Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2003;108:1930-1932
Published online before print October 6, 2003, doi: 10.1161/01.CIR.0000096055.62724.C5
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
108/16/1930    most recent
01.CIR.0000096055.62724.C5v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Calabró, P.
Right arrow Articles by Yeh, E. T.H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Calabró, P.
Right arrow Articles by Yeh, E. T.H.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Related Collections
Right arrow Pathophysiology
Right arrow Risk Factors
Right arrow Smooth muscle proliferation and differentiation
Right arrow Mechanism of atherosclerosis/growth factors

(Circulation. 2003;108:1930.)
© 2003 American Heart Association, Inc.


Brief Rapid Communications

Inflammatory Cytokines Stimulated C-Reactive Protein Production by Human Coronary Artery Smooth Muscle Cells

Paolo Calabró, MD; James T. Willerson, MD; Edward T.H. Yeh, MD

From the Department of Cardiology, University of Texas-M.D. Anderson Cancer Center (E.T.H.Y.), the University of Texas-Houston Health Science Center (P.C., J.T.W., E.T.H.Y.), and Texas Heart Institute, St Luke’s Episcopal Hospital (P.C., J.T.W., E.T.H.Y.), Houston, Tex.

Correspondence to Edward T.H. Yeh, MD, Department of Cardiology, 1515 Holcombe Blvd, Box 449, University of Texas-M.D. Anderson Cancer Center, Houston, TX 77030-4095. E-mail etyeh{at}mdanderson.org

Received June 26, 2003; de novo received August 6, 2003; revision received August 26, 2003; accepted August 26, 2003.


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— Serum C-reactive protein (CRP) levels are good predictors of the development of cardiovascular events in apparently healthy men and women. CRP has been believed to be produced exclusively by hepatocytes during the acute-phase response. Several lines of evidence have suggested that atherosclerotic arteries can also produce CRP. However, the cell types that produce CRP locally in the atherosclerotic arterial wall have not been clearly identified.

Methods and Results— Human coronary artery smooth muscle cells (HCASMCs) and human umbilical vein endothelial cells (HUVECs) were incubated with interleukin-1ß (IL-1ß), IL-6, their combination, tumor necrosis factor-{alpha} (TNF-{alpha}), or lipopolysaccharide (LPS) at different concentrations. The supernatants were concentrated and analyzed by a high-sensitivity enzyme-linked immunosorbent assay specific for human CRP. RNA was extracted from the HCASMCs for reverse transcriptase-polymerase chain reaction (RT-PCR) using specific primers for the CRP. Maximal CRP production was observed in HCASMCs after 48 hours of incubation with the combination of 25 ng/mL of IL-1ß and 10 ng/mL of IL-6, whereas incubation with IL-1ß or IL-6 alone only modestly induced CRP. Incubation with TNF-{alpha} (50 ng/mL) or LPS (1000 EU/mL) resulted in an increase in CRP production comparable to the IL-1ß and IL-6 combination. The induction of CRP in HCASMCs was independently confirmed by RT-PCR comparing the relative CRP mRNA levels. The induction of CRP production by HCASMCs was not reproduced in HUVECs, however.

Conclusions— These results demonstrated that HCASMCs, but not HUVECs, could produce CRP in response to inflammatory cytokines. The locally produced CRP could directly participate in atherogenesis and the development of cardiovascular complications.


Key Words: atherosclerosis • inflammation • muscle, smooth • interleukins • risk factors


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
C-reactive protein (CRP), a marker of inflammation, is an important predictor of future cardiovascular events in apparently healthy men and women1–4 and could directly participate in the pathogenesis of atherosclerosis through activation of endothelial cells.5–9 CRP, named for its capacity to bind to the C-polysaccharide of Streptococcus pneumoniae, was the first acute-phase protein to be described.10 CRP, like other acute-phase proteins, is synthesized by the liver in response to microbial infection, tissue injury, and autoimmune disorders. It had been shown that interleukin-1ß (IL-1ß) and IL-6 strongly induced the expression of CRP in human hepatocytes11 and hepatoma cells.12 Recently, human neuronal cells were found to produce CRP in Alzheimer’s disease.13 In addition, renal cortical tubular epithelial cells were shown to produce CRP after inflammatory stimuli.14 Interestingly, CRP has also been found in human atherosclerotic plaques,15 which could be the result of indirect deposit from circulating cells or direct production by cells in the arterial wall. We show that human coronary artery smooth muscle cells (HCASMCs), but not human umbilical vein endothelial cells (HUVECs), can synthesize CRP after stimulation by inflammatory cytokines.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture
HCASMCs, HUVECs, and endothelial cell supplements were purchased from Cascade Biologics; penicillin, streptomycin, medium 231, medium 199, and smooth muscle cell growth supplement were from Gibco BRL; and fetal bovine serum, human serum, heparin, and gelatin were obtained from Sigma. HCASMCs were plated onto 0.1% gelatin-coated culture dishes from Corning, Inc, and grown in 231 medium with growth supplement and 1% penicillin/streptomycin; HUVECs were plated onto 0.1% gelatin-coated culture dishes and grown in 199 medium with endothelial growth supplement, heparin, antibiotics, and 15% fetal bovine serum. Cells were used at passage 5 to 7.

CRP Assays
CRP level in the cell supernatant was measured using a commercial enzyme-linked immunosorbent assay (ELISA) kit specific for human CRP (Diagnostic System Laboratories) according to the manufacturer’s directions. The minimum detectable concentration of the assay was 1.6 ng/mL. All the experiments were performed in triplicate. Cells were cultured in 6-well plates until 80% to 90% confluent and were incubated for 48 hours with recombinant human IL-1ß (R&D Systems) (25 ng/mL), recombinant human IL-6 (R&D Systems) (10 ng/mL), their combination, recombinant human tumor necrosis factor-{alpha} (TNF-{alpha}) (R&D Systems) (50 ng/mL), or lipopolysaccharide (LPS) derived from Escherichia coli O113:H10 (Associates of Cape Cod, Inc) (1000 EU/mL); the culture supernatants were then concentrated ({approx}10 times) using centrifugal filter units (Millipore) and assayed for CRP.

CRP mRNA Expression
Cells cultured in 60-mm plates were incubated for 48 hours with 25 ng/mL IL-1ß, 10 ng/mL IL-6, their combination, 50 ng/mL TNF-{alpha}, and 1000 EU/mL LPS, and total cellular RNA was extracted by Trizol reagent. Reverse-transcriptase polymerase chain reaction (RT-PCR) was performed with the Access RT-PCR System (Promega) according to the manufacturer’s directions. For each reaction, 1 µg of total RNA served as a template. For amplification, a primer pair specific for human CRP (forward, TCGTATGCCACCAAGAGACAAGACA; reverse AACACTTCGCCTTGCACTTCATACT; GenBank accession No. M11725) was used. These primers were designed to yield a product of 440 bp after 40 amplification cycles. In all experiments, control reactions were performed substituting sterile nuclease-free water for the RNA template in the reaction. Glyceraldehyde-3-phosphate dehydrogenase (GADPH) was amplified as a reference for quantification of CRP mRNA. The RT-PCR products were visualized on 1% agarose gel with ethidium bromide.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
CRP Production by HCASMCs, but Not by HUVECs
The results of CRP released into the media and the CRP mRNA levels in HCASMCs after treatment with inflammatory cytokines were shown in Figures 1 and 2, respectively. As shown in Figure 1A, CRP production was minimal without stimulation, and incubation of HCASMCs with 50 ng/mL of IL-1ß or 10 ng/mL of IL-6 alone led to a small but significant induction. Maximal CRP production was observed after the combination of the 2 cytokines (Figure 1B). TNF-{alpha} or LPS also induced a similar level of CRP production and showed a dose-responsive relationship (Figure 1C). In contrast, CRP production could not be detected in HUVECs after similar stimulation protocols (data not shown). To confirm the results of CRP protein production in HCASMCs, we also assayed the mRNA levels in HCASMCs by RT-PCR. Figure 2 shows CRP mRNA levels in HCASMCs after the different treatments. IL-1 ß plus IL-6 combination caused a significant increase in CRP mRNA level compared with baseline. Treatment with LPS and TNF-{alpha} also upregulates the CRP mRNA levels. The RT-PCR amplified band was confirmed to be authentic CRP by direct sequencing.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 1. Effect of cytokine and LPS treatment on CRP protein production in HCASMCs. HCASMCs were incubated with different stimuli for 48 hours and supernatants were analyzed for CRP. Data represent a mean±SD. This has also been repeated 3 times. Statistically significant CRP productions (P<0.05) were indicated by an asterisk. The data were analyzed using one-way analysis of variance followed by the Scheffe test for multiple comparisons.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 2. Effect of cytokine and LPS treatment on mRNA levels in HCASMCs. HCASMCs were incubated with different stimuli for 48 hours and CRP mRNA expression assessed by RT-PCR. This has also been repeated 3 times. Statistically significant CRP productions (P<0.05) were indicated by an asterisk. The data were analyzed using one-way analysis of variance followed by the Scheffe test for multiple comparisons.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
CRP has been shown to be an excellent predictor of future cardiovascular events in apparently healthy men and women.3,4 This could be in part the result of some of the biological properties of CRP such as its stability, lack of diurnal variation, and lack of influence of gender and age.10 However, accumulating evidence also points to the possibility that CRP is a direct participant in vascular inflammation.16 One of the outstanding unresolved issues in this field is the source of CRP production in humans. It has been previously assumed that hepatocytes are the only source of CRP production during the acute-phase response. During the acute-phase reaction, serum CRP levels often increase up to 100 or 200 µg/mL; however, the level of serum CRP that is useful for predicting cardiovascular risk is 1 to 3 µg/mL. In fact, patients with serum CRP levels >10 µg/mL should have the test repeated at a late date to exclude infection, autoimmune diseases, or malignancy.17 Thus, we sought to identify another source of CRP production that could help explain the lower level of CRP useful for cardiovascular risk prediction.

We show that CRP is produced by HCASMCs, but not by HUVECs, after exposure to inflammatory cytokines. This locally produced CRP could play an important role in the activation of endothelial cells.5–9 Two studies have shown that both epithelial cells of the respiratory tract and renal epithelium produce CRP.14,18 Moreover, neuronal cells also seem to be capable of synthesizing acute-phase reactants involved in the pathogenesis of neurodegenerative disease.13 These studies expand the variety of cell types that could participate in CRP production; however, relevance of these observations to the pathogenesis of atherosclerosis is doubtful. CRP has been observed to colocalize with the terminal complement complex in atherosclerotic plaques.19 In this report, however, the authors suggested that CRP is deposited from circulating CRP produced by the liver instead of local synthesis. In contrast, work by Yasojima et al.15 suggested that cells in the arterial wall synthesize CRP. Using in situ hybridization techniques, the authors showed that elongated muscle-like cells inside the atherosclerotic plaque were positive for CRP. Our findings, thus, provide a direct demonstration that HCASMCs, but not HUVECs, are a source of locally produced CRP in the arterial wall. The locally produced CRP can directly participate in atherogenesis and the development of cardiovascular complications.

Isolated human hepatocytes can produce 10 times more CRP compared with control after stimulation.20 Human hepatoma cell line HepG2 is able to produce CRP {approx}4-fold compared with control in conditions similar to those used in our experiments.21 Another hepatoma cell line Hep3B stimulated with conditioned medium (generated by stimulating peripheral blood mononuclear cell with LPS at a dose of 1 µg/mL for 24 hours) showed an {approx}50-fold increase in CRP mRNA compared with unstimulated cells.14 Thus, CRP productions by human coronary artery smooth muscle cells is less robust than those produced by the liver. This could partly account for the lower serum level of CRP (1 to 3 mg/L) useful for cardiovascular risk prediction and the high level of CRP (>10 mg/L) observed during the acute-phase response.


*    Acknowledgments
 
This work was supported in part by the DREAM project.


*    Footnotes
 
Guest editor for this article was Prediman K. Shah, MD, Cedars-Sinai Medical Center, Los Angeles, Calif.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Shah PK. Circulating markers of inflammation for vascular risk prediction: are they ready for prime time. Circulation. 2000; 101: 1758–1759.[Free Full Text]

2. Libby P, Ridker PM, Maseri A. Inflammation and atherosclerosis. Circulation. 2002; 105: 1135–1143.[Abstract/Free Full Text]

3. Ridker PM. C-reactive protein and risks of future myocardial infarction and thrombotic stroke. Eur Heart J. 1998; 19: 1–3.[Free Full Text]

4. Ridker PM, Rifai N, Rose L, et al. Comparison of C-reactive protein and low-density lipoprotein cholesterol levels in the prediction of first cardiovascular events. N Engl J Med. 2002; 347: 1557–1565.[Abstract/Free Full Text]

5. Pasceri V, Willerson JT, Yeh ET. Direct proinflammatory effect of C-reactive protein on human endothelial cells. Circulation. 2000; 102: 2165–2168.[Abstract/Free Full Text]

6. Pasceri V, Cheng JS, Willerson JT, et al. Modulation of C-reactive protein-mediated monocyte chemoattractant protein-1 induction in human endothelial cells by anti-atherosclerosis drugs. Circulation. 2001; 103: 2531–2534.[Abstract/Free Full Text]

7. Venugopal SK, Devaraj S, Yuhanna I, et al. Demonstration that C-reactive protein decreases eNOS expression and bioactivity in human aortic endothelial cells. Circulation. 2002; 106: 1439–1441.[Abstract/Free Full Text]

8. Verma S, Wang CH, Li SH, et al. A self-fulfilling prophecy: C-reactive protein attenuates nitric oxide production and inhibits angiogenesis. Circulation. 2002; 106: 913–919.[Abstract/Free Full Text]

9. Verma S, Li SH, Badiwala MV, et al. Endothelin antagonism and interleukin-6 inhibition attenuate the proatherogenic effects of C-reactive protein. Circulation. 2002; 105: 1890–1896.[Abstract/Free Full Text]

10. Yeh ET, Palusinski RP. C-reactive protein: the pawn has been promoted to queen. Curr Atheroscler Rep. 2003; 5: 101–105.[Medline] [Order article via Infotrieve]

11. Moshage HJ, Roelofs HM, van Pelt JF, et al. The effect of interleukin-1, interleukin-6 and its interrelationship on the synthesis of serum amyloid A and C-reactive protein in primary cultures of adult human hepatocytes. Biochem Biophys Res Commun. 1988; 155: 112–117.[CrossRef][Medline] [Order article via Infotrieve]

12. Ganter U, Arcone R, Toniatti C, et al. Dual control of C-reactive protein gene expression by interleukin-1 and interleukin-6. Embo J. 1989; 8: 3773–3779.[Medline] [Order article via Infotrieve]

13. Yasojima K, Schwab C, McGeer EG, et al. Human neurons generate C-reactive protein and amyloid P: upregulation in Alzheimer’s disease. Brain Res. 2000; 887: 80–89.[CrossRef][Medline] [Order article via Infotrieve]

14. Jabs WJ, Logering BA, Gerke P, et al. The kidney as a second site of human C-reactive protein formation in vivo. Eur J Immunol. 2003; 33: 152–161.[CrossRef][Medline] [Order article via Infotrieve]

15. Yasojima K, Schwab C, McGeer EG, et al. Generation of C-reactive protein and complement components in atherosclerotic plaques. Am J Pathol. 2001; 158: 1039–1051.[Abstract/Free Full Text]

16. Yeh ET, Anderson HV, Pasceri V, et al. C-reactive protein: linking inflammation to cardiovascular complications. Circulation. 2001; 104: 974–975.[Free Full Text]

17. Yeh ET, Willerson JT. Coming of age of C-reactive protein: using inflammation markers in cardiology. Circulation. 2003; 107: 370–371.[Free Full Text]

18. Gould JM, Weiser JN. Expression of C-reactive protein in the human respiratory tract. Infect Immun. 2001; 69: 1747–1754.[Abstract/Free Full Text]

19. Torzewski J, Torzewski M, Bowyer DE, et al. C-reactive protein frequently colocalizes with the terminal complement complex in the intima of early atherosclerotic lesions of human coronary arteries. Arterioscler Thromb Vasc Biol. 1998; 18: 1386–1392.[Abstract/Free Full Text]

20. Wigmore SJ, Fearon KC, Maingay JP, et al. Interleukin-8 can mediate acute-phase protein production by isolated human hepatocytes. Am J Physiol. 1997; 273: E720–E726.[Medline] [Order article via Infotrieve]

21. Smith JW, McDonald TL. Production of serum amyloid A and C-reactive protein by HepG2 cells stimulated with combinations of cytokines or monocyte conditioned media: the effects of prednisolone. Clin Exp Immunol. 1992; 90: 293–299.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. Largo, M. J. Martinez-Calatrava, O. Sanchez-Pernaute, M. E. Marcos, J. Moreno-Rubio, C. Aparicio, J. Egido, and G. Herrero-Beaumont
Effect of a high dose of glucosamine on systemic and tissue inflammation in an experimental model of atherosclerosis aggravated by chronic arthritis
Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H268 - H276.
[Abstract] [Full Text] [PDF]


Home page
CJASNHome page
D. K. Hothi, L. Rees, J. Marek, J. Burton, and C. W. McIntyre
Pediatric Myocardial Stunning Underscores the Cardiac Toxicity of Conventional Hemodialysis Treatments
Clin. J. Am. Soc. Nephrol., April 1, 2009; 4(4): 790 - 797.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
S. Devaraj, U. Singh, and I. Jialal
The Evolving Role of C-Reactive Protein in Atherothrombosis
Clin. Chem., February 1, 2009; 55(2): 229 - 238.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
O. K. Chun, S.-J. Chung, K. J. Claycombe, and W. O. Song
Serum C-Reactive Protein Concentrations Are Inversely Associated with Dietary Flavonoid Intake in U.S. Adults
J. Nutr., April 1, 2008; 138(4): 753 - 760.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
X. Wang, D. Liao, U. Bharadwaj, M. Li, Q. Yao, and C. Chen
C-Reactive Protein Inhibits Cholesterol Efflux From Human Macrophage-Derived Foam Cells
Arterioscler. Thromb. Vasc. Biol., March 1, 2008; 28(3): 519 - 526.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
R. R. S. Packard and P. Libby
Inflammation in Atherosclerosis: From Vascular Biology to Biomarker Discovery and Risk Prediction
Clin. Chem., January 1, 2008; 54(1): 24 - 38.
[Abstract] [Full Text] [PDF]


Home page
Biol Res NursHome page
D. Lithgow, A. Nyamathi, D. Elashoff, O. Martinez-Maza, and C. Covington
C-reactive Protein in Nipple Aspirate Fluid Associated With Gail Model Factors
Biol Res Nurs, October 1, 2007; 9(2): 108 - 116.
[Abstract] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. Memoli, A. Procino, P. Calabro, P. Esposito, G. Grandaliano, G. Pertosa, M. D. Prete, M. Andreucci, S. D. Lillo, G. Ferulano, et al.
Inflammation may modulate IL-6 and C-reactive protein gene expression in the adipose tissue: the role of IL-6 cell membrane receptor
Am J Physiol Endocrinol Metab, October 1, 2007; 293(4): E1030 - E1035.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
T. Kuji, T. Masaki, L. Li, and A. K. Cheung
Expression of C-reactive protein in myointimal hyperplasia in a porcine arteriovenous graft model
Nephrol. Dial. Transplant., September 1, 2007; 22(9): 2469 - 2475.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
P. Singh, M. Hoffmann, R. Wolk, A. S.M. Shamsuzzaman, and V. K. Somers
Leptin Induces C-Reactive Protein Expression in Vascular Endothelial Cells
Arterioscler. Thromb. Vasc. Biol., September 1, 2007; 27(9): e302 - e307.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
P. J. Pussinen, K. Tuomisto, P. Jousilahti, A. S. Havulinna, J. Sundvall, and V. Salomaa
Endotoxemia, Immune Response to Periodontal Pathogens, and Systemic Inflammation Associate With Incident Cardiovascular Disease Events
Arterioscler. Thromb. Vasc. Biol., June 1, 2007; 27(6): 1433 - 1439.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
S. Norja, L. Nuutila, P. J Karhunen, and S. Goebeler
C-reactive protein in vulnerable coronary plaques
J. Clin. Pathol., May 1, 2007; 60(5): 545 - 548.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
M. Tabuchi, K. Inoue, H. Usui-Kataoka, K. Kobayashi, M. Teramoto, K. Takasugi, K. Shikata, M. Yamamura, K. Ando, K. Nishida, et al.
The association of C-reactive protein with an oxidative metabolite of LDL and its implication in atherosclerosis
J. Lipid Res., April 1, 2007; 48(4): 768 - 781.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A. Barac, U. Campia, and J. A. Panza
Methods for Evaluating Endothelial Function in Humans
Hypertension, April 1, 2007; 49(4): 748 - 760.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
W. Koenig and N. Khuseyinova
Biomarkers of Atherosclerotic Plaque Instability and Rupture
Arterioscler. Thromb. Vasc. Biol., January 1, 2007; 27(1): 15 - 26.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. A. Albert and P. M Ridker
C-Reactive Protein as a Risk Predictor: Do Race/Ethnicity and Gender Make a Difference?
Circulation, August 1, 2006; 114(5): e67 - e74.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
E. Paffen and M. P.M. deMaat
C-reactive protein in atherosclerosis: A causal factor?
Cardiovasc Res, July 1, 2006; 71(1): 30 - 39.
[Abstract] [Full Text] [PDF]


Home page
Psychosom. Med.Home page
M. Hamer, E. Williams, R. Vuonovirta, P. Giacobazzi, E. L. Gibson, and A. Steptoe
The Effects of Effort-Reward Imbalance on Inflammatory and Cardiovascular Responses to Mental Stress
Psychosom Med, May 1, 2006; 68(3): 408 - 413.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Okopien, R. Krysiak, and Z. S. Herman
Effects of Short-Term Fenofibrate Treatment on Circulating Markers of Inflammation and Hemostasis in Patients with Impaired Glucose Tolerance
J. Clin. Endocrinol. Metab., May 1, 2006; 91(5): 1770 - 1778.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
J. Krupinski, M. M. Turu, J. Martinez-Gonzalez, A. Carvajal, J. O. Juan-Babot, E. Iborra, M. Slevin, F. Rubio, and L. Badimon
Endogenous Expression of C-Reactive Protein Is Increased in Active (Ulcerated Noncomplicated) Human Carotid Artery Plaques
Stroke, May 1, 2006; 37(5): 1200 - 1204.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
J. Montaner, I. Fernandez-Cadenas, C. A. Molina, M. Ribo, R. Huertas, A. Rosell, A. Penalba, L. Ortega, P. Chacon, and J. Alvarez-Sabin
Poststroke C-Reactive Protein Is a Powerful Prognostic Tool Among Candidates for Thrombolysis
Stroke, May 1, 2006; 37(5): 1205 - 1210.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
S. Tsimikas, J. T. Willerson, and P. M. Ridker
C-reactive protein and other emerging blood biomarkers to optimize risk stratification of vulnerable patients.
J. Am. Coll. Cardiol., April 18, 2006; 47(8 Suppl): C19 - C31.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
D Skowasch, S Schrempf, C J Preusse, J A Likungu, A Welz, B Luderitz, and G Bauriedel
Tissue resident C reactive protein in degenerative aortic valves: correlation with serum C reactive protein concentrations and modification by statins
Heart, April 1, 2006; 92(4): 495 - 498.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
I. Jialal, S. Devaraj, U. Singh, J. Fan, and Y. E. Chen
Sources of CRP in Atherosclerotic Lesions
Am. J. Pathol., March 1, 2006; 168(3): 1054 - 1056.
[Full Text] [PDF]


Home page
CirculationHome page
E. J. Armstrong, D. A. Morrow, and M. S. Sabatine
Inflammatory Biomarkers in Acute Coronary Syndromes: Part II: Acute-Phase Reactants and Biomarkers of Endothelial Cell Activation
Circulation, February 21, 2006; 113(7): e152 - e155.
[Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
M Meuwissen, A C van der Wal, H W M Niessen, K T Koch, R J de Winter, C M van der Loos, S Z H Rittersma, S A J Chamuleau, J G P Tijssen, A E Becker, et al.
Colocalisation of intraplaque C reactive protein, complement, oxidised low density lipoprotein, and macrophages in stable and unstable angina and acute myocardial infarction
J. Clin. Pathol., February 1, 2006; 59(2): 196 - 201.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
D.-H. Kang, S.-K. Park, I.-K. Lee, and R. J. Johnson
Uric Acid-Induced C-Reactive Protein Expression: Implication on Cell Proliferation and Nitric Oxide Production of Human Vascular Cells
J. Am. Soc. Nephrol., December 1, 2005; 16(12): 3553 - 3562.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
I. Ciubotaru, L. A. Potempa, and R. C. Wander
Production of Modified C-Reactive Protein in U937-Derived Macrophages
Experimental Biology and Medicine, November 1, 2005; 230(10): 762 - 770.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
S. Yung, R. C.W. Tsang, Y. Sun, J. K.H. Leung, and T. M. Chan
Effect of Human Anti-DNA Antibodies on Proximal Renal Tubular Epithelial Cell Cytokine Expression: Implications on Tubulointerstitial Inflammation in Lupus Nephritis
J. Am. Soc. Nephrol., November 1, 2005; 16(11): 3281 - 3294.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. Wang, S. Oparil, Y.-F. Chen, M. A. McCrory, G. A. Skibinski, W. Feng, and A. J. Szalai
Estrogen Treatment Abrogates Neointima Formation in Human C-Reactive Protein Transgenic Mice
Arterioscler. Thromb. Vasc. Biol., October 1, 2005; 25(10): 2094 - 2099.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. Feinbloom and K. A. Bauer
Assessment of Hemostatic Risk Factors in Predicting Arterial Thrombotic Events
Arterioscler. Thromb. Vasc. Biol., October 1, 2005; 25(10): 2043 - 2053.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
E. T.H. Yeh
A New Perspective on the Biology of C-Reactive Protein
Circ. Res., September 30, 2005; 97(7): 609 - 611.
[Full Text] [PDF]


Home page
J Am Coll CardiolHome page
P. Calabro, D. W. Chang, J. T. Willerson, and E. T.H. Yeh
Release of C-Reactive Protein in Response to Inflammatory Cytokines by Human Adipocytes: Linking Obesity to Vascular Inflammation
J. Am. Coll. Cardiol., September 20, 2005; 46(6): 1112 - 1113.
[Full Text] [PDF]


Home page
JAOA: Journal of the American Osteopathic AssociationHome page
M. B. Clearfield
C-Reactive Protein: A New Risk Assessment Tool for Cardiovascular Disease
J Am Osteopath Assoc, September 1, 2005; 105(9): 409 - 416.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Devaraj, G. O'Keefe, and I. Jialal
Defining the Proinflammatory Phenotype Using High Sensitive C-Reactive Protein Levels as the Biomarker
J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4549 - 4554.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
M. Satoh, M. Nakamura, T. Akatsu, Y. Shimoda, I. Segawa, and K. Hiramori
C-reactive protein co-expresses with tumor necrosis factor-{alpha} in the myocardium in human dilated cardiomyopathy
Eur J Heart Fail, August 1, 2005; 7(5): 748 - 754.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
T. Inoue, T. Kato, T. Uchida, M. Sakuma, A. Nakajima, M. Shibazaki, Y. Imoto, M. Saito, S. Hashimoto, Y. Hikichi, et al.
Local Release of C-Reactive Protein From Vulnerable Plaque or Coronary Arterial Wall Injured by Stenting
J. Am. Coll. Cardiol., July 19, 2005; 46(2): 239 - 245.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. A. Nath, J. P. Grande, A. J. Croatt, E. Frank, N. M. Caplice, R. P. Hebbel, and Z. S. Katusic
Transgenic Sickle Mice Are Markedly Sensitive to Renal Ischemia-Reperfusion Injury
Am. J. Pathol., April 1, 2005; 166(4): 963 - 972.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. K. Venugopal, S. Devaraj, and I. Jialal
Macrophage Conditioned Medium Induces the Expression of C-Reactive Protein in Human Aortic Endothelial Cells: Potential for Paracrine/Autocrine Effects
Am. J. Pathol., April 1, 2005; 166(4): 1265 - 1271.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. Takeda, E. Suzuki, H. Satonaka, S. Oba, H. Nishimatsu, M. Omata, T. Fujita, R. Nagai, and Y. Hirata
Blockade of Endogenous Cytokines Mitigates Neointimal Formation in Obese Zucker Rats
Circulation, March 22, 2005; 111(11): 1398 - 1406.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
W. Maier, L. A. Altwegg, R. Corti, S. Gay, M. Hersberger, F. E. Maly, G. Sutsch, M. Roffi, M. Neidhart, F. R. Eberli, et al.
Inflammatory Markers at the Site of Ruptured Plaque in Acute Myocardial Infarction: Locally Increased Interleukin-6 and Serum Amyloid A but Decreased C-Reactive Protein
Circulation, March 22, 2005; 111(11): 1355 - 1361.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
Y. Ivashchenko, F. Kramer, S. Schafer, A. Bucher, K. Veit, V. Hombach, A. Busch, O. Ritzeler, J. Dedio, and J. Torzewski
Protein Kinase C Pathway Is Involved in Transcriptional Regulation of C-Reactive Protein Synthesis in Human Hepatocytes
Arterioscler. Thromb. Vasc. Biol., January 1, 2005; 25(1): 186 - 192.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Khreiss, L. Jozsef, L. A. Potempa, and J. G. Filep
Opposing Effects of C-Reactive Protein Isoforms on Shear-Induced Neutrophil-Platelet Adhesion and Neutrophil Aggregation in Whole Blood
Circulation, October 26, 2004; 110(17): 2713 - 2720.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. H. Schindler, E. U. Nitzsche, M. Olschewski, N. Magosaki, M. Mix, J. O. Prior, A. D. Facta, U. Solzbach, H. Just, and H. R. Schelbert
Chronic Inflammation and Impaired Coronary Vasoreactivity in Patients With Coronary Risk Factors
Circulation, August 31, 2004; 110(9): 1069 - 1075.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. Bogaty, J. M. Brophy, M. Noel, L. Boyer, S. Simard, F. Bertrand, and G. R. Dagenais
Impact of Prolonged Cyclooxygenase-2 Inhibition on Inflammatory Markers and Endothelial Function in Patients With Ischemic Heart Disease and Raised C-Reactive Protein: A Randomized Placebo-Controlled Study
Circulation, August 24, 2004; 110(8): 934 - 939.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
F. Blaschke, D. Bruemmer, F. Yin, Y. Takata, W. Wang, M. C. Fishbein, T. Okura, J. Higaki, K. Graf, E. Fleck, et al.
C-Reactive Protein Induces Apoptosis in Human Coronary Vascular Smooth Muscle Cells
Circulation, August 3, 2004; 110(5): 579 - 587.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
I. Jialal, S. Devaraj, and S. K. Venugopal
C-Reactive Protein: Risk Marker or Mediator in Atherothrombosis?
Hypertension, July 1, 2004; 44(1): 6 - 11.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. M Ridker, N. J. Brown, D. E. Vaughan, D. G. Harrison, and J. L. Mehta
Established and Emerging Plasma Biomarkers in the Prediction of First Atherothrombotic Events
Circulation, June 29, 2004; 109(25_suppl_1): IV-6 - IV-19.
[Full Text] [PDF]


Home page
CirculationHome page
P. M Ridker and N. Cook
Clinical Usefulness of Very High and Very Low Levels of C-Reactive Protein Across the Full Range of Framingham Risk Scores
Circulation, April 27, 2004; 109(16): 1955 - 1959.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
108/16/1930    most recent
01.CIR.0000096055.62724.C5v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Calabró, P.
Right arrow Articles by Yeh, E. T.H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Calabró, P.
Right arrow Articles by Yeh, E. T.H.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Related Collections
Right arrow Pathophysiology
Right arrow Risk Factors
Right arrow Smooth muscle proliferation and differentiation
Right arrow Mechanism of atherosclerosis/growth factors