), and G=DNA concentration.

Data and Statistical Analysis
Gene expression data were verified by performing experiments in triplicate. ELISA, FACS, and chemotaxis studies were performed in duplicate. Results are presented as mean±SEM. Statistical significance was evaluated with an unpaired Student’s t test for comparison between 2 groups or by ANOVA for multiple comparisons. A value of P<0.05 was considered significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
MI Increases Expression of SDF-1 in the Infarct Border Zone
We determined the temporal expression of SDF-1 mRNA in the left ventricle after MI by quantitative RT-PCR. SDF-1 increased by 56.7±12.7% and 95.7±29.5% at 48 and 72 hours, respectively, after MI (P<0.05) and returned to baseline by 7 days (Figure 1A). ELISAs showed a significant increase in the left ventricular SDF-1 protein level after MI, which peaked at 410.6±57.9% at 72 hours (P<0.01) and remained >2-fold elevated over baseline at 96 hours (P<0.05). Conversely, the serum level of SDF-1 as measured by ELISA was significantly decreased at 48 hours (31.9±3.4%, P<0.05) and 72 hours (25.9±6.8%, P<0.05) but returned to baseline by 96 hours (Figure 1B). By immunohistochemistry, both cardiomyocytes and blood vessels in the infarct and border zones expressed SDF-1, in contrast to the remote areas of myocardium (Figure 1C).



View larger version (57K):
[in this window]
[in a new window]
 
Figure 1. SDF-1 upregulation in infarcted myocardium. A, Relative mRNA level of SDF-1 in infarcted animals vs sham over time shows 95.7±29.5% increase in SDF-1 copy number at 72 hours (*P<0.05) that normalized by 7 days. B, ELISA for SDF-1 shows 410.6±57.9% increase in left ventricle (*P<0.01) and 25.9±6.8% decrease in serum (*P<0.05) at 72 hours. C, Immunohistochemical staining of SDF-1 (brown) in peri-infarct myocytes and blood vessels (left) and higher-magnification view of border-zone vessel (middle) but not in remote areas of myocardium (right). Abbreviations are as defined in text.

AdV-Mediated SDF-1 Expression
Transduction of the myocardium with AdV.SDF resulted in a 2.5-fold increase of SDF-1 mRNA compared with AdV.CONT (P<0.01, n=8; Figure 2). The level of SDF-1 protein expression by ELISA after direct myocardial injection of AdV.SDF was significantly increased in cardiac tissue, but there was no increase in SDF-1 levels in the liver or serum, consistent with targeted delivery to the myocardium.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 2. A, Effect of AdV.SDF transduction on cardiac muscle (black) compared with AdV.CONT (white) mRNA SDF-1 expression. *P<0.01 for cardiac muscle. B, ELISA for SDF-1 tissue and serum levels 48 hours after AdV.SDF (black), AdV.CONT (gray), or PBS direct myocardial injection (white); *P<0.01 vs AdV.CONT and PBS. Abbreviations are as defined in text.

BMSC CXCR4 Expression and Migration
FACS analysis of Lin– BMCs showed high surface expression of CXCR4 compared with an isotype control, 65.5±2.7% (Figure 3A). The ability to block SDF-1–induced chemotaxis was assessed with the CXCR4 inhibitor AMD3100. Incubation with AMD3100 (5 µg/mL) inhibited migration by 91.5±2.2% compared with control cells (P<0.01, Figure 3B).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 3. A, Immunofluorescence flow cytometry (semilog plot) of Lin– murine BM cells for CXCR4 (solid line), negative IgG isotype control (dashed line), and unstained cells (filled). Results are shown as fluorescence histograms with relative cell number and fluorescence intensity (FL2-H). BMCs were positive by 65.5±2.7% for CXCR4. B, Chemotaxis of BMCs toward 100 ng/mL SDF in absence and presence of CXCR4 receptor inhibitor AMD3100. Chemotaxis is represented as mean number of cells migrated into bottom chamber. AMD3100 inhibited 91.5±2.2% of SDF-1–induced migration (*P<0.01). Abbreviations are as defined in text.

SDF-1 Mediates Injury-Induced Homing
The percentage of donor BMCs in recipient tissue was calculated by real-time PCR to quantify the copy number of GFP (donor-specific) versus GAPDH genes in extracted genomic DNA. Values were derived by using a standard curve generated from mixtures of donor and recipient DNAs. MI resulted in an 80.4±15.6% increase in the homing of Lin– cells to the left ventricle after intravenous administration (P<0.01 vs control; Figure 4). Blockade of the SDF-1/CXCR4 interaction with AMD3100 after MI reduced homing by 64.2±5.5% (P<0.05), suggesting that SDF-1 is a major required factor in injury-induced homing. Further supporting this, overexpression of SDF-1 in the peri-infarct region by Ad.SDF-1 delivery 48 hours after MI increased homing to the left ventricle an additional 2-fold over MI alone (P<0.01 vs infarct). In contrast, SDF-1 overexpression by AdV.SDF-1 delivery in the absence of MI had no effect (P=NS), strongly suggesting that SDF-1 is required, but not sufficient, for SC recruitment to the heart.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 4. Detection of donor GFP+ BMCs in recipient SCID left ventricle by PCR of genomic DNA. SDF in absence of injury did not result in increase in GFP cell accumulation. Infarction increased accumulation of GFP cells, and infarction plus exogenous SDF caused further significant increase. Neutralization of CXCR4 by AMD3100 significantly inhibited homing of GFP cells. Probability values as depicted. Data summarize 2 experiments (n=21 mice). INF indicates infarction; AMD, AMD3100. All other abbreviations are as defined in text.

MI and SDF-1 Transduction Effects of Gene Expression
By quantitative RT-PCR, expression of CXCR4, VCAM-1, ICAM-1, VEGF, and MMP-9 was increased in the left ventricle after MI (P<0.05), with the greatest increase in MMP-9. SCF expression was unchanged (Figure 5A). Although VEGF levels in the entire left ventricle were increased after MI, VEGF was not increased when only the infarct and per-infarct regions were analyzed. This finding was in contrast to expression of the other genes, which were more upregulated in the immediate peri-infarct area compared with the entire left ventricle (data not shown). SDF-1 overexpression by AdV.SDF in the absence of injury resulted in an increase in both VEGF mRNA and protein (Figure 5B) (P<0.05 vs AdV.CONT) but did not affect the other factors.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. A, Gene expression after MI evaluated by RT-PCR. *P<0.05 vs sham-operated animals. PI indicates peri-infarct. B, SDF-1–induced upregulation of VEGF mRNA by RT-PCR and VEGF protein by ELISA. *P<0.05. All other abbreviations are as defined in text.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Herein we establish that SDF-1 is required for post-MI recruitment of SCs to the heart and that forced overexpression of SDF-1 can augment SC homing after infarction. Although SDF-1 is required, it is not sufficient for SC homing, a finding that has significant implications concerning the potential clinical settings in which SDF-1 could be used to augment SC recruitment to the heart.

That SDF-1 is not singularly sufficient reflects the need for concomitant expression of additional factors. We contend that SC recruitment is a 2-step process that begins with binding of SCs to adhesive complexes in the vasculature around an injury zone, followed by local chemotaxis to the site of engraftment. We have corroborated SDF-1 expression in the vasculature. SDF-1 could serve an adhesive function in this context by binding CXCR4-expressing cells to the vessel wall. We have also demonstrated VCAM and ICAM upregulation after MI, and these molecules have previously been shown to be important in SC recruitment.23–25 That SDF-1 expression alone did not increase VCAM and ICAM may explain why SDF-1 is not sufficient as a singular agent. In our view, it will be important to fully delineate the repertoire of adhesion complex alterations that occur in the setting of tissue injury to fully understand the recruitment process.

We contend that SDF-1 is of primary importance in mediating local chemotaxis of SCs. In support of this concept, we found that SDF-1 is significantly increased after MI and most highly expressed in the peri-infarct zone, the area to which BMDCs are recruited.9 Interestingly, we also found that serum levels of SDF-1 were decreased 48 to 72 hours after MI. In patients, SDF-1 plasma levels decrease with unstable angina, consistent with our findings.16 Other groups have reported an increase in plasma SDF-1 within 24 hours after vascular injury in mice.14 This discrepancy in SDF-1 serum levels may relate to the type of injury or may represent an early, transient increase, as we did not evaluate SDF-1 levels before 48 hours. SDF-1 expression increases in the injured vasculature, contributing to the recruitment of circulating progenitor cells into the neointima during intimal hyperplasia.14 In a related scenario, patients treated with G-CSF with or without peripheral blood mononuclear cell infusion develop both an improvement of ventricular function and a high rate of in-stent restenosis.18 This could be due to recruitment of other CXCR4-expressing cell types, including mature blood cells such as lymphocytes, monocytes, megakaryocytes, and platelets.26,27 G-CSF also upregulates expression of the CXCR4 receptor.28

One explanation for the decrease in SDF-1 levels in unstable angina and MI is that SDF-1 is degraded by MMPs.28,29 Patients with acute coronary syndromes have elevated levels of MMP-2 and MMP-9.30 We found a >20-fold increase in MMP-9 in the murine heart after MI. Matrix turnover is a prominent component of post-MI remodeling, and MMP-9–mediated matrix alterations may create a favorable tissue environment for SC migration. MMP-9 also plays documented roles in SDF-1 degradation and SC mobilization from the marrow. Furthermore, in the setting of liver injury, MMP-9 is associated with increased CXCR4 expression on CD34+ cells, and MMP inhibitors reduce homing of these cells to the liver.13,31 How the prominent post-MI increase in MMP-9 expression that we found affects SC recruitment to the heart remains unclear.

The purpose of our study was to determine the role of SDF-1 in BMDC recruitment to the myocardium in the setting of acute MI. We intravenously delivered Lin– BMCs from genomically distinct mice and identified donor cells by PCR. We did not observe homing in response to SDF-1 in the absence of injury, but in the presence of injury, further expression of SDF-1 resulted in a significant additional increase in donor-cell accumulation. Our work contributes to the work by Askari et al,17 who evaluated the effects of stable expression of SDF-1 in a model of ischemic cardiomyopathy. They demonstrated that overexpression of SDF-1 in the myocardium 8 weeks after MI, when intrinsic levels of SDF-1 are comparable to those of controls, followed by administration of granulocyte colony stimulating factor, led to an increase in cell proliferation. Double staining for SC markers such as CD34 and CD117 was used as indirect evidence that the proliferating cells were of BM origin.

In summary, this is the first study to show that SDF-1 plays a major role in the accumulation of SCs in the heart after MI and can further increase homing when given by gene delivery after injury.


*    Acknowledgments
 
This work was funded by National Institutes of Health grants HL64001 (to F.J.G.), HL63770 (to F.J.G.), DK61846 (to D.S.K.), and T32 HL07950 (to J.D.A.).


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Orlic D, Kajstura J, Chimenti S, et al. Bone marrow cells regenerate infarcted myocardium. Nature. 2001; 410: 701–705.[CrossRef][Medline] [Order article via Infotrieve]

2. Balsam LB, Wagers AJ, Christensen JL, et al. Haematopoietic stem cells adopt mature haematopoietic fates in ischaemic myocardium. Nature. 2004; 428: 668–673.[CrossRef][Medline] [Order article via Infotrieve]

3. Murry CE, Soonpaa MH, Reinecke H, et al. Haematopoietic stem cells do not transdifferentiate into cardiac myocytes in myocardial infarcts. Nature. 2004; 428: 664–668.[CrossRef][Medline] [Order article via Infotrieve]

4. Rehman J, Li J, Orschell CM, et al. Peripheral blood ‘endothelial progenitor cells’ are derived from monocyte/macrophages and secrete angiogenic growth factors. Circulation. 2003; 107: 1164–1169.[Abstract/Free Full Text]

5. Perin EC, Dohmann HF, Borojevic R, et al. Transendocardial, autologous bone marrow cell transplantation for severe, chronic ischemic heart failure [comment]. Circulation. 2003; 107: 2294–2302.[Abstract/Free Full Text]

6. Assmus B, Schachinger V, Teupe C, et al. Transplantation of Progenitor Cells and Regeneration Enhancement in Acute Myocardial Infarction (TOPCARE-AMI). Circulation. 2002; 106: 3009–3017.[Abstract/Free Full Text]

7. Shintani S, Murohara T, Ikeda H, et al. Mobilization of endothelial progenitor cells in patients with acute myocardial infarction. Circulation. 2001; 103: 2776–2779.[Abstract/Free Full Text]

8. Gill M, Dias S, Hattori K, et al. Vascular trauma induces rapid but transient mobilization of VEGFR2+AC133+ endothelial precursor cells. Circ Res. 2001; 88: 167–174.[Abstract/Free Full Text]

9. Jackson KA, Majka SM, Wang H, et al. Regeneration of ischemic cardiac muscle and vascular endothelium by adult stem cells. J Clin Invest. 2001; 107: 1395–1402.[CrossRef][Medline] [Order article via Infotrieve]

10. Kawamoto A, Gwon HC, Iwaguro H, et al. Therapeutic potential of ex vivo expanded endothelial progenitor cells for myocardial ischemia. Circulation. 2001; 103: 634–637.[Abstract/Free Full Text]

11. Yeh ET, Zhang S, Wu H, et al. Transdifferentiation of human peripheral blood CD34+-enriched cell population into cardiomyocytes, endothelial cells, and smooth muscle cells in vivo. Circulation. 2003; 108: 2070–2074.[Abstract/Free Full Text]

12. Peled A, Petit I, Kollet O, et al. Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4. Science. 1999; 283: 845–848.[Abstract/Free Full Text]

13. Kollet O, Shivtiel S, Chen YQ, et al. HGF, SDF-1, and MMP-9 are involved in stress-induced human CD34+ stem cell recruitment to the liver. J Clin Invest. 2003; 112: 160–169.[CrossRef][Medline] [Order article via Infotrieve]

14. Schober A, Knarren S, Lietz M, et al. Crucial role of stromal cell-derived factor-1{alpha} in neointima formation after vascular injury in apolipoprotein E-deficient mice. Circulation. 2003; 108: 2491–2497.[Abstract/Free Full Text]

15. Abi-Younes S, Sauty A, Mach F, et al. The stromal cell-derived factor-1 chemokine is a potent platelet agonist highly expressed in atherosclerotic plaques. Circ Res. 2000; 86: 131–138.[Abstract/Free Full Text]

16. Damas JK, Waehre T, Yndestad A, et al. Stromal cell-derived factor-1{alpha} in unstable angina: potential antiinflammatory and matrix-stabilizing effects. Circulation. 2002; 106: 36–42.[Abstract/Free Full Text]

17. Askari AT, Unzek S, Popovic ZB, et al. Effect of stromal-cell-derived factor 1 on stem-cell homing and tissue regeneration in ischaemic cardiomyopathy [comment]. Lancet. 2003; 362: 697–703.[CrossRef][Medline] [Order article via Infotrieve]

18. Kang HJ, Kim HS, Zhang SY, et al. Effects of intracoronary infusion of peripheral blood stem-cells mobilised with granulocyte-colony stimulating factor on left ventricular systolic function and restenosis after coronary stenting in myocardial infarction: the MAGIC cell randomised clinical trial. Lancet. 2004; 363: 751–756.[CrossRef][Medline] [Order article via Infotrieve]

19. Yamaguchi J, Kusano KF, Masuo O, et al. Stromal cell-derived factor-1 effects on ex vivo expanded endothelial progenitor cell recruitment for ischemic neovascularization. Circulation. 2003; 107: 1322–1328.[Abstract/Free Full Text]

20. Giordano FJ, Ping P, McKirnan MD, et al. Intracoronary gene transfer of fibroblast growth factor-5 increases blood flow and contractile function in an ischemic region of the heart [comment]. Nat Med. 1996; 2: 534–539.[CrossRef][Medline] [Order article via Infotrieve]

21. Chen J, Kubalak SW, Minamisawa S, et al. Selective requirement of myosin light chain 2v in embryonic heart function. J Biol Chem. 1998; 273: 1252–1256.[Abstract/Free Full Text]

22. Hatse S, Princen K, Bridger G, et al. Chemokine receptor inhibition by AMD3100 is strictly confined to CXCR4. FEBS Lett. 2002; 527: 255–262.[CrossRef][Medline] [Order article via Infotrieve]

23. Vermeulen M, Le Pesteur F, Gagnerault MC, et al. Role of adhesion molecules in the homing and mobilization of murine hematopoietic stem and progenitor cells. Blood. 1998; 92: 894–900.[Abstract/Free Full Text]

24. Frenette PS, Subbarao S, Mazo IB, et al. Endothelial selectins and vascular cell adhesion molecule-1 promote hematopoietic progenitor homing to bone marrow [comment]. Proc Natl Acad Sci U S A. 1998; 95: 14423–14428.[Abstract/Free Full Text]

25. Peled A, Grabovsky V, Habler L, et al. The chemokine SDF-1 stimulates integrin-mediated arrest of CD34+ cells on vascular endothelium under shear flow. J Clin Invest. 1999; 104: 1199–1211.[Medline] [Order article via Infotrieve]

26. Mohle R, Rafii S, Moore MA. The role of endothelium in the regulation of hematopoietic stem cell migration. Stem Cells. 1998; 16: 159–165.[Medline] [Order article via Infotrieve]

27. Loetscher M, Geiser T, O’Reilly T, et al. Cloning of a human seven-transmembrane domain receptor, LESTR, that is highly expressed in leukocytes. J Biol Chem. 1994; 269: 232–237.[Abstract/Free Full Text]

28. Petit I, Szyper-Kravitz M, Nagler A, et al. G-CSF induces stem cell mobilization by decreasing bone marrow SDF-1 and up-regulating CXCR4 [erratum appears in Nat Immunol. 2002;3:787]. Nat Immunol. 2002; 3: 687–694.[CrossRef][Medline] [Order article via Infotrieve]

29. McQuibban GA, Butler GS, Gong JH, et al. Matrix metalloproteinase activity inactivates the CXC chemokine stromal cell-derived factor-1. J Biol Chem. 2001; 276: 43503–43508.[Abstract/Free Full Text]

30. Kai H, Ikeda H, Yasukawa H, et al. Peripheral blood levels of matrix metalloproteases-2 and -9 are elevated in patients with acute coronary syndromes. J Am Coll Cardiol. 1998; 32: 368–372.[Abstract/Free Full Text]

31. Heissig B, Hattori K, Dias S, et al. Recruitment of stem and progenitor cells from the bone marrow niche requires MMP-9 mediated release of kit-ligand. Cell. 2002; 109: 625–637.[CrossRef][Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Eur Heart JHome page
K. H. Schuleri, G. S. Feigenbaum, M. Centola, E. S. Weiss, J. M. Zimmet, J. Turney, J. Kellner, M. M. Zviman, K. E. Hatzistergos, B. Detrick, et al.
Autologous mesenchymal stem cells produce reverse remodelling in chronic ischaemic cardiomyopathy
Eur. Heart J., July 8, 2009; (2009) ehp265v1.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
I. Stroo, G. Stokman, G. J. D. Teske, S. Florquin, and J. C. Leemans
Haematopoietic stem cell migration to the ischemic damaged kidney is not altered by manipulating the SDF-1/CXCR4-axis
Nephrol. Dial. Transplant., July 1, 2009; 24(7): 2082 - 2088.
[Abstract] [Full Text] [PDF]


Home page
J Gerontol A Biol Sci Med SciHome page
J. Xu, E. T. Gonzalez, S. S. Iyer, V. Mac, A. L. Mora, R. L. Sutliff, A. Reed, K. L. Brigham, P. Kelly, and M. Rojas
Use of Senescence-Accelerated Mouse Model in Bleomycin-Induced Lung Injury Suggests That Bone Marrow-Derived Cells Can Alter the Outcome of Lung Injury in Aged Mice
J Gerontol A Biol Sci Med Sci, July 1, 2009; 64A(7): 731 - 739.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
B-C Lee, H-C Hsu, W-Y I Tseng, M-Y M Su, S-Y Chen, Y-W Wu, K-L Chien, and M-F Chen
Effect of cardiac rehabilitation on angiogenic cytokines in postinfarction patients
Heart, June 15, 2009; 95(12): 1012 - 1018.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
K. C. Young, E. Torres, K. E. Hatzistergos, D. Hehre, C. Suguihara, and J. M. Hare
Inhibition of the SDF-1/CXCR4 Axis Attenuates Neonatal Hypoxia-Induced Pulmonary Hypertension
Circ. Res., June 5, 2009; 104(11): 1293 - 1301.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Y. L. Tang, W. Zhu, M. Cheng, L. Chen, J. Zhang, T. Sun, R. Kishore, M. I. Phillips, D. W. Losordo, and G. Qin
Hypoxic Preconditioning Enhances the Benefit of Cardiac Progenitor Cell Therapy for Treatment of Myocardial Infarction by Inducing CXCR4 Expression
Circ. Res., May 22, 2009; 104(10): 1209 - 1216.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
N. Li, X. Lu, X. Zhao, F.-L. Xiang, A. Xenocostas, M. Karmazyn, and Q. Feng
Endothelial Nitric Oxide Synthase Promotes Bone Marrow Stromal Cell Migration to the Ischemic Myocardium via Upregulation of Stromal Cell-Derived Factor-1{alpha}
Stem Cells, April 1, 2009; 27(4): 961 - 970.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
K. Stellos, B. Bigalke, H. Langer, T. Geisler, A. Schad, A. Kogel, F. Pfaff, D. Stakos, P. Seizer, I. Muller, et al.
Expression of stromal-cell-derived factor-1 on circulating platelets is increased in patients with acute coronary syndrome and correlates with the number of CD34+ progenitor cells
Eur. Heart J., March 1, 2009; 30(5): 584 - 593.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
P. J. Hohensinner, C. Kaun, K. Rychli, A. Niessner, S. Pfaffenberger, G. Rega, A. Furnkranz, P. Uhrin, J. Zaujec, T. Afonyushkin, et al.
The inflammatory mediator oncostatin M induces stromal derived factor-1 in human adult cardiac cells
FASEB J, March 1, 2009; 23(3): 774 - 782.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
D. C. Vela, G. V. Silva, J. A.R. Assad, A. L.S. Sousa, S. Coulter, M. R. Fernandes, E. C. Perin, J. T. Willerson, and L. M. Buja
Histopathological Study of Healing After Allogenic Mesenchymal Stem Cell Delivery in Myocardial Infarction in Dogs
J. Histochem. Cytochem., February 1, 2009; 57(2): 167 - 176.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
S. Brunner, J. Winogradow, B. C. Huber, M.-M. Zaruba, R. Fischer, R. David, G. Assmann, N. Herbach, R. Wanke, J. Mueller-Hoecker, et al.
Erythropoietin administration after myocardial infarction in mice attenuates ischemic cardiomyopathy associated with enhanced homing of bone marrow-derived progenitor cells via the CXCR-4/SDF-1 axis
FASEB J, February 1, 2009; 23(2): 351 - 361.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
W. Wojakowski, M. Tendera, M. Kucia, E. Zuba-Surma, E. Paczkowska, J. Ciosek, M. Halasa, M. Krol, M. Kazmierski, P. Buszman, et al.
Mobilization of bone marrow-derived Oct-4+ SSEA-4+ very small embryonic-like stem cells in patients with acute myocardial infarction.
J. Am. Coll. Cardiol., January 6, 2009; 53(1): 1 - 9.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J.-S. Lin, Y.-S. Chen, H.-S. Chiang, and M.-C. Ma
Hypoxic preconditioning protects rat hearts against ischaemia-reperfusion injury: role of erythropoietin on progenitor cell mobilization
J. Physiol., December 1, 2008; 586(23): 5757 - 5769.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. S. Penn and A. A. Mangi
Genetic Enhancement of Stem Cell Engraftment, Survival, and Efficacy
Circ. Res., June 20, 2008; 102(12): 1471 - 1482.
[Abstract] [Full Text] [PDF]


Home page
JNMHome page
P. Misra, D. Lebeche, H. Ly, M. Schwarzkopf, G. Diaz, R. J. Hajjar, A. D. Schecter, and J. V. Frangioni
Quantitation of CXCR4 Expression in Myocardial Infarction Using 99mTc-Labeled SDF-1{alpha}
J. Nucl. Med., June 1, 2008; 49(6): 963 - 969.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
R. Ray, C. M. Herring, T. A. Markel, P. R. Crisostomo, M. Wang, B. Weil, T. Lahm, and D. R. Meldrum
Deleterious effects of endogenous and exogenous testosterone on mesenchymal stem cell VEGF production
Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2008; 294(5): R1498 - R1503.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. Saxena, J. E. Fish, M. D. White, S. Yu, J. W.P. Smyth, R. M. Shaw, J. M. DiMaio, and D. Srivastava
Stromal Cell-Derived Factor-1{alpha} Is Cardioprotective After Myocardial Infarction
Circulation, April 29, 2008; 117(17): 2224 - 2231.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Z. Mallat
PI3K{gamma} Helps an SDF Seeking Home ... for EPCs
Circ. Res., April 25, 2008; 102(8): 871 - 872.
[Full Text] [PDF]


Home page
Circ. Res.Home page
E. Chavakis, G. Carmona, C. Urbich, S. Gottig, R. Henschler, J. M. Penninger, A. M. Zeiher, T. Chavakis, and S. Dimmeler
Phosphatidylinositol-3-Kinase-{gamma} Is Integral to Homing Functions of Progenitor Cells
Circ. Res., April 25, 2008; 102(8): 942 - 949.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Tillmanns, M. Rota, T. Hosoda, Y. Misao, G. Esposito, A. Gonzalez, S. Vitale, C. Parolin, S. Yasuzawa-Amano, J. Muraski, et al.
Formation of large coronary arteries by cardiac progenitor cells
PNAS, February 5, 2008; 105(5): 1668 - 1673.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
K. Stellos, H. Langer, K. Daub, T. Schoenberger, A. Gauss, T. Geisler, B. Bigalke, I. Mueller, M. Schumm, I. Schaefer, et al.
Platelet-Derived Stromal Cell-Derived Factor-1 Regulates Adhesion and Promotes Differentiation of Human CD34+ Cells to Endothelial Progenitor Cells
Circulation, January 15, 2008; 117(2): 206 - 215.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
W Wojakowski, M Kucia, M Kazmierski, M Z Ratajczak, and M Tendera
Circulating progenitor cells in stable coronary heart disease and acute coronary syndromes: relevant reparatory mechanism?
Heart, January 1, 2008; 94(1): 27 - 33.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
C. Valina, K. Pinkernell, Y.-H. Song, X. Bai, S. Sadat, R. J. Campeau, T. H. Le Jemtel, and E. Alt
Intracoronary administration of autologous adipose tissue-derived stem cells improves left ventricular function, perfusion, and remodelling after acute myocardial infarction
Eur. Heart J., November 1, 2007; 28(21): 2667 - 2677.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
G. Chamberlain, J. Fox, B. Ashton, and J. Middleton
Concise Review: Mesenchymal Stem Cells: Their Phenotype, Differentiation Capacity, Immunological Features, and Potential for Homing
Stem Cells, November 1, 2007; 25(11): 2739 - 2749.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
V. F.M. Segers, T. Tokunou, L. J. Higgins, C. MacGillivray, J. Gannon, and R. T. Lee
Local Delivery of Protease-Resistant Stromal Cell Derived Factor-1 for Stem Cell Recruitment After Myocardial Infarction
Circulation, October 9, 2007; 116(15): 1683 - 1692.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. Zhang, N. Mal, M. Kiedrowski, M. Chacko, A. T. Askari, Z. B. Popovic, O. N. Koc, and M. S. Penn
SDF-1 expression by mesenchymal stem cells results in trophic support of cardiac myocytes after myocardial infarction
FASEB J, October 1, 2007; 21(12): 3197 - 3207.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
A. Y. Sheikh, S.-A. Lin, F. Cao, Y. Cao, K. E.A. van der Bogt, P. Chu, C.-P. Chang, C. H. Contag, R. C. Robbins, and J. C. Wu
Molecular Imaging of Bone Marrow Mononuclear Cell Homing and Engraftment in Ischemic Myocardium
Stem Cells, October 1, 2007; 25(10): 2677 - 2684.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. Xu, A. Mora, H. Shim, A. Stecenko, K. L. Brigham, and M. Rojas
Role of the SDF-1/CXCR4 Axis in the Pathogenesis of Lung Injury and Fibrosis
Am. J. Respir. Cell Mol. Biol., September 1, 2007; 37(3): 291 - 299.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
X. Hu, S. Dai, W.-J. Wu, W. Tan, X. Zhu, J. Mu, Y. Guo, R. Bolli, and G. Rokosh
Stromal Cell Derived Factor-1{alpha} Confers Protection Against Myocardial Ischemia/Reperfusion Injury: Role of the Cardiac Stromal Cell Derived Factor-1{alpha} CXCR4 Axis
Circulation, August 7, 2007; 116(6): 654 - 663.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. E. Ip, Y. Wu, J. Huang, L. Zhang, R. E. Pratt, and V. J. Dzau
Mesenchymal Stem Cells Use Integrin beta1 Not CXC Chemokine Receptor 4 for Myocardial Migration and Engraftment
Mol. Biol. Cell, August 1, 2007; 18(8): 2873 - 2882.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
J. Joseph
The stem cell army in heart failure: do we mobilize or pave the way home?
Eur. Heart J., May 5, 2007; (2007) ehm155v1.
[Full Text] [PDF]


Home page
Eur Heart JHome page
H. D. Theiss, R. David, M. G. Engelmann, A. Barth, K. Schotten, M. Naebauer, B. Reichart, G. Steinbeck, and W.-M. Franz
Circulation of CD34+ progenitor cell populations in patients with idiopathic dilated and ischaemic cardiomyopathy (DCM and ICM)
Eur. Heart J., May 2, 2007; 28(10): 1258 - 1264.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
J. Chan, S. N. Waddington, K. O'Donoghue, H. Kurata, P. V. Guillot, C. Gotherstrom, M. Themis, J. E. Morgan, and N. M. Fisk
Widespread Distribution and Muscle Differentiation of Human Fetal Mesenchymal Stem Cells After Intrauterine Transplantation in Dystrophic mdx Mouse
Stem Cells, April 1, 2007; 25(4): 875 - 884.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Zhang, E. Shpall, J. T. Willerson, and E. T.H. Yeh
Fusion of Human Hematopoietic Progenitor Cells and Murine Cardiomyocytes Is Mediated by {alpha}4{beta}1 Integrin/Vascular Cell Adhesion Molecule-1 Interaction
Circ. Res., March 16, 2007; 100(5): 693 - 702.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
R. J. Lee, Q. Fang, P. A. Davol, Y. Gu, R. E. Sievers, R. C. Grabert, J. M. Gall, E. Tsang, M. S. Yee, H. Fok, et al.
Antibody Targeting of Stem Cells to Infarcted Myocardium
Stem Cells, March 1, 2007; 25(3): 712 - 717.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. Honold, R. Lehmann, C. Heeschen, D. H. Walter, B. Assmus, K.-I. Sasaki, H. Martin, J. Haendeler, A. M. Zeiher, and S. Dimmeler
Effects of Granulocyte Colony Stimulating Factor on Functional Activities of Endothelial Progenitor Cells in Patients With Chronic Ischemic Heart Disease
Arterioscler. Thromb. Vasc. Biol., October 1, 2006; 26(10): 2238 - 2243.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Y. Wu, J. E. Ip, J. Huang, L. Zhang, K. Matsushita, C.-C. Liew, R. E. Pratt, and V. J. Dzau
Essential Role of ICAM-1/CD18 in Mediating EPC Recruitment, Angiogenesis, and Repair to the Infarcted Myocardium
Circ. Res., August 4, 2006; 99(3): 315 - 322.
[Abstract] [Full Text] [PDF]


Home page
Ann. Thorac. Surg.Home page
S. Mieno, M. Boodhwani, B. Ramlawi, J. Li, J. Feng, C. Bianchi, R. J. Laham, J. Li, and F. W. Sellke
Human Coronary Microvascular Effects of Cardioplegia-Induced Stromal-Derived Factor-1{alpha}
Ann. Thorac. Surg., August 1, 2006; 82(2): 657 - 663.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
R. S. Ripa, Y. Wang, E. Jorgensen, H. E. Johnsen, B. Hesse, and J. Kastrup
Intramyocardial injection of vascular endothelial growth factor-A165 plasmid followed by granulocyte-colony stimulating factor to induce angiogenesis in patients with severe chronic ischaemic heart disease
Eur. Heart J., August 1, 2006; 27(15): 1785 - 1792.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
Y. Misao, G. Takemura, M. Arai, T. Ohno, H. Onogi, T. Takahashi, S. Minatoguchi, T. Fujiwara, and H. Fujiwara
Importance of recruitment of bone marrow-derived CXCR4+ cells in post-infarct cardiac repair mediated by G-CSF
Cardiovasc Res, August 1, 2006; 71(3): 455 - 465.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. Mieno, B. Ramlawi, M. Boodhwani, R. T. Clements, K. Minamimura, T. Maki, S.-H. Xu, C. Bianchi, J. Li, and F. W. Sellke
Role of Stromal-Derived Factor-1{alpha} in the Induction of Circulating CD34+CXCR4+ Progenitor Cells After Cardiac Surgery.
Circulation, July 4, 2006; 114(1 Suppl): 186 - 192.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H.-J. Kang, H.-Y. Lee, S.-H. Na, S.-A Chang, K.-W. Park, H.-K. Kim, S.-Y. Kim, H.-J. Chang, W. Lee, W. J. Kang, et al.
Differential Effect of Intracoronary Infusion of Mobilized Peripheral Blood Stem Cells by Granulocyte Colony-Stimulating Factor on Left Ventricular Function and Remodeling in Patients With Acute Myocardial Infarction Versus Old Myocardial Infarction: The MAGIC Cell-3-DES Randomized, Controlled Trial
Circulation, July 4, 2006; 114(1_suppl): I-145 - I-151.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
H. Yu, K. Sliedregt-Bol, H. Overkleeft, G. A. van der Marel, T. J.C. van Berkel, and E. A.L. Biessen
Therapeutic Potential of a Synthetic Peptide Inhibitor of Nuclear Factor of Activated T Cells as Antirestenotic Agent
Arterioscler. Thromb. Vasc. Biol., July 1, 2006; 26(7): 1531 - 1537.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
Y Wang, H E Johnsen, S Mortensen, L Bindslev, R Sejersten Ripa, M Haack-Sorensen, E Jorgensen, W Fang, and J Kastrup
Changes in circulating mesenchymal stem cells, stem cell homing factor, and vascular growth factors in patients with acute ST elevation myocardial infarction treated with primary percutaneous coronary intervention
Heart, June 1, 2006; 92(6): 768 - 774.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
T. Freyman, G. Polin, H. Osman, J. Crary, M. Lu, L. Cheng, M. Palasis, and R. L. Wilensky
A quantitative, randomized study evaluating three methods of mesenchymal stem cell delivery following myocardial infarction
Eur. Heart J., May 1, 2006; 27(9): 1114 - 1122.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L.-N. Zhang, D. W. Wilson, V. da Cunha, M. E. Sullivan, R. Vergona, J. C. Rutledge, and Y.-X. Wang
Endothelial NO Synthase Deficiency Promotes Smooth Muscle Progenitor Cells in Association With Upregulation of Stromal Cell-Derived Factor-1{alpha} in a Mouse Model of Carotid Artery Ligation
Arterioscler. Thromb. Vasc. Biol., April 1, 2006; 26(4): 765 - 772.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
S. Francois, M. Bensidhoum, M. Mouiseddine, C. Mazurier, B. Allenet, A. Semont, J. Frick, A. Sache, S. Bouchet, D. Thierry, et al.
Local Irradiation Not Only Induces Homing of Human Mesenchymal Stem Cells at Exposed Sites but Promotes Their Widespread Engraftment to Multiple Organs: A Study of Their Quantitative Distribution After Irradiation Damage
Stem Cells, April 1, 2006; 24(4): 1020 - 1029.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
D. Zohlnhofer, I. Ott, J. Mehilli, K. Schomig, F. Michalk, T. Ibrahim, G. Meisetschlager, J. von Wedel, H. Bollwein, M. Seyfarth, et al.
Stem Cell Mobilization by Granulocyte Colony-Stimulating Factor in Patients With Acute Myocardial Infarction: A Randomized Controlled Trial
JAMA, March 1, 2006; 295(9): 1003 - 1010.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
J. Leor, E. Guetta, M. S. Feinberg, H. Galski, I. Bar, R. Holbova, L. Miller, P. Zarin, D. Castel, I. M. Barbash, et al.
Human Umbilical Cord Blood-Derived CD133+ Cells Enhance Function and Repair of the Infarcted Myocardium
Stem Cells, March 1, 2006; 24(3): 772 - 780.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
W. Wojakowski, M. Tendera, A. Zebzda, A. Michalowska, M. Majka, M. Kucia, K. Maslankiewicz, R. Wyderka, M. Krol, A. Ochala, et al.
Mobilization of CD34+, CD117+, CXCR4+, c-met+ stem cells is correlated with left ventricular ejection fraction and plasma NT-proBNP levels in patients with acute myocardial infarction
Eur. Heart J., February 1, 2006; 27(3): 283 - 289.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
Y. Misao, G. Takemura, M. Arai, S. Sato, K. Suzuki, S. Miyata, K.-i. Kosai, S. Minatoguchi, T. Fujiwara, and H. Fujiwara
Bone marrow-derived myocyte-like cells and regulation of repair-related cytokines after bone marrow cell transplantation
Cardiovasc Res, February 1, 2006; 69(2): 476 - 490.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Muta, G. Matsumoto, E. Nakashima, and M. Toi
Mechanical Analysis of Tumor Growth Regression by the Cyclooxygenase-2 Inhibitor, DFU, in a Walker256 Rat Tumor Model: Importance of Monocyte Chemoattractant Protein-1 Modulation
Clin. Cancer Res., January 1, 2006; 12(1): 264 - 272.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
A. Leri, J. Kajstura, and P. Anversa
Cardiac Stem Cells and Mechanisms of Myocardial Regeneration
Physiol Rev, October 1, 2005; 85(4): 1373 - 1416.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
M. H. Yamani, N. B. Ratliff, D. J. Cook, E. M. Tuzcu, Y. Yu, R. Hobbs, G. Rincon, C. Bott-Silverman, J. B. Young, N. Smedira, et al.
Peritransplant Ischemic Injury Is Associated With Up-Regulation of Stromal Cell-Derived Factor-1
J. Am. Coll. Cardiol., September 20, 2005; 46(6): 1029 - 1035.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Lapidot, A. Dar, and O. Kollet
How do stem cells find their way home?
Blood, September 15, 2005; 106(6): 1901 - 1910.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H. Ince, M. Petzsch, H. D. Kleine, H. Eckard, T. Rehders, D. Burska, S. Kische, M. Freund, and C. A. Nienaber
Prevention of Left Ventricular Remodeling With Granulocyte Colony-Stimulating Factor After Acute Myocardial Infarction: Final 1-year Results of the Front-Integrated Revascularization and Stem Cell Liberation in Evolving Acute Myocardial Infarction by Granulocyte Colony-Stimulating Factor (FIRSTLINE-AMI) Trial
Circulation, August 30, 2005; 112(9_suppl): I-73 - I-80.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
M. Kucia, R. Reca, K. Miekus, J. Wanzeck, W. Wojakowski, A. Janowska-Wieczorek, J. Ratajczak, and M. Z. Ratajczak
Trafficking of Normal Stem Cells and Metastasis of Cancer Stem Cells Involve Similar Mechanisms: Pivotal Role of the SDF-1-CXCR4 Axis
Stem Cells, August 1, 2005; 23(7): 879 - 894.
[Abstract] [Full Text] [PDF]


Home page
Ann. Thorac. Surg.Home page
Y. L. Tang, Q. Zhao, X. Qin, L. Shen, L. Cheng, J. Ge, and M. I. Phillips
Paracrine Action Enhances the Effects of Autologous Mesenchymal Stem Cell Transplantation on Vascular Regeneration in Rat Model of Myocardial Infarction
Ann. Thorac. Surg., July 1, 2005; 80(1): 229 - 237.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. Guleng, K. Tateishi, M. Ohta, F. Kanai, A. Jazag, H. Ijichi, Y. Tanaka, M. Washida, K. Morikane, Y. Fukushima, et al.
Blockade of the Stromal Cell-Derived Factor-1/CXCR4 Axis Attenuates In vivo Tumor Growth by Inhibiting Angiogenesis in a Vascular Endothelial Growth Factor-Independent Manner
Cancer Res., July 1, 2005; 65(13): 5864 - 5871.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Zernecke, A. Schober, I. Bot, P. von Hundelshausen, E. A. Liehn, B. Mopps, M. Mericskay, P. Gierschik, E. A. Biessen, and C. Weber
SDF-1{alpha}/CXCR4 Axis Is Instrumental in Neointimal Hyperplasia and Recruitment of Smooth Muscle Progenitor Cells
Circ. Res., April 15, 2005; 96(7): 784 - 791.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
110/21/3300    most recent
01.CIR.0000147780.30124.CFv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abbott, J. D.
Right arrow Articles by Giordano, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abbott, J. D.
Right arrow Articles by Giordano, F. J.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Bone Marrow Transplantation
*Heart Attack
*Stem Cells
Related Collections
Right arrow Gene expression
Right arrow Growth factors/cytokines
Right arrow Ischemic biology - basic studies