(Circulation. 2004;109:790-796.)
© 2004 American Heart Association, Inc.
Basic Science Reports |
From the Center of Vascular Biology and Department of Pathology (J.H., X.Z., T.Y., D.P.H., A.C.N.) and the Department of Medicine (A.M.G.), Weill Medical College of Cornell University, New York, NY.
Correspondence to Andrew C. Nicholson, DVM, PhD, Department of Pathology, A-626, Weill Medical College of Cornell University, 1300 York Ave, New York, NY 10021. E-mail nicholso{at}med.cornell.edu
Received October 31, 2002; de novo received August 5, 2003; revision received October 1, 2003; accepted October 6, 2003.
| Abstract |
|---|
|
|
|---|
Methods and Results Treatment of J774 cells and murine peritoneal macrophages with pitavastatin decreased CD36 mRNA expression in a dose-dependent manner. Decreased CD36 mRNA was associated with decreased CD36 cell surface protein expression in human THP-1 cells and human monocyte-derived macrophages. Pitavastatin also reduced the increase in CD36 mRNA, cell surface protein, and binding/uptake of OxLDL induced by peroxisome proliferator-activated receptor-
(PPAR
) ligands and/or OxLDL. Pitavastatin did not alter the half-life of CD36 mRNA, which suggests pitavastatin downregulates CD36 expression by reducing CD36 transcription. In addition, pitavastatin significantly decreased PPAR
mRNA and protein expression. Finally, pitavastatin increased p44/42 mitogen-activated protein kinase activity and PPAR
phosphorylation and increased the ratio of phosphorylated PPAR
to nonphosphorylated PPAR
.
Conclusions The present data demonstrate that pitavastatin prevents OxLDL uptake by macrophages through PPAR
-dependent inhibition of CD36 expression and suggest that pitavastatin could modulate CD36-mediated atherosclerotic foam cell formation.
Key Words: antigens, CD36 macrophages statins cholesterol lipoproteins
| Introduction |
|---|
|
|
|---|
Scavenger receptors are thought to play a significant role in atherosclerotic foam cell development because of their ability to bind and internalize modified lipids, such as oxidized LDL (OxLDL).15,16 Two major classes of human scavenger receptors, designated types A and B, have been identified. CD36, the defining member of type B scavenger receptors, binds OxLDL but not LDL.17 CD36 cDNA-transfected cells bind and internalize OxLDL, and binding of OxLDL to human macrophages was 50% blocked by antibodies to CD36.18 Both native and modified lipids upregulate expression of the class A19 and class B20 scavenger receptors. Inhibition of CD36 expression has been demonstrated to reduce the development of atherosclerosis in atherosclerosis-prone apolipoprotein E-null mice.21
Recent studies have implicated peroxisome proliferator-activated receptor-
(PPAR
) in the regulation of CD36 by oxidized lipoprotein.22,23 PPAR
is a member of the nuclear hormone receptor superfamily. PPAR
heterodimerizes with the retinoid X receptor (RXR) and functions as a transcriptional regulator of genes that modulate lipid metabolism and adipocyte gene expression.24 PPAR
is activated by such diverse agents as long-chain fatty acids, arachidonic and linoleic acid metabolites,25 and the thiazolidinedione class of antidiabetic drugs.26 The phosphorylation status of PPAR
has been shown to affect its transcription activity. PPAR
is a positive regulator for its target genes, whereas its phosphorylated form (PPAR
-Pi) is a negative regulator.27
Pitavastatin, also known as NK-104 (CAS 147526-32-7; monocalcium bis [(3R, 5S, 6E)-7-(2-cyclopropyl-4-(4-fluorophenyl)-3-quinolyl)-3,5-dihydroxy-6-heptenoate]) is a recently developed HMG-CoA reductase inhibitor that significantly reduces serum total cholesterol, LDL cholesterol, and triglycerides while modestly raising HDL cholesterol.28,29 We evaluated the effects of pitavastatin on the expression of CD36 by murine macrophages and demonstrate a novel mechanism by which pitavastatin inhibits CD36 expression, through PPAR
-dependent inhibition of CD36 gene transcription.
| Methods |
|---|
|
|
|---|
85%. Cells received treatments in serum-free medium.
THP1 cells (a human monocytic cell line; ATCC, Rockville, Md) were cultured in RPMI 1640 complete medium. Cells were adjusted to a density of 300x103/cm2 in dishes before addition of PMA to drive the differentiation into macrophages. After the completion of differentiation (
12 hours) and removal of PMA, cells were continued and treated in complete medium. These cells were used in fluorescence-activated cell sorter (FACS) studies because of the unavailability of antibodies to murine CD36.
Murine macrophages were obtained from C57BL/6 mice. Mice were injected intraperitoneally (3 mL per mouse) with 3% brewer thioglycollate medium (Difco). After 5 days, the mice were euthanized, and peritoneal macrophages were harvested by lavage. Cells were washed once with PBS and cultured in 60-mm dishes with complete RPMI medium for 4 hours. Medium containing floating cells was aspirated, and adherent cells were washed once with PBS, then cultured in complete medium.
Isolation of LDL and Preparation of OxLDL
LDL (1.019 to 1.063 g/mL) was isolated from normal human plasma by sequential ultracentrifugation, dialyzed against PBS containing 0.3 mmol/L EDTA, sterilized by filtration through a 0.22-µm filter, and stored under N2 gas at 4°C. Protein content was determined by the methods of Lowry.30 LDL was iodinated by the method of Bilheimer et al as described by Goldstein et al31 using carrier-free [125I]Na (Amersham Corp).
OxLDL was prepared as described previously.20 The purity and charge of both LDL and OxLDL were evaluated by examining electrophoretic migration in agarose gels. The degree of oxidation of LDL and OxLDL was determined by measuring the amount of thiobarbituric acid reactive substances (TBAR). LDL had TBAR values of <1 nmol/mg. OxLDL had TBAR values of >10 and <30 nmol/mg. All lipoproteins were used for experiments within 3 weeks after preparation.
Isolation of Total RNA, Purification of Poly(A+) RNA, and Northern Blotting
Cells were lysed in RNAzol B (Tel-Test, Inc), chloroform was extracted, and total cellular RNA was precipitated in isopropanol. After washing with 80% and 100% ethanol, the dried pellet of total RNA was dissolved in distilled water and quantified. The poly(A+) RNA was purified from
80 µg of total RNA with the PolyAT tract mRNA Isolation System III (Promega).
Poly(A+) RNA was loaded on 1% formaldehyde agarose gel. After electrophoresis, poly(A+) RNA was transferred to a Zeta-probe GT genomic-tested blotting membrane (Bio-Rad Laboratories) in 10xSSC by capillary force overnight. The blot was UV crosslinked for 2 minutes and prehybridized with Hybrisol I (Oncor, Inc) for 30 minutes before the addition of 32P randomly primed labeling probe for mouse CD36 or PPAR
or GAPDH. After overnight hybridization, the membrane was washed for 2x20 minutes with 2xSSC and 0.2% SDS and for 2x20 minutes with 0.2xSSC and 0.2% SDS at 55°C. The blot was autoradiographed by exposure to radiographic film (X-Omat AR, Kodak). Autoradiograms were assessed by densitometric scanning with a UMAX UC630 flatbed scanner attached to a Macintosh IIci (Apple Computer) running NIH Image software. The probe for mouse CD36 is an NsiI-BglII digest (base pairs 193 to 805). The template DNA for PPAR
was generated by reverse transcription-polymerase chain reaction (RT-PCR) based on the published sequences. The sequences of 5' and 3' oligonucleotides used for PPAR
were TCGGCGTTGTCATGATCCTC (121141) and GGTTCATAAAAGCACGCTGG (551571), respectively.
Flow Cytometry
After treatment, cells were lifted by addition of trypsin. Cells were washed 3 times with PBS. Approximately 1x106 cells were suspended in 300 µL of PBS containing 5% mouse serum and incubated for 30 minutes at room temperature with shaking. Cells then were added to 10 µL of mouse anti-human CD36 antibody conjugated to fluorescein isothiocyanate isomer 1 (FITC; Chemicon International Inc). After incubation with the antibody for 1 hour at room temperature, cells were washed 3 times with PBS. After suspension in PBS, cells were subjected to flow cytometric analysis with a Coulter FACScan.
Determination of Binding/Uptake of 125I-Labeled OxLDL to Macrophages
Binding/uptake of OxLDL was performed as described previously.18
Analysis of Phospho-P42/44 Mitogen-Activated Protein Kinase by Western Blotting
Analysis of phospho-P42/44 mitogen-activated protein (MAP) kinase was performed as described previously.32
Extraction of Nuclear Protein and Western Analysis of PPAR
and Phospho-PPAR
After treatment, cells were washed twice with PBS and then resuspended in 400 µL of cold buffer A (10 mmol/L HEPES, pH 7.9, 10 mmol/L KCl, 0.1 mmol/L EDTA, 0.1 mmol/L EGTA, 1 mmol/L DTT, 0.5 mmol/L PMSF). After 15 minutes incubation on ice, 25 µL of 10% NP-40 was added to the cell suspension, which was subjected to a vortex for 10 seconds. The supernatant was removed after being spun for 30 seconds at 13 000 rpm. The pellet was resuspended in 100 µL of cold buffer C (20 mmol/L HEPES, pH 7.91, 400 mmol/L KCl, 1 mmol/L EDTA, 1 mmol/L EGTA, freshly added 1 mmol/L DTT, 1 mmol/L PMSF, 1 µg/mL pepstatin A, 1 µg/mL leupeptin, 0.1 mmol/L P-aminobenzamidine, and 10 µg/mL aprotinin) and kept for 15 minutes at 4°C. The mixture was spun for 5 minutes at 13 000 rpm, and the supernatant was collected as nuclear proteins.
Nuclear proteins (500 µg) from each sample were incubated with an antibody to mouse PPAR
antibody. Immunoabsorbed proteins were separated by SDS-PAGE and transferred onto nylon-enhanced nitrocellulose membrane, then analyzed by Western blot for phospho-PPAR
(PPAR
-Pi) by incubation with anti-phosphoserine antibodies. The nuclear proteins were also used to analyze PPAR
protein expression by SDS-PAGE/Western blot.
| Results |
|---|
|
|
|---|
|
We next determined the effect of pitavastatin on CD36 protein expression. PMA-differentiated THP-1 cells (a human monocyte cell line) and human peripheral blood monocyte-derived macrophages were incubated with or without pitavastatin for 24 hours. CD36 surface protein expression was assessed by flow cytometry. Consistent with the effect of pitavastatin on CD36 mRNA, CD36 surface protein was substantially decreased (Figures 2A and 2B). To assess the functional significance of reduced expression of CD36 surface protein expression, we examined the binding/uptake of 125I-labeled OxLDL. Pitavastatin reduced both baseline binding/uptake of OxLDL and binding/uptake of OxLDL induced by a PPAR
ligand, prostaglandin J2 (PGJ2; data not shown).
|
Pitavastatin Blocks Induction of CD36 Expression by PPAR
Agonists
Ligand activation of PPAR
by OxLDL, PGJ2, or 15d-deoxy prostaglandin J2 (15d-PGJ2) induces CD36 gene transcription. To determine whether pitavastatin was able to abolish induction of CD36 mRNA by PPAR
ligands, macrophages were cotreated with OxLDL plus pitavastatin (Figure 3A) or PGJ2/15d-PGJ2 plus pitavastatin (Figure 3B). OxLDL, PGJ2, and 15d-PGJ2 each significantly increased CD36 expression. However, coincubation with pitavastatin decreased CD36 mRNA expression induced by PPAR
ligands (Figure 3). The inhibitory effect of pitavastatin on the induction of CD36 mRNA expression by PPAR
activation was also associated with decreased surface protein expression (Figure 4). Pitavastatin decreased CD36 surface protein expression induced by OxLDL in a concentration-dependent manner (Figure 4).
|
|
Pitavastatin Decreases CD36 Expression at the Transcriptional Level and by Inactivating PPAR
To determine whether pitavastatin decreased CD36 mRNA expression by reducing CD36 transcription or by altering CD36 mRNA stability, cells were treated with or without pitavastatin (10 µmol/L) in the presence of the transcriptional inhibitor actinomycin D. The half-life of CD36 was similar in both the presence and absence of pitavastatin (data not shown). Because CD36 RNA stability was not altered by pitavastatin, it is likely that pitavastatin downregulates CD36 mRNA at the transcriptional level.
To further investigate the mechanism by which pitavastatin regulates CD36 expression, we evaluated the effect of pitavastatin on PPAR
expression. Pitavastatin decreased expression of PPAR
mRNA (Figure 5A) and protein (Figure 5B) in a dose-dependent manner. The phosphorylation status of PPAR
has been shown to affect its transcription activity. PPAR
is a positive regulator for its target genes, whereas its phosphorylated form (PPAR
-Pi) is a negative regulator. Thus, the ratio of PPAR
-Pi to PPAR
is important for determining PPAR
-mediated transcriptional function. We evaluated PPAR
phosphorylation status in response to pitavastatin and found that expression of the nonphosphorylated form of PPAR
was decreased. Whereas the amount of PPAR
-Pi remained unchanged, the ratio of PPAR
-Pi to PPAR
was increased. This results in decreased PPAR
-dependent transcription and decreased expression of CD36. To determine the mechanism of PPAR
phosphorylation, we evaluated the effect of pitavastatin on p44/42 MAP kinase activity, which has been shown to phosphorylate serine residues in PPAR
. Beginning 4 hours after treatment with pitavastatin (and lasting for 24 hours), we observed increased p44/42 MAP kinase activity, as indicated by p44/42 MAP kinase phosphorylation (Figure 5C).
|
| Discussion |
|---|
|
|
|---|
and through MAP kinase-mediated phosphorylation of PPAR
. This results in an increased ratio of phosphorylated PPAR
to nonphosphorylated PPAR
, which leads to decreased CD36 gene transcription.
PPARs become transcriptionally active when bound to ligand.24 Growth factors, such as epidermal growth factor and platelet-derived growth factor, have been shown to phosphorylate PPAR
via the MAP kinase signaling pathway and to decrease PPAR
transcriptional activity.27 The NH2-terminal domain of PPAR
contains a consensus MAP kinase site in a region conserved between PPAR
1 and PPAR
2 isoforms.33 PPAR
proteins migrate on immunoblots as closely spaced doublets, a pattern suggestive of phosphorylation.34,35 A putative MAP kinase site is phosphorylated by ERK2 and JNK.33 Phosphorylation significantly inhibits both ligand-independent and -dependent transcriptional activation by PPAR
.33 This repression is mediated by MAP kinase phosphorylation of Ser82 on PPAR
1.27 Mutation of the phosphorylated residue (Ser82) prevents PPAR
1 phosphorylation and the growth factor-mediated repression of PPAR
-dependent transcription. This phosphorylation-mediated transcriptional repression results from an alteration in the ability of PPAR
to become transcriptionally activated by ligand and is not due to a reduced capacity of the PPAR
· RXR complex to heterodimerize or recognize its DNA binding site.27 We have previously shown that both transforming growth factor-ß36 and HDL32 induce MAP kinase-mediated phosphorylation of PPAR
.
The effect of statins on scavenger receptor expression has been evaluated previously. Lovastatin inhibited expression of both the type A scavenger receptor and CD36. Lovastatin decreased type A scavenger receptor mRNA in PMA-treated THP-1 cells.8 This inhibition was reversed by the addition of exogenous mevalonate.8 Similarly, lovastatin inhibited CD36 expression in human monocytic U937 cells, as measured by quantitative RT-PCR and FACS.9 Mevalonate completely reversed the effects of lovastatin, whereas excess LDL was only partially effective. Lovastatin was also shown to decrease expression of CD36 and the type A scavenger receptor in human blood-derived monocytes in culture for 2 and 5 days but not in more mature macrophages.37 Finally, monocyte-derived macrophages had decreased expression of CD36 and the type A scavenger receptor in hypercholesterolemic patients treated with atorvastatin relative to monocyte-derived macrophages from untreated patients.38 However, in these studies, no molecular mechanisms were identified by which statins decreased scavenger receptor expression.
In conclusion, the present study demonstrates that pitavastatin modulates phosphorylation and activity of PPAR
, which leads to decreased expression of CD36, a major macrophage scavenger receptor for oxidized lipids. The effect of pitavastatin on inhibition of CD36 expression may have relevance to both atherosclerotic foam cell formation mediated by CD36 and PPAR
and expression of other PPAR
-responsive inflammatory mediators expressed within vascular lesions.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
2. Takemoto M, Liao JK. Pleiotropic effects of 3-hydroxy-3-methylglutaryl coenzyme a reductase inhibitors. Arterioscler Thromb Vasc Biol. 2001; 21: 17121719.
3. Rosenson RS, Tangney CC. Antiatherothrombotic properties of statins: implications for cardiovascular event reduction. JAMA. 1998; 279: 16431650.
4. Laufs U, La Fata V, Plutzky J, et al. Upregulation of endothelial nitric oxide synthase by HMG CoA reductase inhibitors. Circulation. 1998; 97: 11291135.
5. Hernandez-Perera O, Perez-Sala D, Navarro-Antolin J, et al. Effects of the 3-hydroxy-3-methylglutaryl-CoA reductase inhibitors, atorvastatin and simvastatin, on the expression of endothelin-1 and endothelial nitric oxide synthase in vascular endothelial cells. J Clin Invest. 1998; 101: 27112719.[Medline] [Order article via Infotrieve]
6. Weber C, Erl W, Weber KS, et al. HMG-CoA reductase inhibitors decrease CD11b expression and CD11b-dependent adhesion of monocytes to endothelium and reduce increased adhesiveness of monocytes isolated from patients with hypercholesterolemia. J Am Coll Cardiol. 1997; 30: 12121217.[Abstract]
7. Kimura M, Kurose I, Russell J, et al. Effects of fluvastatin on leukocyte-endothelial cell adhesion in hypercholesterolemic rats. Arterioscler Thromb Vasc Biol. 1997; 17: 15211526.
8. Umetani N, Kanayama Y, Okamura M, et al. Lovastatin inhibits gene expression of type-I scavenger receptor in THP-1 human macrophages. Biochim Biophys Acta. 1996; 1303: 199206.[Medline] [Order article via Infotrieve]
9. Pietsch A, Erl W, Lorenz RL. Lovastatin reduces expression of the combined adhesion and scavenger receptor CD36 in human monocytic cells. Biochem Pharmacol. 1996; 52: 433439.[CrossRef][Medline] [Order article via Infotrieve]
10. Willaims JK, Sukhova G, Herrington D, et al. Pravastatin has cholesterol-lowering independent effects on the artery wall of atherosclerotic monkeys. J Am Coll Cardiol. 1998; 31: 684691.
11. Aikawa M, Rabkin E, Okada Y, et al. Lipid lowering by diet reduces matrix metalloproteinase activity and increases collagen content of rabbit atheroma: a potential mechanism of lesion stabilization. Circulation. 1998; 97: 24332444.
12. Colli S, Eligini S, Lalli M, et al. Vastatins inhibit tissue factor in cultured human macrophages: a novel mechanism of protection against atherothrombosis. Arterioscler Thromb Vasc Biol. 1998; 17: 265272.
13. Soma MR, Donetti E, Parolina C, et al. HMG CoA reductase inhibitors: in vivo effects on carotid intimal thickening in normocholesterolemic rabbits. Arterioscler Thromb. 1993; 13: 571578.
14. Guijjaro C, Blanco-Colio LM, Ortego M, et al. 3-Hydroxy-3-methylglutaryl coenzyme a reductase and isoprenylation inhibitors induce apoptosis of vascular smooth muscle cells in culture. Circ Res. 1998; 83: 490500.
15. Febbraio M, Hajjar DP, Silverstein RL. CD36: a class B scavenger receptor involved in angiogenesis, atherosclerosis, inflammation, and lipid metabolism. J Clin Invest. 2001; 108: 785791.[CrossRef][Medline] [Order article via Infotrieve]
16. de Winther MP, van Dijk KW, Havekes LM, et al. Macrophage scavenger receptor class A: a multifunctional receptor in atherosclerosis. Arterioscler Thromb Vasc Biol. 2000; 20: 290297.
17. Endemann G, Stanton L, Madden K, et al. CD36 is a receptor for oxidized low density lipoprotein. J Biol Chem. 1993; 268: 1181111816.
18. Nicholson A, Pearce SFA, Silverstein R. Oxidized LDL binds to CD36 on human monocyte-derived macrophages and transfected cell lines: evidence implicating the lipid moiety of the lipoprotein as the binding site. Arterioscler Thromb. 1995; 15: 269275.
19. Han J, Nicholson AC. Modulation of macrophage scavenger receptor expression by lipoproteins. Am J Pathol. 1998; 152: 16471654.[Abstract]
20. Han J, Hajjar DP, Febbraio M, et al. Native and modified low density lipoproteins increase the functional expression of the macrophage class B scavenger receptor, CD36. J Biol Chem. 1997; 272: 2165421659.
21. Febbraio M, Podrez EA, Smith JD, et al. Targeted disruption of the class B scavenger receptor CD36 protects against atherosclerotic lesion development in mice. J Clin Invest. 2000; 105: 10491056.[Medline] [Order article via Infotrieve]
22. Tontonoz P, Nagy L, Alvarez J, et al. PPAR
promotes monocyte/macrophage differentiation and uptake of oxidized LDL. Cell. 1998; 93: 241252.[CrossRef][Medline]
[Order article via Infotrieve]
23. Nagy L, Tontonoz P, Alvarez J, et al. Oxidized LDL regulates macrophage gene expression through ligand activation of PPAR
. Cell. 1998; 93: 229240.[CrossRef][Medline]
[Order article via Infotrieve]
24. Tontonoz P, Hu E, Spiegelman B. Regulation of adipocyte gene expression and differentiation by peroxisome proliferator activated receptor gamma. Curr Opin Genet Dev. 1995; 5: 571576.[CrossRef][Medline] [Order article via Infotrieve]
25. Forman BM, Tontonoz P, Chen J, et al. 15-Deoxy-delta 12, 14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR gamma. Cell. 1995; 83: 803812.[CrossRef][Medline] [Order article via Infotrieve]
26. Lehmann JM, Moore LB, Smith-Oliver TA, et al. An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor gamma (PPAR
). J Biol Chem. 1995; 270: 1295312956.
27. Camp HS, Tafuri SR. Regulation of peroxisome proliferator-activated receptor
activity by mitogen-activated protein kinase. J Biol Chem. 1997; 272: 1081110816.
28. Noji Y, Higashikata T, Inazu A, et al. Long-term treatment with pitavastatin (NK-104), a new HMG-CoA reductase inhibitor, of patients with heterozygous familial hypercholesterolemia. Atherosclerosis. 2002; 163: 157164.[CrossRef][Medline] [Order article via Infotrieve]
29. Saito Y, Yamada N, Teramoto T, et al. Clinical efficacy of pitavastatin, a new 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor, in patients with hyperlipidemia: dose-finding study using the double-blind, three-group parallel comparison. Arzneimittelforschung. 2002; 52: 251255.[Medline] [Order article via Infotrieve]
30. Lowry O, Rosebrogh N, Farr A, et al. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951; 193: 265275.
31. Goldstein J, Basu S, Brown M. Receptor-mediated endocytosis of low-density lipoprotein in cultured cells. Methods Enzymol. 1983; 98: 241260.[Medline] [Order article via Infotrieve]
32. Han J, Hajjar DP, Zhou X, et al. Regulation of peroxisome proliferator-activated receptor-gamma-mediated gene expression: a new mechanism of action for high density lipoprotein. J Biol Chem. 2002; 277: 2358223586.
33. Adams M, Reginato J, Shao D, et al. Transcriptional activation by peroxisome proliferator-activated receptor
is inhibited by phosphorylation at a consensus mitogen-activated kinase site. J Biol Chem. 1997; 272: 51285132.
34. Vidal-Puig A, Jimenez-Linan M, Lowell BB, et al. Regulation of PPAR gamma gene expression by nutrition and obesity in rodents. J Clin Invest. 1996; 97: 25532561.[Medline] [Order article via Infotrieve]
35. Xue JC, Schwarz EJ, Chawla A, et al. Distinct stages in adipogenesis revealed by retinoid inhibition of differentiation after induction of PPAR
. Mol Cell Biol. 1996; 16: 15671575.[Abstract]
36. Han J, Hajjar DP, Tauras JM, et al. Transforming growth factor-ß1 (TGF-ß1) and TGF-ß2 decrease expression of CD36, the type B scavenger receptor, through mitogen-activated protein kinase phosphorylation of peroxisome proliferator-activated receptor-
. J Biol Chem. 2000; 275: 12411246.
37. Hrboticky N, Draude G, Hapfelmeier G, et al. Lovastatin decreases the receptor-mediated degradation of acetylated and oxidized LDLs in human blood monocytes during the early stage of differentiation into macrophages. Arterioscler Thromb Vasc Biol. 1999; 19: 12671275.
38. Fuhrman B, Koren L, Volkova N, et al. Atorvastatin therapy in hypercholesterolemic patients suppresses cellular uptake of oxidized-LDL by differentiating monocytes. Atherosclerosis. 2002; 164: 179185.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
S. Collot-Teixeira, J. Martin, C. McDermott-Roe, R. Poston, and J. L. McGregor CD36 and macrophages in atherosclerosis Cardiovasc Res, August 1, 2007; 75(3): 468 - 477. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Umeji, S. Umemoto, S. Itoh, M. Tanaka, S. Kawahara, T. Fukai, and M. Matsuzaki Comparative effects of pitavastatin and probucol on oxidative stress, Cu/Zn superoxide dismutase, PPAR-{gamma}, and aortic stiffness in hypercholesterolemia Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2522 - H2532. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cho, E.-M. Park, M. Febbraio, J. Anrather, L. Park, G. Racchumi, R. L. Silverstein, and C. Iadecola The Class B Scavenger Receptor CD36 Mediates Free Radical Production and Tissue Injury in Cerebral Ischemia J. Neurosci., March 9, 2005; 25(10): 2504 - 2512. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kawakami, M. Tani, T. Chiba, K. Yui, S. Shinozaki, K. Nakajima, A. Tanaka, K. Shimokado, and M. Yoshida Pitavastatin Inhibits Remnant Lipoprotein-Induced Macrophage Foam Cell Formation Through ApoB48 Receptor-Dependent Mechanism Arterioscler Thromb Vasc Biol, February 1, 2005; 25(2): 424 - 429. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Han, M. Parsons, X. Zhou, A. C. Nicholson, A. M. Gotto Jr, and D. P. Hajjar Functional Interplay Between the Macrophage Scavenger Receptor Class B Type I and Pitavastatin (NK-104) Circulation, November 30, 2004; 110(22): 3472 - 3479. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2004 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |