| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2004;110:2651-2657.)
© 2004 American Heart Association, Inc.
Molecular Cardiology |
From the Department of Pharmacology (T.C., E.W., E.M.G., U.R., D.D.) and Cardiovascular Centre (M.K.), Dresden University of Technology, Dresden; Department of Pharmacology (P.B., W.S.), University of Münster, Münster; and Department of Cardiology, University of Tübingen, Tübingen (W.S., R.F.B.), Germany.
Correspondence to Dr Dobromir Dobrev, Fetscherstr. 74, 01307 Dresden, Germany. E-mail dobrev{at}rcs.urz.tu-dresden.de
Received February 26, 2004; de novo April 30, 2004; accepted June 2, 2004.
| Abstract |
|---|
|
|
|---|
Methods and Results We used whole-cell voltage-clamp technique and biochemical assays to study regulation and expression of ICa,L in myocytes and atrial tissue from 148 patients with sinus rhythm (SR) and chronic AF. Basal ICa,L at +10 mV was smaller in AF than in SR (3.8±0.3 pA/pF, n=138/37 [myocytes/patients] and 7.6±0.4 pA/pF, n=276/86, respectively; P<0.001), though protein levels of the pore-forming
1c and regulatory ß2a channel subunits were not different. In both groups, norepinephrine (0.01 to 10 µmol/L) increased ICa,L with a similar maximum effect and comparable potency. Selective blockers of kinases revealed that basal ICa,L was enhanced by Ca2+/calmodulin-dependent protein kinase II in SR but not in AF. Norepinephrine-activated ICa,L was larger with protein kinase C block in SR only, suggesting decreased channel phosphorylation in AF. The type 1 and type 2A phosphatase inhibitor okadaic acid increased basal ICa,L more effectively in AF than in SR, which was compatible with increased type 2A phosphatase but not type 1 phosphatase protein expression and higher phosphatase activity in AF.
Conclusions In AF, increased protein phosphatase activity contributes to impaired basal ICa,L. We propose that protein phosphatases may be potential therapeutic targets for AF treatment.
Key Words: myocytes fibrillation, atrial calcium phosphatases
| Introduction |
|---|
|
|
|---|
In humans, electrical remodeling is associated with changes in activity of several ion currents.2 During experimental and clinical AF, the amplitude of L-type Ca2+ current (ICa,L) decreases38 with corresponding reductions in mRNA and protein levels of the pore-forming
1c subunit.3,812 However the hypothesis of transcriptionally mediated downregulation of ICa,L was challenged in humans by recent studies that failed to detect changes in mRNA and protein levels of
1c and the regulatory ß2a subunits.13,14 Although reduced amplitude of ICa,L is a consistent finding in AF, the molecular mechanisms are not fully understood.
Functional regulation of Ca2+ channels relies on phosphorylation processes. Protein kinase A and C and the Ca2+/calmodulin-dependent protein kinase II (PKA, PKC, and CAMKII, respectively) affect ICa,L.15,16 In the heart, phosphorylation of ICa,L is counteracted by type 1 and type 2A phosphatases (PP1 and PP2A).17 Thus, the actual amplitude of basal ICa,L is determined by the balanced activity of kinases and phosphatases.
The present study tested the hypothesis that reduced ICa,L in patients with AF is associated with alterations in phosphorylation-dependent channel regulation.
| Methods |
|---|
|
|
|---|
Right atrial appendages were obtained from 95 patients with SR and 53 patients with chronic AF (AF >6 months, Table). Significant differences between the groups were found for age, body mass index, incidence of coronary artery disease and/or valve disease, hyperlipidemia, and left atrial diameter. AF patients more often received digitalis, angiotensin receptor inhibitors, and diuretics, whereas ß-blockers and lipid-lowering drugs were more frequently used in SR (Table).
|
ICa,L Measurement
Atrial myocytes were isolated with a standard protocol.18 The solution for cell storage contained (in mmol/L) KCl 20, KH2PO4 10, glucose 10, K-glutamate 70, ß-hydroxybutyrate 10, taurine 10, EGTA 10, and albumin 1, pH=7.4. Whole-cell voltage-clamp ICa,L recordings were performed as previously described.19 ISO-2 software (MFK) was used for data acquisition and analysis. Borosilicate glass electrodes (Hilgenberg) had tip resistances of 2 to 5 M
when filled with (in mmol/L) Cs-methanesulfonate 90, CsCl 20, HEPES 10, Mg-ATP 4, Tris-GTP 0.4, EGTA 10, and CaCl2 3, pH =7.2. Cell capacitances averaged 88.1±1.9 and 106.1±3.8 pF for SR (n=276) and AF (n=138) myocytes, respectively (P<0.01). Seal resistances were 3 to 6 G
. Series resistance and system capacitance were compensated. The bath solution contained (in mmol/L) TEA-Cl 120, CsCl 10, HEPES 10, CaCl2 2, MgCl2 1, and glucose 10 (pH 7.4, with CsOH). Basal and norepinephrine (NE)- and isoproterenol (ISO)-activated ICa,L were measured at 37°C in the absence and presence of selective inhibitors of PKA (8-Br-Rp-cAMP, 100 µmol/L in the pipette), PKC (bisindolylmaleimide-I and its inactive form bisindolylmaleimide-V, 1 µmol/L each), CAMKII (KN-93 and its inactive form KN-92, 20 µmol/L each), and PP1/PP2A (okadaic acid, 1 µmol/L). All drugs were from Calbiochem and were applied via a rapid solution exchange system (ALA Scientific Instruments). The data were not corrected for the calculated liquid junction potential (15 mV; JPCalc, version 2.2).
Reverse-Transcription Polymerase Chain Reaction Analysis
Total RNA isolated from right atrial homogenates was reverse transcribed (Invitrogen) in the presence of random hexanucleotides. PCR experiments were performed in a thermocycler (Master cycler, Eppendorf) using standard PCR reaction mixes (Applied Biosystems) and 3-µL cDNA aliquots. Oligonucleotide sequences for
-actin,20
1c (forward primer, GCCCCGAAACATGAGCAT; reverse primer, GAAAATCACCAGCCAGTAGAAGA), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; forward primer, AACAGCGACACCCACTCCTC; reverse primer, GGAGGGGAGATTCAGTGTGGT) were according to published sequences (GeneBank accession Nos. J00071, L29534, and J02642, respectively). The catalytic subunits of PP1 (
, ß, and
) and PP2A (
and ß) were detected with isoform-specific PCR primers as previously described.21
Western Blot Analysis
The
1c Ca2+ channel subunit and GAPDH were detected with primary antibodies (Biotrend, Köln, Germany) and anti-rabbit IgG (DAKO, Hamburg, Germany) and anti-mouse IgG (Sigma, Taufkirchen, Germany) as previously described.8 Antibodies against the ß2a-subunit were raised in rabbit against an epitope mapping near the C-terminus (KKRNEAGEWNRDVYIRQ) and were affinity purified on the respective antigen column. The protein bands were visualized by using enhanced chemiluminescence (Pharmacia Biotech) and quantified using Quantity One Software (Bio-Rad).
Protein expression of catalytic subunits of PP1
and PP2A was quantified as described.21 The structural subunit of PP2A (PP2A-A)17 was assessed by a goat polyclonal antibody against the carboxy terminus of PP2A-A
of human origin (Santa Cruz Biotechnology, Inc, Santa Cruz, Calif) and alkaline phosphatase-conjugated rabbit-anti-goat IgG (Sigma, St. Louis, Mo). To demonstrate the specificity of bands, antibodies for
1c, ß2a, PP1, and PP2A-C were incubated with corresponding immunizing peptides before blotting. Immunologic signals were visualized using enhanced chemifluorescence (Amersham Pharmacia Biotech) and quantified in Storm 820 using ImageQuaNT-Software (Molecular Dynamics).
Phosphatase Assay
Activity of phosphatases was measured in atrial homogenates as previously described.22
Statistics
Univariate ANOVAs were applied to associate preoperative variables with expression and electrophysiological data (SPSS version 11.5). Concentration-response curves were fitted with software Prism (version 4.0). Differences between continuous data were compared by an unpaired Student t test. Frequency data were analyzed with
2 statistics. Data are given as mean±SEM. P<0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
Properties of ICa,L in SR and AF
Basal peak ICa,L at +10 mV was smaller in AF than in SR (3.8±0.3 pA/pF, n=138/37 [myocytes/patients] and 7.6±0.4 pA/pF, n=276/86, respectively; P<0.001). When expression and function of Ca2+ channels were compared in the same patients, reduced basal ICa,L was not paralleled by decreased
1c and ß2a proteins (Figure 1, B through E). In addition, the maximum current was obtained at more positive potentials in AF than in SR (Figure 1F), suggesting phosphorylation-dependent changes in channel regulation rather than expression.23
|
Regulation of Basal ICa,L by Kinases and Phosphatases
The phosphorylation state of Ca2+ channels depends on the balance between kinases and phosphatases. Therefore, we measured ICa,L in the presence of selective enzyme inhibitors. The PKA blocker 8-Br-Rp-cAMP (100 µmol/L), the PKC blocker bisindolylmaleimide-I, and its inactive form bisindolylmaleimide-V (1 µmol/L each) did not modulate basal ICa,L in either group (data not shown). In contrast, the CAMKII inhibitor KN-93 (20 µmol/L), but not the inactive form KN-92, reduced basal ICa,L by
40% in SR but was ineffective in AF (Figure 2, A and B).
|
The lack of effect of KN-93 on basal ICa,L in AF may be due to increased phosphatase activity. Indeed, the PP1/PP2A inhibitor OA (1 µmol/L) increased basal ICa,L more effectively in AF than in SR (Figure 2, C and D). In the presence of the CAMKII blocker KN-93, OA failed to increase ICa,L in AF (2.3±0.6 pA/pF before and 2.5±0.2 pA/pF after OA, n=8/2, NS) and SR myocytes (8.2±0.9 pA/pF before and 8.5±0.5 pA/pF after OA, n=13/3; NS), indicating that the OA-mediated ICa,L increase involves activation by CAMKII.
Modulation of ICa,L by NE and ISO
In both groups, exposure of myocytes to NE (0.01 to 10 µmol/L) increased ICa,L with similar maximum effect (increase in peak ICa,L at 10 µmol/L NE: 6.8±1.3 pA/pF, n=13/5, AF versus 6.7±0.8 pA/pF, n=46/19, SR) and comparable potency (Figure 3). As expected from the higher phosphorylation state of the channels in the presence of NE,23 the maximum of the current-voltage relationship in SR and AF was shifted toward less positive potentials (Figure 3).
|
Contribution of kinases to NE-activated ICa,L differed between SR and AF. 8-Br-Rp-cAMP did not change NE-activated ICa,L in SR but blocked this current by 60% in AF (P<0.05, Figure 4, A and B). In SR, bisindolylmaleimide-I increased NE-activated ICa,L by
100% compared with control but was ineffective in AF. KN-93 inhibited the NE-activated ICa,L by 19% in SR and by 38% in AF (P<0.05), suggesting larger contribution of CAMKII to NE effects in AF (Figure 4, A and B). Bisindolylmaleimide-V and KN-92 had no significant effect. The ineffectiveness of 8-Br-Rp-cAMP on NE-activated ICa,L in SR may be due to opposite effects of
- and ß-adrenoceptor-mediated signal transduction. Therefore, we repeated the experiments with ISO, which activates ß-adrenoceptors only. In the presence of 8-Br-Rp-cAMP, ISO-activated ICa,L was 31% smaller in SR and 51% smaller in AF than in its absence (Figure 4C).
|
Expression and Activity of Phosphatases
Because of the evidence for enhanced phosphatase activity in AF, we also studied the expression of the catalytic subunits of PP1 and PP2A in their various isoforms. Unexpectedly, the mRNA levels of all isoforms were lower in AF than in SR, though statistical significance was reached for PP1
only (Figure 5). Because mRNA and protein levels do not always correlate, we also measured PP1 and PP2A proteins. In accordance with the higher impact of PP2A on channel regulation,17 protein expression of the catalytic subunit of this phosphatase was larger in AF than in SR, whereas protein levels were similar for PP1 and the structural PP2A subunit (Figure 6). Correspondingly, phosphatase activity was higher in AF than in SR (Figure 6B).
|
|
| Discussion |
|---|
|
|
|---|
1c and ß 2a channel subunits. We provide evidence for decreased channel phosphorylation in AF from several observations: (1) the rightward shift of the maximum of the ICa,L current-voltage curve in AF; (2) loss of effect of the CAMKII inhibitor KN-93 in AF; (3) larger increase of basal ICa,L in AF by block of phosphatases with OA; and (4) higher PP2A-C protein expression and phosphatase activity in AF. Additional evidence for impaired channel phosphorylation in AF was provided by the lack of block of NE-activated ICa,L by the PKC inhibitor bisindolylmaleimide-I. Our results suggest that in AF the ratio of protein kinase/phosphatase activity is altered in favor of increased phosphatase activity, resulting in lower basal ICa,L.
Comparison With Previous Studies
Several studies in human atria reported smaller ICa,L amplitude in AF than in SR. Although reduced
1c expression is an attractive molecular mechanism, 1011 others did not confirm this hypothesis.13,14 In the present study, reduced ICa,L was not paralleled by decreased channel expression (Figure 1). Moreover, the maximum of the current-voltage relationship of ICa,L in AF was shifted to the right, suggesting altered phosphorylation-dependent ICa,L regulation.23
The
1c and ß2a subunits possess several phosphorylation sites for PKA and PKC15 and possibly for CAMKII. Interestingly, the latter kinase is regulated by membrane voltage.16 Using selective kinase inhibitors, we found that in SR basal ICa,L is not modulated by PKA or PKC. Interestingly, the CAMKII blocker KN-93 reduced basal ICa,L in SR but not in AF, suggesting that CAMKII may modulate basal ICa,L in SR only. However, reduced CAMKII activity is not a likely explanation because protein levels of CAMKII were
90% higher in AF than in SR.24 Because KN-93 prevents the calmodulin binding to CAMKII,25 calmodulin abundance or activity may be affected in AF. Modulation of ICa,L by CAMKII requires the cytoskeleton.26 Thus, we cannot exclude the possibility that abnormalities of cytoskeletal proteins contribute to the lack of effect of CAMKII on ICa,L in AF. Further work is needed to verify these hypotheses.
Cardiac ß- and
-adrenoceptors couple to different subtypes of G-proteins, thereby modulating PKA-, PKC-, and CAMKII-dependent processes that regulate ICa,L.15,16 Here, NE increased ICa,L with similar potency and efficacy in SR and AF. The same holds true for maximum effect of ISO, confirming previous results.5 However, the effects of the kinase inhibitors differed between SR and AF. In both groups, block of CAMKII with KN-93 reduced NE-activated ICa,L, whereas inhibition of PKC with bisindolylmaleimide-I strongly increased the current in SR but not in AF. Our data are consistent with results in human atrial myocytes, where activation of PKC inhibits ICa,L.27 In SR, the PKA blocker 8-Br-Rp-cAMP had no effect on NE-activated ICa,L, which may be due to opposite effects of the
- and ß-adrenoceptor-mediated signal transduction on ICa,L, because 8-Br-Rp-cAMP reduced the ISO-activated ICa,L both in SR and in AF. In AF, the NE-activated ICa,L was inhibited by 8-Br-Rp-cAMP but not by bisindolylmaleimide-I, indicating impaired ability of PKC to modulate ICa,L in AF.
The lack of effects of CAMKII and PKC on ICa,L in AF suggests either limited kinase ability to phosphorylate the channels or increased phosphatase activity. Blockade of PP1 and PP2A with OA increased basal ICa,L to a greater extent in AF than in SR, and the difference in current density disappeared. The OA-induced ICa,L increase was absent after blocking CAMKII with KN-93, suggesting involvement of this kinase. The stronger effect of OA in AF was compatible with increased PP2A-C protein expression and higher phosphatase activity. Increased PP2A-C expression was not associated with alterations of the structural PP2A-A subunit, suggesting that the former may directly target the channels.28 Thus, increased PP2A activity in AF appears to counteract stimulatory effects of CAMKII on ICa,L, resulting in reduced basal ICa,L.
Study Limitations
Here, we did not investigate channel phosphorylation, because measurement of the phosphorylation state of the channels was not feasible in cardiac myocytes.
ß-Blockers increase PP1 and PP2A expression in dog hearts.29 However, their distributions were similar in the SR and AF subgroups. In rat hearts, expression and activity of PP1 and PP2A decline with age.22 Though patients were older in the AF group than in the SR group, age-related effects on phosphatase activity are unlikely because neither expression nor activity correlated with age.
Our results are not consistent with data at the single-channel level, where reduced
1c expression was associated with increased mean open time of the single channels.12 The authors suggested reduced PP2A activity as the underlying mechanism, though the protein levels of PP1 and PP2A were unchanged.12 The reason for the discrepant observations is currently unknown. Differences between cell-attached and ruptured whole-cell voltage-clamp methods, uncontrolled state of the cardiac diseases, and/or patients medications could contribute to these discrepant findings. Therefore, we cannot exclude the possibility that in a subset of patients with AF, a reduction of
1c expression and a compensatory increase in single-channel ICa,L activity occur.
Potential Significance
Increased phosphatase activity may associate with enhanced dephosphorylation of other proteins, eg, those involved in excitation-contraction coupling.17 Because contractile dysfunction in AF may promote atrial thrombus formation,30 possible improvement of atrial contractility by blockade of phosphatases could reduce the risk of stroke in AF patients after cardioversion to SR. In addition, inhibition of phosphatases in AF may promote reversal of atrial remodeling.
Physiological function of cardiac potassium currents requires basal kinase activities.24,31 Thus, increased phosphatase activity may contribute to downregulation of potassium currents in human AF.
| Conclusions |
|---|
|
|
|---|
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
1C and ß2 are not downregulated in atrial myocardium of patients with chronic atrial fibrillation. J Mol Cell Cardiol. 2003; 35: 437443.[CrossRef][Medline]
[Order article via Infotrieve]
1-adrenoceptor from patients with dilated cardiomyopathy prolong action potential duration and enhance contractility in isolated cardiomyocytes. J Mol Cell Cardiol. 2001; 33: 15151525.[CrossRef][Medline]
[Order article via Infotrieve]This article has been cited by other articles:
![]() |
Y.-G. Sun, Y.-X. Cao, W.-W. Wang, S.-F. Ma, T. Yao, and Y.-C. Zhu Hydrogen sulphide is an inhibitor of L-type calcium channels and mechanical contraction in rat cardiomyocytes Cardiovasc Res, June 17, 2008; (2008) cvn140v2. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J.J.M. Brundel, L. Ke, A.-J. Dijkhuis, X. Qi, A. Shiroshita-Takeshita, S. Nattel, R. H. Henning, and H. H. Kampinga Heat shock proteins as molecular targets for intervention in atrial fibrillation Cardiovasc Res, June 1, 2008; 78(3): 422 - 428. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Van Wagoner Evaluating the impact of atrial dilatation on atrial calcium cycling Eur. Heart J., May 1, 2008; 29(9): 1084 - 1085. [Full Text] [PDF] |
||||
![]() |
S. Dinanian, C. Boixel, C. Juin, J.-S. Hulot, A. Coulombe, C. Rucker-Martin, N. Bonnet, B. Le Grand, M. Slama, J.-J. Mercadier, et al. Downregulation of the calcium current in human right atrial myocytes from patients in sinus rhythm but with a high risk of atrial fibrillation Eur. Heart J., May 1, 2008; 29(9): 1190 - 1197. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nattel, B. Burstein, and D. Dobrev Atrial Remodeling and Atrial Fibrillation: Mechanisms and Implications Circ Arrhythmia Electrophysiol, April 1, 2008; 1(1): 62 - 73. [Full Text] [PDF] |
||||
![]() |
H. Tsujikawa, Y. Song, M. Watanabe, H. Masumiya, S. A. Gupte, R. Ochi, and T. Okada Cholesterol depletion modulates basal L-type Ca2+ current and abolishes its -adrenergic enhancement in ventricular myocytes Am J Physiol Heart Circ Physiol, January 1, 2008; 294(1): H285 - H292. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kirchhof, A. Auricchio, J. Bax, H. Crijns, J. Camm, H.-C. Diener, A. Goette, G. Hindricks, S. Hohnloser, L. Kappenberger, et al. Outcome parameters for trials in atrial fibrillation: executive summary: Recommendations from a consensus conference organized by the German Atrial Fibrillation Competence NETwork (AFNET) and the European Heart Rhythm Association (EHRA) Eur. Heart J., November 2, 2007; 28(22): 2803 - 2817. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kirchhof, A. Auricchio, J. Bax, H. Crijns, J. Camm, H.-C. Diener, A. Goette, G. Hindricks, S. Hohnloser, L. Kappenberger, et al. Outcome parameters for trials in atrial fibrillation: Recommendations from a consensus conference organized by the German Atrial Fibrillation Competence NETwork and the European Heart Rhythm Association Europace, November 1, 2007; 9(11): 1006 - 1023. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Carnes, P. M. L. Janssen, M. L. Ruehr, H. Nakayama, T. Nakayama, H. Haase, J. A. Bauer, M. K. Chung, I. M. Fearon, A. M. Gillinov, et al. Atrial Glutathione Content, Calcium Current, and Contractility J. Biol. Chem., September 21, 2007; 282(38): 28063 - 28073. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Voigt, A. Friedrich, M. Bock, E. Wettwer, T. Christ, M. Knaut, R. H. Strasser, U. Ravens, and D. Dobrev Differential phosphorylation-dependent regulation of constitutively active and muscarinic receptor-activated IK,ACh channels in patients with chronic atrial fibrillation Cardiovasc Res, June 1, 2007; 74(3): 426 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nattel, A. Maguy, S. Le Bouter, and Y.-H. Yeh Arrhythmogenic Ion-Channel Remodeling in the Heart: Heart Failure, Myocardial Infarction, and Atrial Fibrillation Physiol Rev, April 1, 2007; 87(2): 425 - 456. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C.M. Choisy, L. A. Arberry, J. C. Hancox, and A. F. James Increased Susceptibility to Atrial Tachyarrhythmia in Spontaneously Hypertensive Rat Hearts Hypertension, March 1, 2007; 49(3): 498 - 505. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cardin, E. Libby, P. Pelletier, S. Le Bouter, A. Shiroshita-Takeshita, N. Le Meur, J. Leger, S. Demolombe, A. Ponton, L. Glass, et al. Contrasting Gene Expression Profiles in Two Canine Models of Atrial Fibrillation Circ. Res., February 16, 2007; 100(3): 425 - 433. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rucker-Martin, P. Milliez, S. Tan, X. Decrouy, M. Recouvreur, R. Vranckx, C. Delcayre, J.-F. Renaud, I. Dunia, D. Segretain, et al. Chronic hemodynamic overload of the atria is an important factor for gap junction remodeling in human and rat hearts Cardiovasc Res, October 1, 2006; 72(1): 69 - 79. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. de Haan, M. Greiser, E. Harks, Y. Blaauw, A. van Hunnik, S. Verheule, M. Allessie, and U. Schotten AVE0118, Blocker of the Transient Outward Current (Ito) and Ultrarapid Delayed Rectifier Current (IKur), Fully Restores Atrial Contractility After Cardioversion of Atrial Fibrillation in the Goat Circulation, September 19, 2006; 114(12): 1234 - 1242. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. El-Armouche, P. Boknik, T. Eschenhagen, L. Carrier, M. Knaut, U. Ravens, and D. Dobrev Molecular Determinants of Altered Ca2+ Handling in Human Chronic Atrial Fibrillation Circulation, August 15, 2006; 114(7): 670 - 680. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Molenaar, T. Christ, U. Ravens, and A. Kaumann Carvedilol blocks {beta}2- more than {beta}1-adrenoceptors in human heart Cardiovasc Res, January 1, 2006; 69(1): 128 - 139. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Dobrev, A. Friedrich, N. Voigt, N. Jost, E. Wettwer, T. Christ, M. Knaut, and U. Ravens The G Protein-Gated Potassium Current IK,ACh Is Constitutively Active in Patients With Chronic Atrial Fibrillation Circulation, December 13, 2005; 112(24): 3697 - 3706. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gaborit, M. Steenman, G. Lamirault, N. Le Meur, S. Le Bouter, G. Lande, J. Leger, F. Charpentier, T. Christ, D. Dobrev, et al. Human Atrial Ion Channel and Transporter Subunit Gene-Expression Remodeling Associated With Valvular Heart Disease and Atrial Fibrillation Circulation, July 26, 2005; 112(4): 471 - 481. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||