| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2004;110:3136-3142.)
© 2004 American Heart Association, Inc.
Molecular Cardiology |
From Molecular Cardiology, Department of Internal Medicine IV, University of Frankfurt, Frankfurt, Germany (I.S., J.H., C.U., A.M.Z., S.D.); the Department of Hematology, University of Tübingen, Tübingen, Germany (T.H.B.); and the Center for Cardiovascular Development, Baylor College of Medicine, Houston, Tex (H.O., M.D.S.).
Correspondence to Stefanie Dimmeler, PhD, Molecular Cardiology, Department of Internal Medicine IV, Johann Wolfgang Goethe University of Frankfurt, Theodor-Stern Kai 7, 60590 Frankfurt am Main, Germany. E-mail dimmeler{at}em.uni-frankfurt.de
Received May 18, 2004; revision received June 22, 2004; accepted June 28, 2004.
| Abstract |
|---|
|
|
|---|
Methods and Results Human EPCs were isolated from peripheral blood. Using flow cytometry after fluorescence in situ hybridization with a telomere-specific (C3TA2)3 peptide nucleic acid probe (Flow-FISH), we found mean telomere length in untreated EPCs from healthy subjects to range between 8.5±0.2 and 11.1±0.5 kb with no change over 6 days of culture, excluding telomere erosion as one cause for premature senescence. Although mean telomere length did not differ between statin-treated and untreated EPCs, atorvastatin (0.1 µmol/L) and mevastatin (1.0 µmol/L) both led to a more than 3-fold increase in the expression of the telomere capping protein TRF2 (telomere repeat-binding factor), as shown by immunoblotting, whereas quantitative reverse transcriptionpolymerase chain reaction demonstrated no increase in TRF2 mRNA. Telomere dysfunction of EPCs was also paralleled by a 4-fold increase in the DNA damage checkpoint-kinase 2 (Chk2). Conversely, statin cotreatment or overexpression of TRF2 completely suppressed Chk2 induction. Finally, overexpression of a dominant negative mutant of the TRF2 protein abrogated statin-induced enhancement of migratory activity down to baseline values.
Conclusions Ex vivo culturing of EPCs leads to "uncapping" of telomeres, indicated by the loss of TRF2. Statin cotreatment of EPCs prevents impairment of their functional capacity by a TRF2-dependent, posttranscriptional mechanism. This is the first time a beneficial effect of statins on telomere biology has been described.
Key Words: telomere aging stem cells telomere repeat-binding factor 2
| Introduction |
|---|
|
|
|---|
| Methods |
|---|
|
|
|---|
Cell Culture
Mononuclear cells were isolated by density-gradient centrifugation with Ficoll from peripheral blood of healthy human volunteers as described previously.28 Immediately after isolation, total mononuclear cells (8x106 cells/mL medium; cell density, 2.5x106 cells/cm2) were plated on culture dishes coated with human fibronectin (Sigma) and maintained in endothelial basal medium (EBM; Clonetics) supplemented with EGM SingleQuots, VEGF (100 ng/mL), and 20% FCS. More than 90% of adherent EPCs show endothelial characteristics, as demonstrated by Dil-acetylated LDL uptake and lectin binding and immunostaining of typical endothelial marker proteins, including VEGF receptor (VEGFR2) (KDR) (Relia Tech), endoglin (CD105) (NeoMarkers), and von Willebrand factor (Oncogene). Using FACS analysis, we found 94% of EPCs to stain positive for KDR, 76% for CD105, and 72% for von Willebrand factor.
Q-FISH
Endothelial cells or EPCs were incubated for 24 hours with 100 ng/mL colcemide. Nuclei were isolated by hypotonic swelling in a 60-mmol/L KCl solution and fixed in a 3:1 solution of methanol/glacial acid. Hybridization was performed with a Cy3-conjugated (C3TA2)3 peptide nucleic acid (PNA) probe (Dako) according to the manufacturers instructions. Counterstaining was performed with 4',6-diamino-2-phenylindole (DAPI; 2 µg/mL).
Determination of Human Telomere Length by Flow-FISH
The average length of telomere repeats at chromosome ends in individual peripheral blood leukocytes was measured by Flow-FISH as previously reported.2932 EPCs were detached by trypsin, and the cell suspension was centrifuged for 5 minutes at 800g. The supernatant was removed, and the cell pellets were washed twice with PBS. A total of 2x105 EPCs and 1x105 calf thymocytes (as an internal calibration standard) were resuspended together in the following hybridization mixture: 20 mmol/L Tris, 20 mmol/L NaCl, 1% BSA, 75% formamide (Invitrogen), and 0.3 µg/mL telomere-specific FITC-conjugated (C3TA2)3 PNA probe (Applied Biosystems). For background control, PNA probe was omitted from the mixture. After an initial reaction time of 10 minutes at room temperature, the DNA in the samples was denatured in a water bath for 15 minutes at 87°C. Hereafter, the samples were further incubated for an additional 2 hours at room temperature in the dark and then washed 3 times with 1 mL washing buffer A (75% formamide [AppliChem], 100 mmol/L Tris, 1% BSA, and 1% Tween) and 1 time with 1 mL washing buffer B (1% BSA, 1% Tween, 10 mmol/L HEPES, and 5% glucose). Finally, cells were resuspended in a propidium iodide solution (0.03 µg/mL) and incubated for 45 minutes at 4°C before flow cytometric analysis. Diploid cells were gated on the basis of staining with propidium iodide (R1 for human EPCs and R7 for calf thymocytes, as shown in Figure 1A). The separation between EPCs and calf thymocytes on the basis of forward light scatter and propidium iodide fluorescence was validated in experiments with purified cell suspensions. For each cell subpopulation, the specific telomere fluorescence was calculated by subtracting the mean fluorescence of the background control (no probe) from the mean fluorescence obtained from cells hybridized with the telomere probe. FITC-labeled fluorescent beads (QuantumTM-24 Premixed; Flow Cytometry Standards) were used to correct for daily shifts in the linearity of the flow cytometer and fluctuations in the laser intensity and alignment. Mean telomere length of EPCs was calculated as molecular equivalents of soluble fluorochrome (EPCs)/molecular equivalents of soluble fluorochrome (thymocytes) times the mean telomere length of thymocytes determined directly by Southern blotting.
|
Whole-Cell Extracts
Cells were washed 3 times in cold PBS and then lysed for 30 minutes at 4°C in lysis buffer containing 20 mmol/L Tris-HCl (pH 7.4), 1 mmol/L EDTA (pH 8.0), 1 mmol/L EGTA, 150 mmol/L NaCl, 1% Triton, 2.5 mmol/L Na-pyrophosphate, 1 mmol/L ß-glycerophosphate, 1 mmol/L Na-orthovanadate, and the following protease inhibitors: 200 mmol/L PMSF and 1 µg/mL leupeptin. After centrifugation at high speed, the supernatant was collected and the protein content of all samples was determined using the Bio-Rad protein assay with
-globulin as a standard.
Western Blot Analysis
Electrophoresis was performed on 12% SDS-polyacrylamide gels loading 30 µg of protein per lane. After transfer to a 0.2-µm polyvinylidene difluoride membrane (Bio-Rad), the membranes were blocked in 3% BSA (in PBS, pH 7.5, and 0.2% Tween 20) for 1 hour and incubated overnight with the indicated primary antibody (Ab) at 4°C. Each Ab incubation period was followed by 1 hour of membrane washing in 0.1% Tween-20 in PBS. Detection was performed by use of a horseradish peroxidaselinked anti-rabbit (1:7500 in PBS/1% Tween 20/2% nonfat milk), anti-goat (1:5000), or anti-mouse (1:5000 in PBS/1% Tween 20/2% nonfat milk) (secondary) Ab (Amersham) and the Amersham enhanced chemiluminescence system (ECL kit). The following primary Abs were used: ß-actin mouse monoclonal Ab (Sigma A5441; 1:8000), TRF2 H-300 rabbit polyclonal Ab (Santa Cruz sc-9143; 1:250), TRF2 goat polyclonal Ab (Santa Cruz sc-8528; 1:250), Checkpoint-kinase 2 (Chk2) mouse monoclonal Ab (Santa Cruz sc-17747; 1:250), green fluorescent protein (GFP) rabbit polyclonal Ab (Invitrogen 46-0092; 1:3000), and c-myc 9B11 mouse monoclonal Ab (Cell Signaling 2276; 1:500).
Quantitative Real-Time Reverse TranscriptionPolymerase Chain Reaction
Total RNA from 106 EPCs was isolated by the guanidinium method using Qiagens RNA extraction kit. Quantification of TRF2 mRNA was performed by amplification of EPC cDNA in a 1-step reverse transcriptionpolymerase chain reaction (RT-PCR) using the LightCycler (Roche Diagnostics) real-time thermocycler according to the instructions of the manufacturer (Roche Diagnostics). The RT-PCR reaction was composed of 3.25 mmol/L Mn(OAc)2, 1x LightCyclerRNA Master SYBR Green I, 100 ng mRNA, and 0.5 µmol/L of each primer in a final volume of 20 µL. The following oligonucleotide primers were used for amplification of human TRF2 cDNA: sense (5'
3') CCCAAGAACAAGCGCATGAC and antisense (5'
3') TTTCTGCACTCCAGCCTTGAC. Amplification was performed with 45 cycles and an annealing temperature of 61°C. Copy numbers were calculated by the instrument software (Roche Diagnostics) from standard curves of an in vitrotranscribed cytokine mRNA. The specificity of the amplification reaction was determined by a melting curve analysis. PCR products were analyzed on a 2% agarose gel to confirm a 341-bp product.
Adenoviral Constructs and Infection of EPCs
Plasmids for human TRF2 and its dominant-negative truncation (TRF2
B
M) were provided by T. de Lange (Rockefeller University, New York, NY33). Adenoviruses coexpressing enhanced GFP were generated by use of pAdTrack-cytomegalovirus and pShuttle-cytomegalovirus (provided by B. Vogelstein, Johns Hopkins Oncology Center, Baltimore, Md34,35) and have been described previously.24 If not otherwise stated, Antennapedia peptide (Antennapedia internalization sequence RQIAIWFQNRRMKWAA36) at a concentration of 0.5 mmol/L, purified adenovirus, and 100 µL of OptiMem (Gibco) were incubated for 30 minutes at room temperature. The mixture was then added to freshly isolated mononuclear cells (see Cell Culture) in a 2.5-mL volume and left together with the cells until day 3. Adenoviral infection was validated by visualization of enhanced GFP under fluorescence microscopy.
Assessment of Migratory Capacity of EPCs
After 3 days of culture, progenitor cells were resuspended in EBM without FCS, containing 1% BSA. Then 5x104 EPCs were placed in the upper chamber of a modified Boyden chamber (Falcon HTS Fluoro Blok insert, No. 351152, 8-µm pore size). The chamber was placed in a 24-well culture dish (Falcon, No. 353504) containing endothelial basal medium, 50 ng/mL VEGF, and 100 ng/mL stromal cellderived factor (SDF)-1 (where indicated) for measuring the migratory capacity of EPCs. After 24 hours of incubation at 37°C, the lower side of the filter was washed with PBS and fixed with 2% paraformaldehyde. For quantification, cells were stained with Dil-acetylated LDL and were counted manually in 3 random microscopic fields per well.
| Results |
|---|
|
|
|---|
In situ telomere hybridization (Q-FISH) was performed to prove the specificity of the used (C3TA2)3 PNA probe in EPCs (data not shown). EPCs were analyzed in interphase. Using Flow-FISH, we found the mean telomere length in EPCs generated from different blood donors to range between 8 and 11 kb, independent of statin cotreatment (Figure 1C). We also performed longitudinal studies on isolated mononuclear cells. Here, mean telomere length did not differ between freshly isolated mononuclear cells and EPCs on days 4 and 6 (Figure 1D). These results indicating no change in mean telomere length during cell culture argue against telomere erosion as a possible cause for premature senescence in cultured EPCs from healthy subjects. In addition, because mean telomere length by itself can conceal small populations of critically shortened telomeres, we also specifically compared the potential effects of propagation and statins on the shortest length of telomeres in the Flow-FISH distribution and excluded a shift in the length distribution. Together, these findings would better support the concept of telomere dysfunction independent of critical telomere shortening, such as because of telomere uncapping.
Statins Induce TRF2 by a Posttranscriptional Mechanism
To investigate the possibility that statins might, instead, have salutary effects on telomere-associated proteins in cultured EPCs, we first examined the protein expression of the specific TRFs. Although expression of TRF1 did not change under statin treatment (data not shown), TRF2 was induced more than 3-fold by atorvastatin or mevastatin, in a dose-dependent manner, after 3 days of cultivation (Figure 2, A and B), and induction reached its maximum at 0.1 µmol/L and 1.0 µmol/L, respectively. Simvastatin (data not shown) had an identical effect on TRF2 expression at a concentration of
0.5 µmol/L. To obtain this effect, which was consistent among each of 3 healthy blood donors (Figure 2, A and B), statin incubation had to be initiated in the first 24 hours after isolation of mononuclear cells (Figure 2C). Addition of atorvastatin at later time points did not lead to an increase of TRF2 expression.
|
We previously showed that statins inhibit premature senescence in EPCs by preventing formation of mevalonate and the downstream products farnesylpyrophosphate (FPP) and geranylgeranylpyrophosphate (GPP).11 As shown in Figure 2D, mevalonate, FPP, and GPP partially repressed TRF2 induction by atorvastatin, indicating a mechanism involving isoprenylation. To test for induction of TRF2, we performed semiquantitative PCR using TRF2-specific oligonucleotide primers (Figure 2E). However, no statistical difference in TRF2 mRNA expression could be seen among the statin-treated and untreated cells, suggesting an enhancement of protein translation or stability rather than mRNA induction.
Telomere Dysfunction of EPCs Leads to Chk2 Induction
Because loss of the telomere-capping protein TRF2 leads to telomere dysfunction, as measured by activation of the DNA damage protein kinase pathway, we investigated this possible downstream contender in TRF2 signaling. Activity of Chk2, a DNA damage kinase, increases accompanying partial loss of TRF2 in human myocardium during heart failure and is triggered in rat cardiomyocytes by interference with TRF2 function or expression.24 Indeed, Chk2 protein level in EPCs increases under culture conditions to more than 4-fold compared with levels in freshly isolated monocytes (Figure 3A), whereas atorvastatin, mevastatin, or simvastatin (data not shown) cotreatment completely abrogated Chk2 induction (23±6% versus 100% control; Figures 2A and 3
B). Finally, overexpression of TRF2 wild-type protein in EPCs also prevented Chk2 upregulation (Figure 3C), suggesting that Chk2 is a downstream target of telomere dysfunction induced by lack of TRF2 in EPCs.
|
Enhancement of Migratory Activity by Statins Depends on TRF2 Expression
Finally, to provide evidence that the increase in TRF2 contributes to the increased functional capacity of EPCs elicited by statins, we expressed dominant-negative TRF2 in EPCs. To achieve this, freshly isolated mononuclear cells were infected with adenoviral constructs. The validity of viral vectors was confirmed by immunoblots in the day 3 EPCs (Figure 4A). Transduced EPCs were used on day 3 for migration assays, showing an increase in basal migratory activity after coculture with 0.1 µmol/L atorvastatin from 14.2±1.9 to 33.7±2.6 cells per high-power field (HPF; P<0.001; Figure 4B) and from 48±9.5 to 112±22 cells/HPF in response to SDF-1 as the chemoattractant (P<0.05; Figure 4C). Conversely, migratory activity in atorvastatin-treated EPCs expressing dominant-negative TRF2 was reduced almost down to baseline (no statin pretreatment): 18.8±1.9 cells/HPF without SDF (P<0.001 versus Ad-GFP+atorvastatin; Figure 4B) and 53.7±3.9 cells/HPF with SDF attraction (P<0.01 versus Ad-GFP+atorvastatin; Figure 4C), respectively.
|
| Discussion |
|---|
|
|
|---|
Human telomeres are bound by 2 double-strand telomere binding proteins, TRF1 and TRF2, each of which recruits another set of interacting proteins. Removal of TRF2 triggers apoptosis or senescence and can result in fusion of the chromosome ends.33,38,39 Loss of TRF2, however, occurs in end-stage human heart failure and leads to telomere dysfunction.24 Overexpression of TRF2 and TERT is protective against oxidative stress in cultured cardiomyocytes.24 Similarly, we demonstrate that interference with TRF2 abolishes the statin-induced enhancement of the migratory capacity in EPCs. Of note, the migratory activity of EPCs reflects the most relevant parameter with regard to functional improvement after cell therapy for acute myocardial infarction.9 It is also possible that the induction of TRF2 by statins leads to "juvenation" of EPCs, because replicative senescence is delayed. Younger cells would migrate faster than older cells because of their age characteristics. In this case, TRF2 protein might correlate very well with cellular aging, thus exerting only an indirect role on cell migration.
Telomere length in human white blood cells shortens during aging.37 Interestingly, individuals with shorter white blood cell telomeres after adjustment for age show a >3-fold higher mortality rate from heart disease and more than 8-fold higher mortality rate from infectious diseases.40 Not only do environmental factors affect telomere length, but also, a recent study implies an X-chromosomelinked inheritance factor.41 Although human cells accumulate short telomeres of 2 kb or less as they approach senescence,42 the "uncapping" of telomeres, rather than shortening, is now thought to lead to activation of the senescence program.13 To exclude telomere shortening as a cause of the premature senescence in EPCs, we measured mean telomere length by the Flow-FISH method. This new technique is especially advantageous when different subpopulations of cells have to be analyzed on the basis of their scatter properties. First, mean telomere length did not vary between circulating mononuclear cells and EPCs on days 4 and 6, thus eliminating culture-induced telomere erosion as a probable cause of senescence in EPCs. Second, we found that the mean telomere length between statin-treated EPCs and untreated controls did not differ. Hence, no increase in mean telomere length occurred as an explanation of how statins favorably affect senescence in human EPCs. Nevertheless, our data cannot exclude the possibility that telomeric shortening may occur at the level of individual telomeres at the chromosome ends.
Whereas ongoing progressive erosion of telomeres is the key factor in replicative senescence, more acute conditions also cause telomere dysfunction, including oxidative stress and other signaling cascades.13,43,44 An important consequence of telomere dysfunction is activation of the ATM-dependent DNA damage pathway. We found an important DNA damage checkpoint kinase, Chk2, to be upregulated in EPCs if cultured without atorvastatin. Chk2 can phosphorylate E2F1, p53, and the polo-like kinase 3 (Plk3, alternatively called Prk). Interestingly, Plk3 can be rapidly activated by reactive oxygen species in cultured fibroblasts.4547 Chk2 itself is activated by phosphorylation, such as in cardiac myocytes failing because of telomere dysfunction.24 We found statins to suppress Chk2 induction in cultured EPCs if cells were treated within the first 24 hours. Statins have been proved to promote potent systemic antioxidant effects in vivo through suppression of different oxidation pathways, including the generation of myeloperoxidase-derived and nitric oxidederived oxidants.48 This can be attributed primarily to the inhibition of isoprenylation, which was also a prerequisite for the induction of TRF2 by statins in our study. We have recently shown that statins can delay the onset of replicative senescence simply by inhibition of the nuclear export of TERT in endothelial cells.10
The recognition that premature replicative senescence of EPCs occurs in vitro does not necessarily imply that the same phenomenon will persist in vivo after their intravenous administration. Moreover, the remaining nonsenescent cells may be more than adequate to function in vivo.
In summary, loss of an essential telomere-capping protein and the impairment of functional capacity in EPCs during propagation in culture can be prevented by treatment with statins. Exogenous TRF2 reproduces the statin effect, and a dominant-interfering mutation blocks the statin effect, implicating TRF2 in this process, albeit through effectors that remain to be defined. This is the first time a beneficial effect of statins on telomere biology has been described.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Patterson C. The Ponzo effect: endothelial progenitor cells appear on the horizon. Circulation. 2003; 107: 29952997.
3. Werner N, Junk S, Laufs U, Link A, Walenta K, Bohm M, Nickenig G. Intravenous transfusion of endothelial progenitor cells reduces neointima formation after vascular injury. Circ Res. 2003; 93: e17e24.
4. Assmus B, Schachinger V, Teupe C, Britten M, Lehmann R, Dobert N, Grunwald F, Aicher A, Urbich C, Martin H, Hoelzer D, Dimmeler S, Zeiher AM. Transplantation of Progenitor Cells and Regeneration Enhancement in Acute Myocardial Infarction (TOPCARE-AMI). Circulation. 2002; 106: 30093017.
5. Szmitko PE, Fedak PW, Weisel RD, Stewart DJ, Kutryk MJ, Verma S. Endothelial progenitor cells: new hope for a broken heart. Circulation. 2003; 107: 30933100.
6. Kawamoto A, Tkebuchava T, Yamaguchi J, Nishimura H, Yoon YS, Milliken C, Uchida S, Masuo O, Iwaguro H, Ma H, Hanley A, Silver M, Kearney M, Losordo DW, Isner JM, Asahara T. Intramyocardial transplantation of autologous endothelial progenitor cells for therapeutic neovascularization of myocardial ischemia. Circulation. 2003; 107: 461468.
7. Kawamoto A, Gwon HC, Iwaguro H, Yamaguchi JI, Uchida S, Masuda H, Silver M, Ma H, Kearney M, Isner JM, Asahara T. Therapeutic potential of ex vivo expanded endothelial progenitor cells for myocardial ischemia. Circulation. 2001; 103: 634637.
8. Vasa M, Fichtlscherer S, Aicher A, Adler K, Urbich C, Martin H, Zeiher AM, Dimmeler S. Number and migratory activity of circulating endothelial progenitor cells inversely correlate with risk factors for coronary artery disease. Circ Res. 2001; 89: e1e7.[CrossRef][Medline] [Order article via Infotrieve]
9. Britten MB, Abolmaali ND, Assmus B, Lehmann R, Honold J, Schmitt J, Vogl TJ, Martin H, Schachinger V, Dimmeler S, Zeiher AM. Infarct remodeling after intracoronary progenitor cell treatment in patients with acute myocardial infarction (TOPCARE-AMI): mechanistic insights from serial contrast-enhanced magnetic resonance imaging. Circulation. 2003; 108: 22122218.
10. Haendeler J, Hoffmann J, Diehl JF, Vasa M, Spyridopoulos I, Zeiher AM, Dimmeler S. Antioxidants inhibit nuclear export of telomerase reverse transcriptase and delay replicative senescence of endothelial cells. Circ Res. 2004; 94: 768775.
11. Assmus B, Urbich C, Aicher A, Hofmann WK, Haendeler J, Rossig L, Spyridopoulos I, Zeiher AM, Dimmeler S. HMG-CoA reductase inhibitors reduce senescence and increase proliferation of endothelial progenitor cells via regulation of cell cycle regulatory genes. Circ Res. 2003; 92: 10491055.
12. Vasa M, Fichtlscherer S, Adler K, Aicher A, Martin H, Zeiher AM, Dimmeler S. Increase in circulating endothelial progenitor cells by statin therapy in patients with stable coronary artery disease. Circulation. 2001; 103: 28852890.
13. Ben-Porath I, Weinberg RA. When cells get stressed: an integrative view of cellular senescence. J Clin Invest. 2004; 113: 813.[CrossRef][Medline] [Order article via Infotrieve]
14. Spyridopoulos I, Isner JM, Losordo DW. Oncogenic ras induces premature senescence in endothelial cells: role of p21(Cip1/Waf1). Basic Res Cardiol. 2002; 97: 117124.[CrossRef][Medline] [Order article via Infotrieve]
15. Broccoli D, Smogorzewska A, Chong L, de Lange T. Human telomeres contain two distinct Myb-related proteins, TRF1 and TRF2. Nat Genet. 1997; 17: 231235.[CrossRef][Medline] [Order article via Infotrieve]
16. Bilaud T, Brun C, Ancelin K, Koering CE, Laroche T, Gilson E. Telomeric localization of TRF2, a novel human telobox protein. Nat Genet. 1997; 17: 236239.[CrossRef][Medline] [Order article via Infotrieve]
17. Ancelin K, Brun C, Gilson E. Role of the telomeric DNA-binding protein TRF2 in the stability of human chromosome ends. Bioessays. 1998; 20: 879883.[CrossRef][Medline] [Order article via Infotrieve]
18. Griffith JD, Comeau L, Rosenfield S, Stansel RM, Bianchi A, Moss H, de Lange T. Mammalian telomeres end in a large duplex loop. Cell. 1999; 97: 503514.[CrossRef][Medline] [Order article via Infotrieve]
19. Kierszenbaum AL. Telomeres: more than chromosomal non-sticking ends. Mol Reprod Dev. 2000; 57: 23.[CrossRef][Medline] [Order article via Infotrieve]
20. Karlseder J. Telomere repeat binding factors: keeping the ends in check. Cancer Lett. 2003; 194: 189197.[CrossRef][Medline] [Order article via Infotrieve]
21. Ferreira MG, Miller KM, Cooper JP. Indecent exposure: when telomeres become uncapped. Mol Cell. 2004; 13: 718.[CrossRef][Medline] [Order article via Infotrieve]
22. Li GZ, Eller MS, Firoozabadi R, Gilchrest BA. Evidence that exposure of the telomere 3' overhang sequence induces senescence. Proc Natl Acad Sci U S A. 2003; 100: 527531.
23. Loayza D, De Lange T. POT1 as a terminal transducer of TRF1 telomere length control. Nature. 2003; 424: 10131018.[CrossRef][Medline] [Order article via Infotrieve]
24. Oh H, Wang SC, Prahash A, Sano M, Moravec CS, Taffet GE, Michael LH, Youker KA, Entman ML, Schneider MD. Telomere attrition and Chk2 activation in human heart failure. Proc Natl Acad Sci U S A. 2003; 100: 53785383.
25. Harrington L, Robinson MO. Telomere dysfunction: multiple paths to the same end. Oncogene. 2002; 21: 592597.[CrossRef][Medline] [Order article via Infotrieve]
26. Karlseder J, Smogorzewska A, de Lange T. Senescence induced by altered telomere state, not telomere loss. Science. 2002; 295: 24462449.
27. de Lange T. Protection of mammalian telomeres. Oncogene. 2002; 21: 532540.[CrossRef][Medline] [Order article via Infotrieve]
28. Urbich C, Heeschen C, Aicher A, Dernbach E, Zeiher AM, Dimmeler S. Relevance of monocytic features for neovascularization capacity of circulating endothelial progenitor cells. Circulation. 2003; 108: 25112516.
29. Baerlocher GM, Lansdorp PM. Telomere length measurements in leukocyte subsets by automated multicolor flow-FISH. Cytometry. 2003; 55A: 16.
30. Rufer N, Dragowska W, Thornbury G, Roosnek E, Lansdorp PM. Telomere length dynamics in human lymphocyte subpopulations measured by flow cytometry. Nat Biotechnol. 1998; 16: 743747.[CrossRef][Medline] [Order article via Infotrieve]
31. Brummendorf TH, Ersoz I, Hartmann U, Balabanov S, Wolke H, Paschka P, Lahaye T, Berner B, Bartolovic K, Kreil S, Berger U, Gschaidmeier H, Bokemeyer C, Hehlmann R, Dietz K, Lansdorp PM, Kanz L, Hochhaus A. Normalization of previously shortened telomere length under treatment with imatinib argues against a preexisting telomere length deficit in normal hematopoietic stem cells from patients with chronic myeloid leukemia. Ann N Y Acad Sci. 2003; 996: 2638.[Medline] [Order article via Infotrieve]
32. Brummendorf TH, Ersoz I, Hartmann U, Bartolovic K, Balabanov S, Wahl A, Paschka P, Kreil S, Lahaye T, Berger U, Gschaidmeier H, Bokemeyer C, Hehlmann R, Dietz K, Lansdorp PM, Kanz L, Hochhaus A. Telomere length in peripheral blood granulocytes reflects response to treatment with imatinib in patients with chronic myeloid leukemia. Blood. 2003; 101: 375376.
33. Karlseder J, Broccoli D, Dai Y, Hardy S, de Lange T. p53- and ATM-dependent apoptosis induced by telomeres lacking TRF2. Science. 1999; 283: 13211325.
34. Oh H, Taffet GE, Youker KA, Entman ML, Overbeek PA, Michael LH, Schneider MD. Telomerase reverse transcriptase promotes cardiac muscle cell proliferation, hypertrophy, and survival. Proc Natl Acad Sci U S A. 2001; 98: 1030810313.
35. Ramirez R, Carracedo J, Jimenez R, Canela A, Herrera E, Aljama P, Blasco MA. Massive telomere loss is an early event of DNA damage-induced apoptosis. J Biol Chem. 2003; 278: 836842.
36. Gratton JP, Yu J, Griffith JW, Babbitt RW, Scotland RS, Hickey R, Giordano FJ, Sessa WC. Cell-permeable peptides improve cellular uptake and therapeutic gene delivery of replication-deficient viruses in cells and in vivo. Nat Med. 2003; 9: 357362.[CrossRef][Medline] [Order article via Infotrieve]
37. Rufer N, Brummendorf TH, Kolvraa S, Bischoff C, Christensen K, Wadsworth L, Schulzer M, Lansdorp PM. Telomere fluorescence measurements in granulocytes and T lymphocyte subsets point to a high turnover of hematopoietic stem cells and memory T cells in early childhood. J Exp Med. 1999; 190: 157167.
38. van Steensel B, Smogorzewska A, de Lange T. TRF2 protects human telomeres from end-to-end fusions. Cell. 1998; 92: 401413.[CrossRef][Medline] [Order article via Infotrieve]
39. Smogorzewska A, de Lange T. Different telomere damage signaling pathways in human and mouse cells. EMBO J. 2002; 21: 43384348.[CrossRef][Medline] [Order article via Infotrieve]
40. Cawthon RM, Smith KR, OBrien E, Sivatchenko A, Kerber RA. Association between telomere length in blood and mortality in people aged 60 years or older. Lancet. 2003; 361: 393395.[CrossRef][Medline] [Order article via Infotrieve]
41. Nawrot T, Staessen J, Gardner J, Aviv A. Telomere length and possible link to X chromosome. Lancet. 2004; 363: 507510.[CrossRef][Medline] [Order article via Infotrieve]
42. Blackburn EH. Telomere states and cell fates. Nature. 2000; 408: 5356.[CrossRef][Medline] [Order article via Infotrieve]
43. Tchirkov A, Lansdorp PM. Role of oxidative stress in telomere shortening in cultured fibroblasts from normal individuals and patients with ataxia-telangiectasia. Hum Mol Genet. 2003; 12: 227232.
44. Parrinello S, Samper E, Krtolica A, Goldstein J, Melov S, Campisi J. Oxygen sensitivity severely limits the replicative lifespan of murine fibroblasts. Nat Cell Biol. 2003; 5: 741747.[CrossRef][Medline] [Order article via Infotrieve]
45. Stevens C, Smith L, La Thangue NB. Chk2 activates E2F-1 in response to DNA damage. Nat Cell Biol. 2003; 5: 401409.[CrossRef][Medline] [Order article via Infotrieve]
46. Matsuoka S, Huang M, Elledge SJ. Linkage of ATM to cell cycle regulation by the Chk2 protein kinase. Science. 1998; 282: 18931897.
47. Xie S, Wu H, Wang Q, Kunicki J, Thomas RO, Hollingsworth RE, Cogswell J, Dai W. Genotoxic stress-induced activation of Plk3 is partly mediated by Chk2. Cell Cycle. 2002; 1: 424429.[Medline] [Order article via Infotrieve]
48. Shishehbor MH, Brennan ML, Aviles RJ, Fu X, Penn MS, Sprecher DL, Hazen SL. Statins promote potent systemic antioxidant effects through specific inflammatory pathways. Circulation. 2003; 108: 426431.
This article has been cited by other articles:
![]() |
I. Spyridopoulos, J. Hoffmann, A. Aicher, T. H. Brummendorf, H. W. Doerr, A. M. Zeiher, and S. Dimmeler Accelerated Telomere Shortening in Leukocyte Subpopulations of Patients With Coronary Heart Disease: Role of Cytomegalovirus Seropositivity Circulation, October 6, 2009; 120(14): 1364 - 1372. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Matsumoto, V. Adams, C. Walther, C. Kleinecke, P. Brugger, A. Linke, T. Walther, F. W. Mohr, and G. Schuler Reduced number and function of endothelial progenitor cells in patients with aortic valve stenosis: a novel concept for valvular endothelial cell repair Eur. Heart J., February 1, 2009; 30(3): 346 - 355. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S.M. Wong, R. A. de Boer, N. J. Samani, D. J. van Veldhuisen, and P. van der Harst Telomere biology in heart failure Eur J Heart Fail, November 1, 2008; 10(11): 1049 - 1056. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Spyridopoulos, S. Fichtlscherer, R. Popp, S. W. Toennes, B. Fisslthaler, T. Trepels, A. Zernecke, E. A. Liehn, C. Weber, A. M. Zeiher, et al. Caffeine Enhances Endothelial Repair by an AMPK-Dependent Mechanism Arterioscler Thromb Vasc Biol, November 1, 2008; 28(11): 1967 - 1974. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mahmoudi, I. Gorenne, J. Mercer, N. Figg, T. Littlewood, and M. Bennett Statins Use a Novel Nijmegen Breakage Syndrome-1-Dependent Pathway to Accelerate DNA Repair in Vascular Smooth Muscle Cells Circ. Res., September 26, 2008; 103(7): 717 - 725. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Werner, M. Hanhoun, T. Widmann, A. Kazakov, A. Semenov, J. Poss, J. Bauersachs, T. Thum, M. Pfreundschuh, P. Muller, et al. Effects of Physical Exercise on Myocardial Telomere-Regulating Proteins, Survival Pathways, and Apoptosis J. Am. Coll. Cardiol., August 5, 2008; 52(6): 470 - 482. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. van der Harst, D. J. van Veldhuisen, and N. J. Samani Expanding the Concept of Telomere Dysfunction in Cardiovascular Disease Arterioscler Thromb Vasc Biol, May 1, 2008; 28(5): 807 - 808. [Full Text] [PDF] |
||||
![]() |
I. Spyridopoulos, Y. Erben, T. H. Brummendorf, J. Haendeler, K. Dietz, F. Seeger, C. K. Kissel, H. Martin, J. Hoffmann, B. Assmus, et al. Telomere Gap Between Granulocytes and Lymphocytes Is a Determinant for Hematopoetic Progenitor Cell Impairment in Patients With Previous Myocardial Infarction Arterioscler Thromb Vasc Biol, May 1, 2008; 28(5): 968 - 974. [Abstract] [Full Text] [PDF] |
||||
![]() |
S W Brouilette, A Whittaker, S E Stevens, P van der Harst, A H Goodall, and N J Samani Telomere length is shorter in healthy offspring of subjects with coronary artery disease: support for the telomere hypothesis Heart, April 1, 2008; 94(4): 422 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
W Wojakowski, M Kucia, M Kazmierski, M Z Ratajczak, and M Tendera Circulating progenitor cells in stable coronary heart disease and acute coronary syndromes: relevant reparatory mechanism? Heart, January 1, 2008; 94(1): 27 - 33. [Abstract] [Full Text] [PDF] |
||||
![]() |
N.-K. Hsieh and H. I. Chen Interacting Leukocytes Predict Atherosclerosis and Restenosis Stroke, December 1, 2007; 38(12): e162 - e163. [Full Text] [PDF] |
||||
![]() |
H. Oeseburg, B. D. Westenbrink, R. A. de Boer, W. H. van Gilst, D. J. van Veldhuisen, and P. van der Harst Can Critically Short Telomeres Cause Functional Exhaustion of Progenitor Cells in Postinfarction Heart Failure? J. Am. Coll. Cardiol., November 6, 2007; 50(19): 1911 - 1912. [Full Text] [PDF] |
||||
![]() |
N. Tentolouris, R. Nzietchueng, V. Cattan, G. Poitevin, P. Lacolley, A. Papazafiropoulou, D. Perrea, N. Katsilambros, and A. Benetos White Blood Cells Telomere Length Is Shorter in Males With Type 2 Diabetes and Microalbuminuria Diabetes Care, November 1, 2007; 30(11): 2909 - 2915. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. L.T. Ballard and J. M. Edelberg Stem Cells and the Regeneration of the Aging Cardiovascular System Circ. Res., April 27, 2007; 100(8): 1116 - 1127. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Fuster and V. Andres Telomere Biology and Cardiovascular Disease Circ. Res., November 24, 2006; 99(11): 1167 - 1180. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen and M. S. Goligorsky Premature senescence of endothelial cells: Methusaleh's dilemma Am J Physiol Heart Circ Physiol, May 1, 2006; 290(5): H1729 - H1739. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Sampson, M. S. Winterbone, J. C. Hughes, N. Dozio, and D. A. Hughes Monocyte Telomere Shortening and Oxidative DNA Damage in Type 2 Diabetes Diabetes Care, February 1, 2006; 29(2): 283 - 289. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. Dzau, M. Gnecchi, A. S. Pachori, F. Morello, and L. G. Melo Therapeutic Potential of Endothelial Progenitor Cells in Cardiovascular Diseases Hypertension, July 1, 2005; 46(1): 7 - 18. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Dong, L. E. Crawford, and P. J. Goldschmidt-Clermont Endothelial Progenitor Obsolescence and Atherosclerotic Inflammation J. Am. Coll. Cardiol., May 3, 2005; 45(9): 1458 - 1460. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2004 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |