Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2003;108:664-667
Published online before print August 4, 2003, doi: 10.1161/01.CIR.0000086978.95976.41
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
108/6/664    most recent
01.CIR.0000086978.95976.41v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cook, S. A.
Right arrow Articles by Rosenzweig, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cook, S. A.
Right arrow Articles by Rosenzweig, A.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*PHENYLEPHRINE
Related Collections
Right arrow Cell signalling/signal transduction
Right arrow Hypertrophy
Right arrow Gene therapy
Right arrowRelated Article

(Circulation. 2003;108:664.)
© 2003 American Heart Association, Inc.


Brief Rapid Communications

A20 Is Dynamically Regulated in the Heart and Inhibits the Hypertrophic Response

Stuart A. Cook, MRCP, PhD; Mikhail S. Novikov, MD; Youngkeun Ahn, MD, PhD; Takashi Matsui, MD, PhD; Anthony Rosenzweig, MD

From the Program in Cardiovascular Gene Therapy, Cardiovascular Research Center and Cardiology Division, Massachusetts General Hospital, Harvard Medical School, Boston, Mass.

Correspondence to Anthony Rosenzweig, MD, Massachusetts General Hospital, 114 16th St, Rm 2600, Charlestown, MA 02129. E-mail arosenzweig{at}partners.org

Received September 10, 2002; de novo received May 2, 2003; revision received June 18, 2003; accepted June 19, 2003.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— Nuclear factor (NF)–{kappa}B signaling has been implicated in cardiomyocyte hypertrophy. Here, we determine the cardiac regulation and biological activity of A20, an inhibitor of NF-{kappa}B signaling.

Methods and Results— Mice were subjected to aortic banding, and A20 expression was examined. A20 mRNA upregulation (4.3±1.5-fold; P<0.05) was detected 3 hours after banding, coinciding with peak NF-{kappa}B activation. A20 was also upregulated in cultured neonatal cardiomyocytes stimulated with phenylephrine or endothelin-1 (2.8±0.6- and 4±1.1-fold, respectively; P<0.05), again paralleling NF-{kappa}B activation. Infection of cardiomyocytes with an adenoviral vector (Ad) encoding A20 inhibited tumor necrosis factor-{alpha}–stimulated NF-{kappa}B signaling with an efficacy comparable to dominant negative inhibitor of {kappa}-B kinase ß (dnIKKß). Ad.dnIKKß-infected cardiomyocytes exhibited increased apoptosis when they were serum starved or subjected to hypoxia-reoxygenation, whereas Ad.A20-infected cardiomyocytes did not. Expression of Ad.A20 inhibited the hypertrophic response in cardiomyocytes stimulated with phenylephrine or endothelin-1.

Conclusions— A20 is dynamically regulated during acute biomechanical stress in the heart and functions to attenuate cardiac hypertrophy through the inhibition of NF-{kappa}B signaling without sensitizing cardiomyocytes to apoptotic cell death.


Key Words: hypertrophy • apoptosis • inflammation


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cardiomyocyte hypertrophy is a prominent feature of the heart’s response to biomechanical strain and neurohumoral stimuli.1 Initiation of the hypertrophic response involves the activation of multiple signaling pathways, including calcineurin, mitogen-activated protein kinases, calcium calmodulin–dependent protein kinases, Akt, and glycogen synthase kinase (GSK)-3ß.1 Recent studies suggest that nuclear factor (NF)–{kappa}B signaling also plays a role in cardiomyocyte hypertrophy,2 and inhibition of NF-{kappa}B signaling can attenuate cardiomyocyte hypertrophy in response to phenylephrine (PE) or endothelin-1 (ET-1) stimulation in vitro.3,4 However, inhibition of NF-{kappa}B in cardiomyocytes by overexpression of nondegradable I{kappa}B{alpha} sensitizes cardiomyocytes to apoptosis,5 raising concerns that NF-{kappa}B inhibition may have deleterious effects in the heart.6

See p 638

In the present study, we describe the regulation and biological activity of A20, a feedback inhibitor of NF-{kappa}B signaling,7 in the heart.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
In Vivo Aortic Banding
Biomechanical stress was achieved by banding the ascending aorta in the mouse as previously described.8

Cell Culture
Primary cardiomyocyte cultures were prepared as previously described.9

Recombinant Adenoviruses
Adenoviral vectors (Ad) were generated, propagated, and characterized as previously described.9 Ad.GFP contains cytomegalovirus-driven expression cassettes for ß-galactosidase and green fluorescent protein (GFP). Ad.dnIKKß10 and Ad.A20 are structurally similar but encode a kinase-inactive (K44A) IKKß mutant (a gift from Dr D. Goeddel, Tularik, South San Francisco, Calif) and Flag-tagged human A20 (a gift from Dr V. Dixit, Genentech, South San Francisco, Calif11), respectively, instead of ß-galactosidase. Cardiomyocytes were infected with adenoviral vectors at a multiplicity of infection (MOI) of 25 to 200.

Immunoblotting
Protein extraction and immunoblotting were performed as previously described.9

Reverse Transcription–Polymerase Chain Reaction and Quantitative Reverse Transcription–Polymerase Chain Reaction
RNA was isolated from hearts or cultured cardiomyocytes as previously described.12 Reverse transcription–polymerase chain reaction (RT-PCR) was performed with A20 primers (forward: TCGTGGCTCTGAAAACCAATG; reverse: GATGGGTCTTCTGAGGATGTTGC) using the one-step RT-PCR kit (Qiagen) before agarose gel electrophoresis. Quantitative RT-PCR was performed as previously described.12 Amplified product was detected by SYBR1 (vascular cell adhesion molecule [VCAM]-1 and intercellular adhesion molecule [ICAM]-1) or Taqman probe (A20). Fold-change in gene expression was determined as previously described.12 Primer sequences were as follows: VCAM-1 forward, GAAGCCGGTCATGGTCAAGT; VCAM-1 reverse, GACGGTCACCCTTGAACAGTTC; ICAM-1 forward, GAATCCAGCCCCTAATCTGACC; ICAM-1 reverse, CTCCCGTTTGACAGACTTCACC; A20 forward, GGAGACGGGACTTTGCTACGA; A20 reverse, GTGTGTCTGCTGAGGCCATTT; and Taqman probe, FAM-CGGAACT-GGAATGACGAATGGGACA-BHQ.

Cell Death ELISA
Apoptotic cell death was determined by ELISA for histone-associated DNA fragments, as previously described.9 Cardiomyocytes were subjected to serum deprivation (36 hours) or hypoxia-reoxygenation injury (4 hours hypoxia, 2 hours reoxygenation), as previously described.9

Leucine Incorporation
Cardiomyocytes were incubated with [4,5-3H]-leucine (1 µCi/mL) in the presence or absence of PE (100 µmol/L) or ET-1 (100 nmol/L) for 36 hours, and leucine incorporation was determined as previously described.13

Northern Blotting
RNA was extracted from cardiomyocytes using the RNeasy kit (Qiagen). RNA (10 µg) was separated by formaldehyde-agarose gel electrophoresis, transferred to nitrocellulose membrane, and ultra violet-crosslinked. Atrial natriuretic factor (ANF) expression was detected using an ANF probe, kindly supplied by Dr K. Bloch (Massachusetts General Hospital, Charlestown, Mass).

Statistics
All data are from >=3 independent experiments and represented as the mean±SEM. ANOVA was used to determine statistical significance. The null hypothesis was rejected at P<0.05.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
A20 Is Dynamically Regulated in the Heart In Vivo and in Cardiomyocytes In Vitro
A20 was dramatically upregulated after 3 hours of acute pressure overload but was not detected by RT-PCR in normal hearts or at other time points (Figure 1A). For more accurate quantification, we developed a quantitative RT-PCR assay using an A20-specific Taqman probe, which revealed that A20 mRNA increased 4.3±1.5-fold (P<0.05) at 3 hours after banding (relative to sham-operated animals) and returned to near-basal levels by 6 hours. A20 is an NF-{kappa}B–dependent gene, and its upregulation after pressure overload correlated with phosphorylation and degradation of the inhibitory I{kappa}B{alpha} subunit (Figure 1B). Correspondingly, restoration of I{kappa}B expression at 6 hours was associated with a return of A20 to basal levels of expression.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 1. A20 is dynamically regulated in the heart and inhibits NF-{kappa}B signaling. A, RT-PCR analysis of A20 gene expression. RT-PCR was performed on hearts after sham operation or aortic banding, as indicated. B, Total I{kappa}B{alpha} and phospho-I{kappa}B{alpha} levels after aortic banding. Proteins (50 µg/lane) from banded or sham-operated mouse hearts were separated by SDS-PAGE. Total I{kappa}B{alpha} (upper panel) and phospho-I{kappa}B{alpha} (lower panel) were detected by immunoblotting. C, I{kappa}B{alpha} and nuclear NF-{kappa}B in PE- or ET-1–stimulated cardiomyocytes. Cardiomyocytes were stimulated with PE or ET-1 as indicated. Proteins were separated by SDS-PAGE. I{kappa}B{alpha} (upper panel) and nuclear NF-{kappa}B (lower panel) were detected by immunoblotting.

A20 was upregulated in vitro by the hypertrophic agonists PE and ET-1 (2.8±0.6- and 4±1.1-fold, respectively, at 1 hour; P<0.05). As observed in vivo, A20 induction corresponded with NF-{kappa}B activation by PE or ET-1, evident as degradation of I{kappa}B{alpha} and nuclear translocation of the p65–NF-{kappa}B subunit (Figure 1C).

A20 Inhibits NF-{kappa}B Signaling in Cardiomyocytes
To examine the biological effects of A20 in cardiomyocytes, we generated a recombinant adenoviral vector expressing A20. Ad.A20 mediated expression of full-length A20 protein of the expected molecular weight in cardiomyocytes (data not shown). A20 expression inhibited degradation of cytosolic I{kappa}B{alpha} and nuclear translocation of the p65–NF-{kappa}B subunit in tumor necrosis factor (TNF)-{alpha}–stimulated cardiomyocytes in a manner comparable to dnIKKß (Figure 2A). As measured by quantitative RT-PCR, Ad.A20 also inhibited TNF-{alpha}–induced transcript levels for the NF-{kappa}B–dependent genes ICAM-1 and VCAM-1 in a dose-dependent manner and with an efficacy equivalent to Ad.dnIKKß (data not shown).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 2. A20 inhibits NF-{kappa}B signaling and attenuates the hypertrophic response without sensitizing cardiomyocytes to apoptosis. A, Immunoblots of I{kappa}B{alpha} and nuclear NF-{kappa}B. Myocytes were uninfected (lane 1) or infected with Ad.GFP (MOI=200, lanes 2 and 3), Ad.A20 (lane 4 MOI=200; lane 5 MOI=50), or dnIKKß (lane 6 MOI=200). Myocytes (lanes 4 to 6) were stimulated with TNF-{alpha} (25 ng/mL, 30 minutes). I{kappa}B{alpha} (upper panel) or NF-{kappa}B (lower panel) were detected by immunoblotting. B, Apoptosis. Cardiomyocytes were infected with Ad.GFP, Ad.A20, or Ad.dnIKK (MOI=200 for all) or were uninfected. Cells were serum starved for 36 hours or subjected to hypoxia-reoxygenation (Hyp/Reox). Apoptotic cell death was determined by ELISA9 (**P<0.01). C, Protein synthesis. Uninfected cardiomyocytes or cardiomyocytes infected with Ad.GFP or Ad.A20 (MOI=200) were stimulated with PE or ET-1 for 36 hours or were left unstimulated in the presence of [3H]-leucine. Leucine incorporation was determined relative to unstimulated control in each group (n=3 to 6, *P<0.05). D, ANF expression. Cardiomyocytes were uninfected (lanes 1 and 4) or infected with Ad.A20 (lanes 2 and 5) or Ad.GFP (lanes 3 and 6). Cardiomyocytes were left unstimulated (lanes 1 to 3) or stimulated with ET-1 for 36 hours (lanes 4 to 6). Upper panel, RNA was extracted, and ANF mRNA was determined by Northern blotting. Lower panel, ethidium bromide staining of ribosomal RNA.

A20 Does Not Enhance Cardiomyocyte Apoptosis
Serum starvation is a proapoptotic stimulus in cardiomyocytes.14 Consistent with prior studies,5 downstream inhibition of NF-{kappa}B in serum-starved cardiomyocytes by dnIKKß increased apoptosis as detected by ELISA for histone-associated DNA fragments9 (Figure 2B). A similar phenomenon was observed in cardiomyocytes after hypoxia-reoxygenation, which is a distinct apoptotic stimulus (Figure 2B).15 In contrast, A20 expression did not increase apoptosis in cardiomyocytes under either condition (Figure 2B).

A20 Inhibits the Hypertrophic Response
Cardiomyocytes infected with Ad.A20 exhibited an attenuated increase in protein synthesis after stimulation with either PE or ET-1 in vitro (P<0.01 versus GFP; Figure 2C). In addition, Ad.A20 inhibited ET-1–stimulated upregulation of ANF (Figure 2D).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Recent evidence suggests that NF-{kappa}B may play a role in hypertrophic signaling in cardiomyocytes.2,3 We examined the cardiac regulation and functional effects of A20, an NF-{kappa}B–regulated gene that plays an important role in feedback inhibition of NF-{kappa}B signaling.7 We found that A20 is dynamically regulated in the heart and is significantly induced by acute pressure overload at a time point corresponding with peak NF-{kappa}B activation. Similarly, A20 expression was induced in cardiomyocytes stimulated with PE or ET-1, coincident with NF-{kappa}B activation. A20 expression in cardiomyocytes in vitro inhibited NF-{kappa}B activation in response to TNF-{alpha}, as did expression of the downstream inhibitor dnIKKß. However, dnIKKß expression substantially increased cardiomyocyte apoptosis after serum deprivation or hypoxia-reoxygenation, whereas A20 expression did not. A20 also inhibited the hypertrophic response of cardiomyocytes in vitro to pharmacological stimulation with either PE or ET-1. Together, these data suggest that A20 may be part of an endogenous feedback mechanism that limits NF-{kappa}B signaling in the heart and modulates the hypertrophic response.

Growing evidence suggests cardiomyocytes have developed negative feedback mechanisms to limit the hypertrophic response.3,16 After acute pressure overload, A20 was upregulated at a time corresponding with the reported upregulation of two endogenous inhibitors of cardiomyocyte hypertrophy, SOCS-316 and iex-1.3 In the case of A20, it seems likely that its expression is mediated by pressure overload–induced NF-{kappa}B activation2,3 and that it plays a role in inhibiting NF-{kappa}B signaling. Although direct evidence for this hypothesis is not presented here, the central importance of NF-{kappa}B–mediated, A20-dependent feedback inhibition on NF-{kappa}B signaling has been conclusively demonstrated in mice.17

Previous studies have shown that inhibition of NF-{kappa}B activation by a nondegradable form of I{kappa}B{alpha} predisposes cardiomyocytes to apoptosis, suggesting that, at least under some circumstances, cardiomyocytes require NF-{kappa}B signaling for survival.5 Consistent with this observation, we found that NF-{kappa}B inhibition by dnIKKß increased cardiomyocyte apoptosis. In contrast, A20 expression, although as effective as dnIKKß in inhibiting NF-{kappa}B activation, did not increase apoptosis. It is not clear how this differential effect is achieved, but it may relate to the more proximal level at which A20 inhibits NF-{kappa}B signaling and is consistent with observations in other systems in which A20 expression may actually inhibit apoptosis.7 Whatever the underlying mechanism, it suggests that the consequences of NF-{kappa}B inhibition in cardiomyocytes can differ substantially according to the nature of the inhibition and that A20 expression may have important strategic advantages as a therapeutic approach to NF-{kappa}B inhibition in the heart.


*    Acknowledgments
 
We thank Dr V. Dixit (Genentech) for the A20 cDNA, Dr D. Goeddel (Tularik) for the IKKß cDNA, and Dr K. Bloch (Massachusetts General Hospital) for the ANF probe. This work was supported by the National Institutes of Health (grants HL-59521 and HL-61557 to Dr Rosenzweig and HL-04250 to Dr Matsui) and the Wellcome Trust (to Dr Cook). Dr Rosenzweig is an Established Investigator of the American Heart Association.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Molkentin JD, Dorn IG 2nd. Cytoplasmic signaling pathways that regulate cardiac hypertrophy. Annu Rev Physiol. 2001; 63: 391–426.[CrossRef][Medline] [Order article via Infotrieve]

2. Purcell NH, Tang G, Yu C, et al. Activation of NF-kappa B is required for hypertrophic growth of primary rat neonatal ventricular cardiomyocytes. Proc Natl Acad Sci U S A. 2001; 98: 6668–6673.[Abstract/Free Full Text]

3. De Keulenaer GW, Wang Y, Feng Y, et al. Identification of IEX-1 as a biomechanically controlled nuclear factor–kappaB target gene that inhibits cardiomyocyte hypertrophy. Circ Res. 2002; 90: 690–696.[Abstract/Free Full Text]

4. Hirotani S, Otsu K, Nishida K, et al. Involvement of nuclear factor–kappaB and apoptosis signal-regulating kinase 1 in G-protein–coupled receptor agonist–induced cardiomyocyte hypertrophy. Circulation. 2002; 105: 509–515.[Abstract/Free Full Text]

5. Mustapha S, Kirshner A, De Moissac D, et al. A direct requirement of nuclear factor–kappa B for suppression of apoptosis in ventricular myocytes. Am J Physiol. 2000; 279: H939–H945.

6. Force T, Haq S, Kilter H, et al. Apoptosis signal-regulating kinase/nuclear factor–kappaB: a novel signaling pathway regulates cardiomyocyte hypertrophy. Circulation. 2002; 105: 402–404.[Free Full Text]

7. Beyaert R, Heyninck K, Van Huffel S. A20 and A20-binding proteins as cellular inhibitors of nuclear factor–kappa B–dependent gene expression and apoptosis. Biochem Pharmacol. 2000; 60: 1143–1151.[CrossRef][Medline] [Order article via Infotrieve]

8. Hamawaki M, Coffman TM, Lashus A, et al. Pressure-overload hypertrophy is unabated in mice devoid of AT1A receptors. Am J Physiol. 1998; 274: H868–H873.[Medline] [Order article via Infotrieve]

9. Matsui T, Li L, del Monte F, et al. Adenoviral gene transfer of activated PI 3-kinase and Akt inhibits apoptosis of hypoxic cardiomyocytes in vitro. Circulation. 1999; 100: 2373–2379.[Abstract/Free Full Text]

10. Meiler SE, Hung RR, Gerszten RE, et al. Endothelial IKK beta signaling is required for monocyte adhesion under laminar flow conditions. J Mol Cell Cardiol. 2002; 34: 349–359.[CrossRef][Medline] [Order article via Infotrieve]

11. Opipari AW Jr, Boguski MS, Dixit VM. The A20 cDNA induced by tumor necrosis factor alpha encodes a novel type of zinc finger protein. J Biol Chem. 1990; 265: 14705–14708.[Abstract/Free Full Text]

12. Cook SA, Matsui T, Li L, et al. Transcriptional effects of chronic Akt activation in the heart. J Biol Chem. 2002; 277: 22528–22533.[Abstract/Free Full Text]

13. Choukroun G, Hajjar R, Kyriakis JM, et al. Role of the stress-activated protein kinases in endothelin-induced cardiomyocyte hypertrophy. J Clin Invest. 1998; 102: 1311–1320.[Medline] [Order article via Infotrieve]

14. Chao W, Shen Y, Li L, et al. Importance of FADD signaling in serum-deprivation- and hypoxia-induced cardiomyocyte apoptosis. J Biol Chem. 2002; 277: 31639–31645.[Abstract/Free Full Text]

15. Laderoute KR, Webster KA. Hypoxia/reoxygenation stimulates Jun kinase activity through redox signaling in cardiac myocytes. Circ Res. 1997; 80: 336–344.[Abstract/Free Full Text]

16. Yasukawa H, Hoshijima M, Gu Y, et al. Suppressor of cytokine signaling-3 is a biomechanical stress-inducible gene that suppresses gp130-mediated cardiac myocyte hypertrophy and survival pathways. J Clin Invest. 2001; 108: 1459–1467.[CrossRef][Medline] [Order article via Infotrieve]

17. Lee EG, Boone DL, Chai S, et al. Failure to regulate TNF-induced NF-kappaB and cell death responses in A20-deficient mice. Science. 2000; 289: 2350–2354.[Abstract/Free Full Text]


Related Article:

Is Nuclear Factor {kappa}B an Attractive Therapeutic Target for Treating Cardiac Hypertrophy?
Nicole H. Purcell and Jeffery D. Molkentin
Circulation 2003 108: 638-640. [Extract] [Full Text]



This article has been cited by other articles:


Home page
Cardiovasc ResHome page
S. Wu, R. Yin, R. Ernest, Y. Li, O. Zhelyabovska, J. Luo, Y. Yang, and Q. Yang
Liver X receptors are negative regulators of cardiac hypertrophy via suppressing NF-{kappa}B signalling
Cardiovasc Res, October 1, 2009; 84(1): 119 - 126.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J. Shaw, I. A. Eydelnant, and L. A. Kirshenbaum
Transgenic Expression of A20 Prevents Cardiac Cell Death and Myocardial Dysfunction After Myocardial Infarction
Circulation, April 10, 2007; 115(14): 1827 - 1829.
[Full Text] [PDF]


Home page
CirculationHome page
H.-L. Li, M.-L. Zhuo, D. Wang, A.-B. Wang, H. Cai, L.-H. Sun, Q. Yang, Y. Huang, Y.-S. Wei, P. P. Liu, et al.
Targeted Cardiac Overexpression of A20 Improves Left Ventricular Performance and Reduces Compensatory Hypertrophy After Myocardial Infarction
Circulation, April 10, 2007; 115(14): 1885 - 1894.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T. Ha, F. Hua, Y. Li, J. Ma, X. Gao, J. Kelley, A. Zhao, G. E. Haddad, D. L. Williams, I. W. Browder, et al.
Blockade of MyD88 attenuates cardiac hypertrophy and decreases cardiac myocyte apoptosis in pressure overload-induced cardiac hypertrophy in vivo
Am J Physiol Heart Circ Physiol, March 1, 2006; 290(3): H985 - H994.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. Backs and E. N. Olson
Control of Cardiac Growth by Histone Acetylation/Deacetylation
Circ. Res., January 6, 2006; 98(1): 15 - 24.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
T. Ha, Y. Li, F. Hua, J. Ma, X. Gao, J. Kelley, A. Zhao, G. E. Haddad, D. L. Williams, I. William Browder, et al.
Reduced cardiac hypertrophy in toll-like receptor 4-deficient mice following pressure overload
Cardiovasc Res, November 1, 2005; 68(2): 224 - 234.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
W. Chao, Y. Shen, L. Li, H. Zhao, S. E. Meiler, S. A. Cook, and A. Rosenzweig
Fas-associated death-domain protein inhibits TNF-{alpha} mediated NF-{kappa}B activation in cardiomyocytes
Am J Physiol Heart Circ Physiol, November 1, 2005; 289(5): H2073 - H2080.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. Gupta, D. Young, and S. Sen
Inhibition of NF-{kappa}B induces regression of cardiac hypertrophy, independent of blood pressure control, in spontaneously hypertensive rats
Am J Physiol Heart Circ Physiol, July 1, 2005; 289(1): H20 - H29.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T. Kiji, Y. Dohi, S. Takasawa, H. Okamoto, A. Nonomura, and S. Taniguchi
Activation of regenerating gene Reg in rat and human hearts in response to acute stress
Am J Physiol Heart Circ Physiol, July 1, 2005; 289(1): H277 - H284.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Aoyama, T. Matsui, M. Novikov, J. Park, B. Hemmings, and A. Rosenzweig
Serum and Glucocorticoid-Responsive Kinase-1 Regulates Cardiomyocyte Survival and Hypertrophic Response
Circulation, April 5, 2005; 111(13): 1652 - 1659.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Chandrasekar, S. Mummidi, W. C. Claycomb, R. Mestril, and M. Nemer
Interleukin-18 Is a Pro-hypertrophic Cytokine That Acts through a Phosphatidylinositol 3-Kinase-Phosphoinositide-dependent Kinase-1-Akt-GATA4 Signaling Pathway in Cardiomyocytes
J. Biol. Chem., February 11, 2005; 280(6): 4553 - 4567.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
K. M. Regula, D. Baetz, and L. A. Kirshenbaum
Nuclear Factor-{kappa}B Represses Hypoxia-Induced Mitochondrial Defects and Cell Death of Ventricular Myocytes
Circulation, December 21, 2004; 110(25): 3795 - 3802.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. C. Harrison, C. R. Roberts, D. B. Hood, M. Sweeney, J. M. Gould, E. W. Bush, and T. A. McKinsey
The CRM1 Nuclear Export Receptor Controls Pathological Cardiac Gene Expression
Mol. Cell. Biol., December 15, 2004; 24(24): 10636 - 10649.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Y. Li, T. Ha, X. Gao, J. Kelley, D. L. Williams, I. W. Browder, R. L. Kao, and C. Li
NF-{kappa}B activation is required for the development of cardiac hypertrophy in vivo
Am J Physiol Heart Circ Physiol, October 1, 2004; 287(4): H1712 - H1720.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. E Hardt and J. Sadoshima
Negative regulators of cardiac hypertrophy
Cardiovasc Res, August 15, 2004; 63(3): 500 - 509.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
N. H. Purcell and J. D. Molkentin
Is Nuclear Factor {kappa}B an Attractive Therapeutic Target for Treating Cardiac Hypertrophy?
Circulation, August 12, 2003; 108(6): 638 - 640.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
108/6/664    most recent
01.CIR.0000086978.95976.41v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cook, S. A.
Right arrow Articles by Rosenzweig, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cook, S. A.
Right arrow Articles by Rosenzweig, A.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*PHENYLEPHRINE
Related Collections
Right arrow Cell signalling/signal transduction
Right arrow Hypertrophy
Right arrow Gene therapy
Right arrowRelated Article