This Article Abstract Full Text (PDF) All Versions of this Article: 110/13/1855    most recent 01.CIR.0000142610.10530.25v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Deng, Y.-M. Articles by Stocker, R. Search for Related Content PubMed PubMed Citation Articles by Deng, Y.-M. Articles by Stocker, R. Related Collections Cardiovascular Pharmacology Restenosis Endothelium/vascular type/nitric oxide Other Treatment Animal models of human disease

(Circulation. 2004;110:1855-1860.)
© 2004 American Heart Association, Inc.

Vascular Medicine

Probucol Protects Against Smooth Muscle Cell Proliferation by Upregulating Heme Oxygenase-1

Yi-Mo Deng, PhD; Ben J. Wu, PhD; Paul K. Witting, PhD; Roland Stocker, PhD

From the Centre for Vascular Research, University of New South Wales, and the Department of Haematology, Prince of Wales Hospital, Sydney. Australia.

Correspondence to Roland Stocker, PhD, Centre for Vascular Research, School of Medical Sciences, Faculty of Medicine, University of New South Wales, UNSW Sydney 2052, Australia. E-mail r.stocker{at}unsw.edu.au

Received February 26, 2004; revision received May 17, 2004; accepted May 20, 2004.

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background— Evidence suggests that induction of heme oxygenase-1 (HO-1) inhibits proliferation of vascular smooth muscle cells and intimal thickening after arterial injury, and therapeutic molecules induce HO-1. Probucol is the only oral drug that inhibits restenosis in humans and intimal thickening in animals, although its underlying mechanism remains unclear.

Methods and Results— Aortas were harvested from New Zealand White rabbits fed normal or 0.75% (wt/wt) probucol-fortified chow, with or without endothelial denudation of the abdominal aorta on day 21, and analyzed for heme oxygenase and apoptosis. Uninjured aortas were harvested on day 21 and balloon-injured aortas on days 22 and 25. Probucol significantly increased mRNA of HO-1 assessed by real-time PCR and HO activity in aortas at all time points. Probucol also enhanced apoptosis of medial cells in the injured aorta, as evidenced by the TUNEL assay. Furthermore, probucol (100 µmol/L) increased HO-1 mRNA and HO activity when added to rabbit aortic smooth muscle cells (RASMCs) cultured in serum-free medium for 24 hours. Induction of HO-1 mRNA was inhibited by actinomycin D and was associated with inhibition of RASMC proliferation. This probucol-induced increase in HO-1 mRNA and inhibition of RASMC proliferation was prevented by the HO inhibitor Sn(IV) protoporphyrin or transfection with small interference RNA (siRNA) to knockdown HO-1, but not by inactive Cu(II) protoporphyrin or scrambled siRNA.

Conclusions— Probucol induces HO-1, and this contributes to the inhibition of vascular SMC proliferation. This novel finding may explain how probucol inhibits restenosis and highlights HO-1 as a target for therapeutic intervention against occlusive vascular disease.

Key Words: angioplasty • antioxidants • atherosclerosis • endothelium • restenosis

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Angioplasty has revolutionized the treatment of advanced atherosclerosis. The advent of drug-eluting stents to locally deliver agents that inhibit cell proliferation has almost completely prevented in-stent restenosis.^1,2 However, there remain concerns with drug-eluting stents, such as late thrombosis³ possibly due to inhibition of reendothelialization,⁴ localized hypersensitivity reactions,⁵ decreased efficacy in diabetic patients,¹ and that the underlying atherosclerotic process is not targeted.

Probucol, a rarely used cholesterol-lowering drug with antioxidant properties, is the only agent that consistently inhibits atherosclerosis and restenosis. It attenuates atherogenesis in animals⁶ and humans⁷ and regresses xanthomas in hypercholesterolemic patients.⁸ Probucol protects human coronary arteries from restenosis^9–11 and promotes positive adventitial remodeling.¹² In animals, probucol prevents intimal thickening after balloon injury,¹³ independent of both cholesterol lowering^14–16 and inhibition of lipoprotein lipid oxidation.¹⁶ This beneficial effect is associated with promotion of endothelial cell growth and functional reendothelialization¹⁶ and inhibition of vascular smooth muscle cell (SMC) proliferation.^16,17

The opposing effects of probucol on endothelial and SMC growth is analogous to the action of heme oxygenase-1 (HO-1), an increasing activity of which inhibits SMC proliferation¹⁸ and promotes the growth of coronary endothelial cells.¹⁹ There is also mounting evidence in vivo that HO-1 protects against vascular disease. For example, increased HO-1 decreases intimal thickening after arterial injury²⁰ and attenuates atherosclerosis in LDL-receptor–²¹ and apolipoprotein E–deficient²² mice. In contrast, inhibition of HO-1 enhances atherosclerosis in Watanabe heritable hyperlipidemic rabbits.²³

On the basis of the aforementioned similarities, we hypothesized that probucol’s protective effects after arterial balloon injury are mediated via induction of HO-1. We provide evidence that probucol inhibits intimal thickening via induction of HO-1 expression and heme oxygenase activity and propose that HO-1 is a therapeutic target for the inhibition of occlusive vascular disease.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Rabbit Aortic Balloon-Injury Model
Male New Zealand White rabbits (2.5 kg; Merunga Farm, Coffs Harbor, Australia) were fed a normal diet (100 g/d) for 3 weeks before being randomized to 2 groups according to body weight and blood cholesterol concentration. Animals were then fed the limited diet without or with 0.75% (wt/wt) probucol (96% purity, Medichem), without and with aortic balloon injury (ABI) of the abdominal aorta on day 21, as described previously.¹⁶ Uninjured aortas were harvested on day 21 and balloon-injured aortas, on days 22 and 25. For RNA extraction, sections of the abdominal aorta were kept overnight in RNAlater (Ambion) at 4°C and then transferred to –80°C. For biochemical analyses, aortas were snap-frozen in phosphate-buffered saline containing a commercial protease inhibitor cocktail, 1 mmol/L EDTA, and 100 µmol/L butylated hydroxytoluene and then stored at –80°C.

Cell Proliferation
Rabbit aortic SMCs (RASMCs; Cell Applications; passages 6 to 11) were cultured in 12-well plates in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Gibco) and 100 U/mL streptomycin/ampicillin at 37°C in a humidified atmosphere of 5% CO₂ until 60% to 70% confluent. Cells were then incubated for up to 48 hours in serum-free DMEM containing 0.3% bovine serum albumin without or with the various chemicals indicated, after which they were harvested with trypsin (0.025%)/EDTA (1 mmol/L) followed by cell counting with a Coulter counter (model ZF, Coulter Electronics).

HO-1–Specific siRNA
Small interfering RNA (siRNA) was designed by targeting the HO-1 sequence 5' AACAAGGAGAACCCGGTCTAC 3', according to the siRNA design guidelines (www.qiagen.com). The sequence 5' GACTCGAGCACTCGAGACA 3' was used as the scrambled siRNA control; it does not match any mammalian sequences currently available on online databases. Double-stranded siRNAs were synthesized (Qiagen-Xeragon) and dissolved in sterile annealing buffer according to the manufacturer’s instruction.

Transfection of RASMCs
Transfection of RASMCs by Transmessenger transfection reagent (Qiagen) was optimized first by using a control, fluorescein isothiocyanate–labeled siRNA provided by Qiagen. Cells were transfected with various concentrations of control siRNA and different siRNA-to–TransMessenger reagent ratios for 4 hours in serum- and antibiotic-free DMEM. Transfection efficiency was evaluated after 24 hours by flow cytometry and counting the percentage of fluorescein isothiocyanate–labeled cells. Optimal transfection efficiency (80%) was obtained with 3.2 µg siRNA and an siRNA-to–TransMessenger reagent ratio of 1:2.5. These conditions were used for the subsequent siRNA transfection experiments.

In Situ Detection of Apoptotic Cells
Paraffin-embedded cross sections of rabbit aortas were stained for apoptotic nuclei with an in situ cell death detection kit (Roche Molecular Biochemicals) according to the manufacturer’s recommendations. In brief, sections were treated with proteinase K and blocked with endogenous peroxidase, and slides were exposed to an avidin-biotin block with antigen retrieval. After permeabilization, sections were incubated with a terminal dUTP nick end-labeling (TUNEL) reaction mixture, treated with converter-peroxidase solution, and exposed to diaminobenzidine black–nickel chromogen. Slides were counterstained with hematoxylin and analyzed by light microscopy for total and TUNEL-positive medial wall cells.

RNA Extraction and Real-Time RT-PCR
Frozen tissue was homogenized in Trizol reagent (Life Technologies) with lysing matrix D in a FastPrep machine (BIO 101). For cultured cells, Trizol reagent was added directly to cells. RNA was extracted according to the manufacturer’s instruction, followed by treatment with RQ1 DNase I (Promega). Real-time reverse transcriptase–polymerase chain reaction (RT-PCR) was performed with MMLV (Life Technologies) and the SYBR Green PCR kit (Applied Biosystems) in an ABI 7700 sequence detector (Applied Biosystems). Expression of HO-1 gene was determined as the amount of HO-1 mRNA relative to mRNA for hypoxanthine phosphoribosyltransferase (HPRT) by using the comparative C_T method described in the ABI 7700 sequence detector user bulletin 2. Sense and antisense primers for HO-1 were 5'-GAGATTGAGCGCAACAAGGA-3' and 5'-AGCGGTAGAGCTGCTTGAACT-3' respectively. Primers for HPRT were as described.²⁴

HO Activity
The activity of HO was determined in microsomes prepared from aortas and RASMCs.²⁵ In brief, frozen tissue was pulverized in LN₂, resuspended in phosphate-buffered saline with protease inhibitors (Roche), and then homogenized.¹⁶ Cells were scraped with a rubber policeman in the same buffer and lysed by 3 freeze-thaw cycles. The tissue homogenate or cell lysate was then centrifuged at 15 000g at 4°C for 20 minutes, and the supernatant was then collected and subjected to ultracentrifugation at 100 000g at 4°C for 1 hour. The resulting microsomal pellet was suspended in buffer A (250 mmol/L sucrose, 20 mmol/L Tris, pH 7.4). For the HO activity assay, 400 to 600 µg microsomal protein was mixed with 200 µg rat liver microsomes, 1 mmol/L NADPH, 2 mmol/L D-glucose-6-phosphate, 1 U glucose-6-phosphate dehydrogenase, and 1 µL of 2.5 mmol/L heme (Sigma) in 25% dimethyl sulfoxide (DMSO) in 100 µL of buffer A on ice. The mixture was incubated at 37°C in the dark for 1 hour, the reaction stopped by adding 100 µL of ethanol/DMSO (95:5, vol/vol), the sample was centrifuged at 13 000g for 5 minutes, and the supernatant was used for further analysis. HO enzyme activity was determined by formation of bilirubin as detected by high-performance liquid chromatography, as described,²⁵ with slight modifications. In brief, the supernatant resulting from the ethanol-DMSO extraction was subjected to an LC18 column eluted with a linear gradient generated by changing from 100% solvent A (methanol/100 mmol/L ammonium acetate, pH 5.1; 3:2, vol/vol) to 100% solvent B (100% methanol) over 18 minutes, with bilirubin detected at 455 nm.

Statistical Analysis
All data are expressed as mean±SEM. Unpaired Student’s t tests were used for between-group comparisons, and significance was accepted at the 95% confidence interval.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Aortic HO-1
In response to ABI, the aortic content of mRNA for HO-1 initially (day 21) decreased (0.5±0.05) and then increased (2.2±0.3) on day 25 relative to the content of HPRT mRNA (Figure 1A). Such a biphasic response in HO-1 induction after mechanical injury is consistent with previous reports.²⁶ Treatment with probucol increased HO-1 mRNA level (Figure 1A) independent of whether rabbits underwent ABI (relative increase, 2.0±0.15 and 1.9±0.7 on days 22 and 25, respectively; P<0.01 vs control for both time points) or not (2.8±0.4-fold on day 21; P<0.01 vs control). In parallel, probucol increased HO activity by 2.1-, 1.3-, and 1.9-fold compared with control on days 21, 22, and 25, respectively (Figure 1B, P<0.01 for all 3 time points), as assessed by bilirubin formation (Figure 1C).

View larger version (17K): [in this window] [in a new window]   Figure 1. Probucol induces HO-1 mRNA expression and HO activity. A, HO-1 mRNA expression and B, HO activity in aortas of 4 control (open bars) and 4 probucol-treated (closed bars) rabbits on days 21, 22, and 25. C, Representative high-performance liquid chromatograms showing formation of bilirubin in aortas of control (lower line) and probucol-treated (upper line) rabbits on day 25. AU indicates arbitrary units; OD, optical density; and RT, retention time. All other abbreviations are as defined in text. *P<0.01 vs control.

HO-1 in RASMCs
Previous studies have shown that inhibition of ABI-induced intimal thickening by probucol is associated with enhanced reendothelialization and inhibition of vascular SMC proliferation.¹⁶ Because HO activity has been linked to the control of cell growth,²⁰ we assessed the effect of probucol on HO-1 in endothelial cells and SMCs. Treatment of primary porcine aortic endothelial cells with probucol (100 µmol/L) appeared to decrease HO-1 mRNA (50±12% and 60±15% of control at 6 and 8 hours, respectively), although this did not reach statistical significance (P>0.05). By contrast, treatment of RASMCs with probucol increased HO-1 mRNA in a time-dependent manner (Figure 2A), and this trend was mirrored by an increase in HO activity (Figure 2B). After 24 hours, cells with and without probucol treatment produced 3.3±0.3 and 1.7±0.4 nmol bilirubin per milligram protein per hour, respectively (P<0.01). Basal expression of HO-1 and its induction by probucol required active transcription, because pretreatment of cells for 30 minutes with 0.5 mg/mL actinomycin D (ActD; Sigma) to inhibit transcription completely abolished the increase in HO-1 mRNA (Figure 2C).

View larger version (17K): [in this window] [in a new window]   Figure 2. Probucol increases HO-1 transcription and activity in RASMCs. A, HO-1 mRNA expression in control (open bars) and 100 µmol/L probucol–treated (closed bars) RASMCs cultured in serum-free DMEM for times indicated (n=3). B, HO activity in control (open bars) and 100 µmol/L probucol–treated (closed bars) RASMCs cultured in serum-free DMEM for times indicated (n=3). C, HO-1 mRNA expression in control (open bars) and 100 µmol/L probucol–treated (closed bars) RASMCs cultured in serum-free DMEM for 24 hours in absence or presence of 0.5 mg/mL ActD added 30 minutes before probucol (n=3). *P<0.01 vs control; **P<0.001 vs cells without ActD. n.s. indicates not significant. All other abbreviations are as defined in text.

HO and RASMC Proliferation
Addition of probucol inhibited the proliferation of cultured RASMCs (Figure 3), as reported previously.¹⁶ Addition of the competitive HO inhibitor tin protoporphyrin (20 µmol/L, Porphyrin Products) abolished this antiproliferative effect of probucol (108±3.3% vs 67±5.5%, P<0.01). In contrast, addition of the inactive copper protoporphyrin (CuPP; 20 µmol/L, Porphyrin Products) tended to decrease cell proliferation, an effect that was due to cytotoxicity as assessed by trypan blue dye exclusion (not shown). More important, CuPP (20 µmol/L) failed to abrogate growth inhibition by probucol (65±5.2% and 67±5.5% for probucol and CuPP, respectively; Figure 3).

View larger version (19K): [in this window] [in a new window]   Figure 3. Probucol attenuates proliferation of RASMCs dependent on HO. Cells were incubated in serum-free DMEM for 48 hours, under conditions indicated, before cell numbers were counted (n=3). 100% value corresponds to 77 961±1825 (n=3). *P<0.01. SnPP indicates tin protoporphyrin; n.s., not significant. All other abbreviations are as defined in text.

We next transfected RASMCs with anti–HO-1 siRNA to knock down HO-1 induction and examined the effect of this on probucol’s ability to inhibit cell proliferation. Transfection of RASMCs with anti–HO-1 siRNA but not scrambled siRNA abolished the ability of probucol both to induce HO-1 mRNA expression (Figure 4A) and to inhibit RASMC proliferation (Figure 4B).

View larger version (17K): [in this window] [in a new window]   Figure 4. Transfection of RASMCs by HO-1 siRNA reverts ability of probucol to induce HO-1 and inhibit cell proliferation. A, HO-1 mRNA expression after 24 hours of culture in serum-free DMEM of control (open bars) and 100 µmol/L probucol–treated (closed bars) RASMCs transfected with HO-1 siRNA or scrambled siRNA (sc siRNA) (n=2). B, Cell numbers after 48 hours of culture in serum-free DMEM of control (open bars) and 100 µmol/L probucol–treated (closed bars) RASMCs transfected with HO-1 siRNA or scrambled siRNA (sc siRNA) (n=2). 100% value corresponds to 51 420±1143. *P<0.01 vs control. All other abbreviations are as defined in text.

Probucol Induces Apoptosis of SMCs In Vivo
Previous studies have established that increasing HO-1 causes inhibition of proliferation of cultured SMCs via stimulation of apoptosis.²⁶ It is also known that probucol decreases arterial injury–induced SMC proliferation in vivo and that 3 weeks after ABI, the numbers of medial cells are decreased in vessels of probucol-treated compared with normal rabbits.¹⁶ Consistent with in vivo inhibition of SMC proliferation, injured aortas from probucol-treated rabbits 4 days after ABI already contained fewer medial cells than sis corresponding control aortas, although this difference did not reach statistical significance (Table). Further, probucol significantly increased the proportion of apoptotic cells in the media (16.5±0.9% vs 9.6±1.0% of cells for probucol vs control, P<0.01), as assessed by the TUNEL assay (Table).

View this table: [in this window] [in a new window]   Probucol Induces Apoptosis of Medial SMCs

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
Probucol consistently inhibits intimal thickening in animals and restenosis in humans, and these protective effects are commonly attributed to its cholesterol-lowering and antioxidant activities. However, probucol reduces postangioplasty restenosis in humans by improving vascular remodeling,¹² and our previous studies in the rabbit ABI model of intimal thickening showed that in vivo protection by probucol is related to the promotion of reendothelialization and inhibition of SMC proliferation, rather than inhibition of aortic lipoprotein lipid oxidation and cholesterol lowering.¹⁶ Here, we show that probucol induces HO-1 mRNA and HO activity in SMCs in vivo and in vitro and that this is responsible for the drug’s ability to inhibit proliferation of SMCs, likely via promotion of apoptosis.

Excessive proliferation of SMCs is a key contributor to intimal thickening after ABI and restenosis after angioplasty. We now provide pharmacologic and molecular evidence for HO-1 induction’s being responsible for the observed probucol-mediated inhibition of SMC proliferation. Both induction of HO-1 and inhibition of RASMC proliferation by probucol were lost completely by the HO-1 inhibitor tin protoporphyrin and HO-1–specific siRNA. In contrast, inactive CuPP and transfection with scrambled siRNA affected neither HO-1 nor cell proliferation. Increased aortic HO activity was observed as early as 4 days after ABI, at which time the injured vessel remained essentially devoid of endothelium. Also, probucol upregulated HO-1 in cultured RASMCs but not in aortic endothelial cells, suggesting that the drug acted directly on SMCs.

It is established that HO-1 confers protection against cellular proliferation and lesion formation after arterial injury. For example, compared with control cells, vascular SMCs from HO-1–deficient mice display enhanced DNA synthesis and growth, and wire injury of femoral arteries results in greater intimal thickening in HO-1–deficient than in control mice.²⁰ Conversely, transfer of the HO-1 gene to porcine arteries attenuates injury-induced proliferation of SMCs and intimal thickening.²⁰ In serum-starved porcine vascular SMCs, HO-1 inhibits DNA synthesis in part via enhanced G₁/G₀ growth arrest,²⁰ reminiscent of the effect of probucol on cultured RASMCs.¹⁶ In rat aortic SMCs, overexpression of HO-1 decreases proliferation by stimulating programmed cell death.¹⁸ Consistent with this concept, we observed the proportion of apoptotic cells to increase significantly in the media of probucol-treated compared with control rabbits (Table). Together, these studies suggest that probucol inhibits intimal thickening after balloon injury by directly inhibiting SMC proliferation via induction of HO-1 and apoptosis.

It is presently unclear how probucol induces HO-1 and how this leads to inhibition of SMC proliferation. HO-1 is a stress protein induced under many conditions and by several agents.²⁷ The latter include oxidants such as hydrogen peroxide²⁸ but also reductants including phenols, such as curcumin,²⁹ suggesting that induction of HO-1 is under redox control and may provide antioxidant protection.³⁰ Because probucol can engage in redox reactions,³¹ it is conceivable that the drug induces HO-1 via changes in cellular redox status. However, preliminary experiments indicate that probucol does not alter the redox status or concentration of glutathione in RASMCs (R. Mashima and R. Stocker, 2002, unpublished data). Therefore, additional studies are required to clarify how probucol induces HO-1 in SMCs and whether this involves redox reactions.

HO-1 is the inducible form of HO that degrades heme to iron, carbon monoxide (CO), and biliverdin that is then converted to bilirubin.²⁷ HO-1 could principally regulate cell growth by a decrease in cellular heme, an increase in 1 or several of its products, or a combination thereof. A presently unresolved key question is the extent to which altered HO-1 activity translates into changes in the cellular concentrations and localization of heme, iron, CO, and biliverdin/bilirubin. Notwithstanding these limitations, there is convincing evidence that CO at 250 ppm suppresses intimal thickening after balloon injury in vivo and inhibits SMC proliferation in vitro, likely involving cGMP and p38 mitogen-activated protein kinase.³² Similarly, micromolar concentrations of biliverdin and bilirubin can inhibit vascular SMC proliferation by stimulating apoptosis.¹⁸

Like probucol,¹⁶ HO-1 regulates cell growth in a cell-specific manner, as exemplified by the opposing effect on SMC and endothelial cell proliferation (see Introduction). Similarly contrasting effects are seen with programmed cell death, as overexpression of HO-1 promotes and blocks apoptosis in SMCs and endothelial cells, respectively.^18,33 In endothelial cells, gaseous CO mimics and hemoglobin suppresses inhibition of apoptosis induced by HO-1,³³ suggesting that the latter is mediated by HO-1–derived CO. If so, this raises the possibility that CO produced by SMCs as a result of probucol-mediated HO-1 induction diffuses to and acts on adjacent endothelial cells to suppress apoptosis. This could help explain why probucol effectively promotes reendothelialization in vivo,¹⁶ a process that itself inhibits intimal thickening.³⁴

In conclusion, the present study shows that induction of HO-1 is responsible for the ability of probucol to inhibit SMC proliferation and intimal thickening. The results add not only to the growing list of protective properties of probucol but also to the list of therapeutic agents that induce HO-1.³⁵ These agents include nitric oxide,³⁶ aspirin,³⁷ and rapamycin.³⁸ These findings lend further support for the notion³⁵ that HO-1 protects against cardiovascular diseases such as intimal thickening,²⁰ atherosclerosis,^21–23 and transplant-associated arteriosclerosis.³² They highlight the potential of HO-1 as a therapeutic target for the alleviation of occlusive vascular disease.

	Acknowledgments

 
This work was supported by a program grant and a senior principal research fellowship of the National Health and Medical Research Council of Australia to Dr Stocker and a grant from the Australian Research Council to Dr Witting. We thank Dr Levon Khachigian for access to the Coulter counter and Dr Antony Lau for helpful comments on the manuscript.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Moses JW, Leon MB, Popma JJ, et al. Sirolimus-eluting stents versus standard stents in patients with stenosis in a native coronary artery. N Engl J Med. 2003; 349: 1315–1323.[Abstract/Free Full Text]
   
2. Gershlick A, De Scheerder I, Chevalier B, et al. Inhibition of restenosis with a paclitaxel-eluting, polymer-free coronary stent: the European evaLUation of pacliTaxel Eluting Stent (ELUTES) trial. Circulation. 2004; 109: 487–493.[Abstract/Free Full Text]
   
3. Liistro F, Colombo A. Late acute thrombosis after paclitaxel eluting stent implantation. Heart. 2001; 86: 262–264.[Abstract/Free Full Text]
   
4. Drachman DE, Edelman ER, Seifert P, et al. Neointimal thickening after stent delivery of paclitaxel: change in composition and arrest of growth over six months. J Am Coll Cardiol. 2000; 36: 2325–2332.[Abstract/Free Full Text]
   
5. Virmani R, Guagliumi G, Farb A, et al. Localized hypersensitivity and late coronary thrombosis secondary to a sirolimus-eluting stent: should we be cautious? Circulation. 2004; 109: 701–705.[Abstract/Free Full Text]
   
6. Stocker R. Dietary and pharmacological antioxidants in atherosclerosis. Curr Opin Lipidol. 1999; 10: 589–597.[CrossRef][Medline] [Order article via Infotrieve]
   
7. Sawayama Y, Shimizu C, Maeda N, et al. Effects of probucol and pravastatin on common carotid atherosclerosis in patients with asymptomatic hypercholesterolemia: Fukuoka Atherosclerosis Trial (FAST). J Am Coll Cardiol. 2002; 39: 610–616.[Abstract/Free Full Text]
   
8. Yamamoto A, Hara H, Takaichi S, et al. Effect of probucol on macrophages, leading to regression of xanthomas and atheromatous vascular lesions. Am J Cardiol. 1988; 62: 31B–36B.[CrossRef][Medline] [Order article via Infotrieve]
   
9. Tardif J-C, Côté G, Lespérance J, et al. Probucol and multivitamins in the prevention of restenosis after coronary angioplasty. N Engl J Med. 1997; 337: 365–372.[Abstract/Free Full Text]
   
10. Rodés J, Côté G, Lespérance J, et al. Prevention of restenosis after angioplasty in small coronary arteries with probucol. Circulation. 1998; 97: 429–436.[Abstract/Free Full Text]
    
11. Tardif JC, Gregoire J, Schwartz L, et al. Effects of AGI-1067 and probucol after percutaneous coronary interventions. Circulation. 2003; 107: 552–558.[Abstract/Free Full Text]
    
12. Côté G, Tardif JC, Lespérance J, et al. Effects of probucol on vascular remodeling after coronary angioplasty: Multivitamins and Protocol Study Group. Circulation. 1999; 99: 30–35.[Abstract/Free Full Text]
    
13. Schneider JE, Berk BC, Gravanis MB, et al. Probucol decreases neointimal formation in a swine model of coronary artery balloon injury: a possible role for antioxidants in restenosis. Circulation. 1993; 88: 628–637.[Abstract/Free Full Text]
    
14. Shinomiya M, Shirai K, Saito Y, et al. Inhibition of intimal thickening of the carotid artery of rabbits and of outgrowth of explants of aorta by probucol. Atherosclerosis. 1992; 97: 143–148.[CrossRef][Medline] [Order article via Infotrieve]
    
15. Ishizaka N, Kurokawa K, Taguchi J, et al. Inhibitory effect of a single local probucol administration on neointimal formation in balloon-injured rat carotid artery. Atherosclerosis. 1995; 118: 53–56.[CrossRef][Medline] [Order article via Infotrieve]
    
16. Lau AK, Leichtweis SB, Hume P, et al. Probucol promotes functional reendothelialization in balloon-injured rabbit aortas. Circulation. 2003; 107: 2031–2036.[Abstract/Free Full Text]
    
17. Sekiya M, Funada J, Watanabe K, et al. Effects of probucol and cilostazol alone and in combination on frequency of poststenting restenosis. Am J Cardiol. 1998; 82: 144–147.[CrossRef][Medline] [Order article via Infotrieve]
    
18. Liu X-M, Chapman GB, Wang H, et al. Adenovirus-mediated heme oxygenase-1 gene expression stimulates apoptosis in vascular smooth muscle cells. Circulation. 2002; 105: 79–84.[Abstract/Free Full Text]
    
19. Deramaudt BM, Braunstein S, Remy P, et al. Gene transfer of human heme oxygenase into coronary endothelial cells potentially promotes angiogenesis. J Cell Biochem. 1998; 68: 121–127.[CrossRef][Medline] [Order article via Infotrieve]
    
20. Duckers HJ, Boehm M, True AL, et al. Heme oxygenase-1 protects against vascular constriction and proliferation. Nat Med. 2001; 7: 693–698.[CrossRef][Medline] [Order article via Infotrieve]
    
21. Ishikawa K, Sugawara D, Wang X, et al. Heme oxygenase-1 inhibits atherosclerotic lesion formation in LDL-receptor knockout mice. Circ Res. 2001; 88: 506–512.[Abstract/Free Full Text]
    
22. Juan SH, Lee TS, Tseng KW, et al. Adenovirus-mediated heme oxygenase-1 gene transfer inhibits the development of atherosclerosis in apolipoprotein E-deficient mice. Circulation. 2001; 104: 1519–1525.[Abstract/Free Full Text]
    
23. Ishikawa K, Sugawara D, Goto J, et al. Heme oxygenase-1 inhibits atherogenesis in Watanabe heritable hyperlipidemic rabbits. Circulation. 2001; 104: 1831–1836.[Abstract/Free Full Text]
    
24. Choy KJ, Deng YM, Hou JY, et al. Coenzyme Q10 supplementation inhibits aortic lipid oxidation but fails to attenuate intimal thickening in balloon-injured New Zealand White rabbits. Free Radic Biol Med. 2003; 35: 300–309.[CrossRef][Medline] [Order article via Infotrieve]
    
25. Ryter S, Kvam E, Richman L, et al. A chromatographic assay for heme oxygenase activity in cultured human cells: application to artificial heme oxygenase overexpression. Free Radic Biol Med. 1998; 24: 959–971.[CrossRef][Medline] [Order article via Infotrieve]
    
26. Liu XM, Chapman GB, Peyton KJ, et al. Carbon monoxide inhibits apoptosis in vascular smooth muscle cells. Cardiovasc Res. 2002; 55: 396–405.[Abstract/Free Full Text]
    
27. Maines MD. The heme oxygenase system: a regulator of second messenger gases. Annu Rev Pharmacol Toxicol. 1997; 37: 517–554.[CrossRef][Medline] [Order article via Infotrieve]
    
28. Keyse SM, Tyrrell RM. Induction of the heme oxygenase gene in human skin fibroblasts by hydrogen peroxide and UVA (365 nm) radiation: evidence for the involvement of the hydroxyl radical. Carcinogenesis. 1989; 11: 787–791.
    
29. Balogun E, Hoque M, Gong P, et al. Curcumin activates the haem oxygenase-1 gene via regulation of Nrf2 and the antioxidant-responsive element. Biochem J. 2003; 371: 887–895.[CrossRef][Medline] [Order article via Infotrieve]
    
30. Stocker R. Induction of haem oxygenase as a defence against oxidative stress. Free Radic Res Commun. 1990; 9: 101–112.[Medline] [Order article via Infotrieve]
    
31. Barnhart RL, Busch SJ, Jackson RL. Concentration-dependent antioxidant activity of probucol in low density lipoproteins in vitro: probucol degradation precedes lipoprotein oxidation. J Lipid Res. 1989; 30: 1703–1710.[Abstract]
    
32. Otterbein LE, Zuckerbraun BS, Haga M, et al. Carbon monoxide suppresses arteriosclerotic lesions associated with chronic graft rejection and with balloon injury. Nat Med. 2003; 9: 183–190.[CrossRef][Medline] [Order article via Infotrieve]
    
33. Brouard S, Otterbein LE, Anrather J, et al. Carbon monoxide generated by heme oxygenase 1 suppresses endothelial cell apoptosis. J Exp Med. 2000; 192: 1015–1026.[Abstract/Free Full Text]
    
34. Hutter R, Sauter BV, Reis ED, et al. Decreased reendothelialization and increased neointima formation with endostatin overexpression in a mouse model of arterial injury. Circulation. 2003; 107: 1658–1663.[Abstract/Free Full Text]
    
35. Otterbein LE, Soares MP, Yamashita K, et al. Heme oxygenase-1: unleashing the protective properties of heme. Trends Immunol. 2003; 24: 449–455.[CrossRef][Medline] [Order article via Infotrieve]
    
36. Motterlini R, Foresti R, Intaglietta M, et al. NO-mediated activation of heme oxygenase: endogenous cytoprotection against oxidative stress to endothelium. Am J Physiol. 1996; 270: H107–H114.[Medline] [Order article via Infotrieve]
    
37. Grosser N, Abate A, Oberle S, et al. Heme oxygenase-1 induction may explain the antioxidant profile of aspirin. Biochem Biophys Res Commun. 2003; 308: 956–960.[CrossRef][Medline] [Order article via Infotrieve]
    
38. Visner GA, Lu F, Zhou H, et al. Rapamycin induces heme oxygenase-1 in human pulmonary vascular cells: implications in the antiproliferative response to rapamycin. Circulation. 2003; 107: 911–916.[Abstract/Free Full Text]
    

This article has been cited by other articles:

				J. Dulak, J. Deshane, A. Jozkowicz, and A. Agarwal Heme Oxygenase-1 and Carbon Monoxide in Vascular Pathobiology: Focus on Angiogenesis Circulation, January 15, 2008; 117(2): 231 - 241. [Abstract] [Full Text] [PDF]

				R. C.M. Siow and A. T. Churchman Adventitial growth factor signalling and vascular remodelling: Potential of perivascular gene transfer from the outside-in Cardiovasc Res, September 1, 2007; 75(4): 659 - 668. [Abstract] [Full Text] [PDF]

				B. J. Wu, N. Di Girolamo, K. Beck, C. G. Hanratty, K. Choy, J. Y. Hou, M. R. Ward, and R. Stocker Probucol [4,4'-[(1-Methylethylidene)bis(thio)]bis-[2,6-bis(1,1-dimethylethyl)phenol]] Inhibits Compensatory Remodeling and Promotes Lumen Loss Associated with Atherosclerosis in Apolipoprotein E-Deficient Mice J. Pharmacol. Exp. Ther., May 1, 2007; 321(2): 477 - 484. [Abstract] [Full Text] [PDF]

				A.-L. Levonen, M. Inkala, T. Heikura, S. Jauhiainen, H.-K. Jyrkkanen, E. Kansanen, K. Maatta, E. Romppanen, P. Turunen, J. Rutanen, et al. Nrf2 Gene Transfer Induces Antioxidant Enzymes and Suppresses Smooth Muscle Cell Growth In Vitro and Reduces Oxidative Stress in Rabbit Aorta In Vivo Arterioscler. Thromb. Vasc. Biol., April 1, 2007; 27(4): 741 - 747. [Abstract] [Full Text] [PDF]

				X.-m. Liu, M. A. Azam, K. J. Peyton, D. Ensenat, A. N. Keswani, H. Wang, and W. Durante Butylated hydroxyanisole stimulates heme oxygenase-1 gene expression and inhibits neointima formation in rat arteries Cardiovasc Res, April 1, 2007; 74(1): 169 - 179. [Abstract] [Full Text] [PDF]

				R. Stocker and M. A. Perrella Heme Oxygenase-1: A Novel Drug Target for Atherosclerotic Diseases? Circulation, November 14, 2006; 114(20): 2178 - 2189. [Full Text] [PDF]

				B. J. Wu, K. Kathir, P. K. Witting, K. Beck, K. Choy, C. Li, K. D. Croft, T. A. Mori, D. Tanous, M. R. Adams, et al. Antioxidants protect from atherosclerosis by a heme oxygenase-1 pathway that is independent of free radical scavenging J. Exp. Med., April 17, 2006; 203(4): 1117 - 1127. [Abstract] [Full Text] [PDF]

				F. H. Bach Heme oxygenase-1: a therapeutic amplification funnel FASEB J, August 1, 2005; 19(10): 1216 - 1219. [Full Text] [PDF]

				K. Choy, K. Beck, F. Y. Png, B. J. Wu, S. B. Leichtweis, S. R. Thomas, J. Y. Hou, K. D. Croft, T. A. Mori, and R. Stocker Processes Involved in the Site-Specific Effect of Probucol on Atherosclerosis in Apolipoprotein E Gene Knockout Mice Arterioscler. Thromb. Vasc. Biol., August 1, 2005; 25(8): 1684 - 1690. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 110/13/1855    most recent 01.CIR.0000142610.10530.25v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Deng, Y.-M. Articles by Stocker, R. Search for Related Content PubMed PubMed Citation Articles by Deng, Y.-M. Articles by Stocker, R. Related Collections Cardiovascular Pharmacology Restenosis Endothelium/vascular type/nitric oxide Other Treatment Animal models of human disease