This Article Abstract Full Text (PDF) All Versions of this Article: 107/6/798    most recent 01.CIR.0000057545.82749.FFv1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Podewski, E. K. Articles by Drexler, H. Search for Related Content PubMed PubMed Citation Articles by Podewski, E. K. Articles by Drexler, H. Pubmed/NCBI databases Substance via MeSH Medline Plus Health Information Cardiomyopathy Related Collections Congestive

(Circulation. 2003;107:798.)
© 2003 American Heart Association, Inc.

Brief Rapid Communications

Alterations in Janus Kinase (JAK)-Signal Transducers and Activators of Transcription (STAT) Signaling in Patients With End-Stage Dilated Cardiomyopathy

Edith K. Podewski, MD; Denise Hilfiker-Kleiner, PhD; Andres Hilfiker, PhD; Henning Morawietz, PhD; Artur Lichtenberg, MD; Kai C. Wollert, MD; Helmut Drexler, MD

From the Departments of Cardiology and Angiology (E.K.P., D.H.K., A.H., K.C.W., H.D.), and Cardiovascular Surgery (A.L.), Hannover Medical School, Hannover, Germany, and the Institute of Pathophysiology (H.M.), University of Halle-Wittenberg, Germany.

Correspondence to Helmut Drexler, MD, Abt. Kardiologie und Angiologie, Medizinische Hochschule Hannover, Carl-Neuberg Str. 1, 30625 Hannover, Germany. E-mail drexler.helmut{at}mh-hannover.de

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background— Experimental studies indicate that interleukin-6 (IL-6)–related cytokines, signaling via the shared receptor gp130, Janus kinases (JAKs), and signal transducers and activators of transcription (STATs), provide a critical cardiomyocyte survival pathway in vivo. Little is known about the activation of this signaling pathway in the myocardia of patients with end-stage dilated cardiomyopathy (DCM).

Methods and Results— We performed a comprehensive expression and activation analysis of IL-6–related cytokines, receptors, signal transducers, and signal transduction inhibitors in left ventricular (LV) myocardia from patients with DCM (n=10) and non-failing (NF) donor hearts (n=5). Differential expression (DCM versus NF) was observed by immunoblotting at each level of the signaling cascade, including receptor ligands (IL-6: -59%, P<0.01; leukemia inhibitory factor [LIF]: +54%, P<0.05), receptor subunits (LIF receptor: -16%, P<0.05), signaling molecules (the Janus kinase TYK2: -48%, P<0.01; STAT3: -47%, P<0.01), and suppressors of cytokine signaling (SOCS1: +97%, P<0.05; SOCS3: -49%, P<0.01). Tyrosine-phosphorylation status of gp130 was increased (+60%, P<0.05), whereas tyrosine-phosphorylation status of JAK2 was reduced in DCM (-72%, P<0.01). Moreover, as shown by immunohistochemistry, the number of STAT3-positive cardiomyocytes was reduced in DCM (-42%, P<0.01).

Conclusion— Signaling via gp130 and JAK-STAT is profoundly altered in DCM. Importantly, tyrosine-phosphorylation of JAK2 is reduced in the face of increased gp130 phosphorylation, indicating impaired downstream activation of this critical pathway in DCM.

Key Words: cardiomyopathy • interleukins • signal transduction

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Dilated cardiomyopathy (DCM) represents a common end-stage disease state of the myocardium in response to different environmental and genetic factors, a fact that has led to the proposition of shared signaling pathways for cardiac dilation and failure.¹ In this regard, a growing body of evidence indicates that interleukin-6 (IL-6)–related cytokines signaling via the shared receptor gp130 provide a critical myocyte survival pathway in vivo. Most notably, gene-targeted mice with a cardiomyocyte-restricted deletion of gp130 develop massive cardiomyocyte apoptosis and dilated cardiomyopathy when subjected to biomechanical stress.²

A prevailing concept predicts that an intricate balance between cardiomyocyte hypertrophy and apoptosis determines heart failure progression.¹ In this regard, the Janus kinases-signal transducers and activators of transcription (JAK-STAT) signaling pathway has been shown to mediate hypertrophic and cytoprotective effects of gp130 activation in cardiomyocytes.^2–8 IL-6–related cytokines potently activate gp130, which in turn promotes tyrosine-phosphorylation (ie, activation) of JAKs and cytoplasmic latent transcription factors of the STAT family.⁹ Signaling via gp130 and JAK-STAT is controlled in a negative-feedback fashion by a family of proteins referred to as suppressors of cytokine signaling, including SOCS1 and SOCS3.^10,11

Despite increasing evidence implicating IL-6–related cytokines, gp130, and JAK-STAT as a critical myocyte survival pathway, little is known regarding expression and activation of this pathway in patients with DCM. In the present study, we have conducted a comprehensive expression and activation analysis of the gp130-JAK-STAT signaling cascade in left ventricular (LV) myocardia from patients with DCM.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Patient Population
LV myocardium was obtained from patients undergoing heart transplantation because of end-stage DCM (n=10; mean age: 44±13 years; New York Heart Association functional classes III and IV; LV ejection fraction: 16±7%; LV end-diastolic diameter: 65±14 mm). Seven patients had been treated with angiotensin-converting enzyme (ACE) inhibitors, 6 patients with diuretics, 7 patients with digoxin, and 5 patients with ß-blockers. For comparison, we studied LV tissue samples from non-failing (NF) donor hearts that could not be transplanted for technical reasons (n=5; mean age: 42±1 years). The non-failing state of these hearts was confirmed by low LV mRNA expression levels of B-type natriuretic peptide (BNP) as assessed by Northern-blot (0.07±0.02 densitometric units in NF versus 0.44±0.05 in DCM).

Immunoblotting
Total protein extracts were subjected to 10% SDS-PAGE, transferred to PDF-membranes, and incubated with primary antibodies according to standard immunoblotting procedures. Antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif) (IL-6, leukemia inhibitory factor [LIF], LIF receptor [LIFR], JAK2, TYK2, SOCS1, SOCS3), R&D Systems (Minneapolis, Minn, cardiotrophin-1 [CT-1], gp130, IL-6R), Affinity Bioreagents (Golden, Colo, JAK1, phospho-JAK1, phospho-JAK2), and Cell-Signaling Technology (Beverly, Mass, STAT1, STAT3, phospho-TYK2, phospho-STAT1, phospho-STAT3). Equal loading was confirmed by Ponceau-S staining, and protein levels were normalized to total actin content. Tyrosine-phosphorylation of gp130 and STAT3 was evaluated by immunoprecipitation⁷ using an anti-phosphotyrosine antibody (Cell Signaling Technology) and protein A-agarose (Roche, Basel, Switzerland), followed by anti-gp130 and anti-STAT3 immunoblotting. Specific bands were visualized by enhanced chemiluminescence (Bio-Rad, Hercules, Calif). Images were scanned using the Gel Doc 2000 documentation system and quantified with Quantity One software (Bio-Rad).

Immunohistochemistry
Immunohistochemistry was performed on serial sections from NF and DCM hearts using antibodies from New England Biolabs (Beverly, Mass, JAK2), Cell Signaling Technology (STAT3), Biomeda (Foster City, Calif, skeletal muscle -actin), and Alexis (San Diego, Calif, myosin) and the Vectastain ABC elite kit from Vector Laboratories (Burlingame, Calif).

Semi-Quantitative Reverse Transcription Polymerase Chain Reaction
IL-6, LIF, and CT-1 mRNA expression levels were determined by reverse transcription polymerase chain reaction under linear amplification conditions. All RNA samples were tested for equal G3PDH content. The following primer pairs were used: CCATCCAGTTGCCTTCTTG/AGTGCATCATCGTTGTTCATAC (IL-6), CTGTTGGTTCTGCACTGGA/GGGTTGAGGATCTTCTGGT (LIF), TCAGACACACAGCCTTGCGC/GCTCAGCCACTCGCGGTAGA (CT-1), and ACCACAGTCCATGCCATCCAC/TCCACCACCCTGTTGCTGTA (G3PDH).

Statistical Analysis
Data are presented as mean±SD. Differences between DCM and NF were analyzed by ANOVA. A 2-tailed probability value <0.05 was considered statistically significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
IL-6 protein expression was downregulated (-59%, P<0.01), whereas LIF protein expression was increased in DCM (+54%, P<0.05) (Figure 1A). Similar changes were observed at the mRNA level; however these differences did not reach statistical significance (not shown). LIFR protein levels were decreased (-16%, P<0.05) in DCM (Figure 1A). CT-1 and IL-6R protein levels were unchanged in DCM (not shown).

View larger version (49K): [in this window] [in a new window]   Figure 1. Expression levels of IL-6, LIF, and LIFR were measured by immunoblotting; representative blots and bar graphs are shown in A. Likewise, expression levels of gp130, JAKs, STATs, phospho-JAKs, and phospho-STATs were determined by immunoblotting, whereas phospho-gp130 levels were assessed by immunoprecipitation; representative blots are shown in B. In each case, the expression ratio of tyrosine-phosphorylated protein/total protein was calculated (bar graphs in B). Protein levels of SOCS1 and SOCS3 were determined by immunoblotting; representative blots and bar graphs are shown in C. *P<0.05, **P<0.01 versus NF (NF, n=5; DCM, n=10).

Protein levels of TYK2 (-48%, P<0.01) and STAT3 (-47%, P<0.01) were decreased, although protein levels of gp130, JAK1, JAK2, and STAT1 were unchanged in DCM. Expression levels of phospho-JAK2 (-72%, P<0.01), phospho-TYK2 (-39%, P<0.01), and phospho-STAT3 (-57%, P<0.01) were decreased, whereas expression levels of phospho-JAK1 and phospho-STAT1 were unchanged in DCM (representative blots are shown in Figure 1B). Immunoprecipitation with anti-phosphotyrosine antibodies followed by gp130 immunoblotting demonstrated that expression levels of phospho-gp130 were increased in DCM (+60%, P<0.05, Figure 1B); on the same blots, phospho-STAT3 levels were decreased (-63%, P<0.05; not shown), confirming our data obtained with anti-phospho-STAT3 antibodies. The expression ratio of tyrosine-phosphorylated protein/total protein was calculated in each case, revealing a reduced phosphorylation status of JAK2 (-66%, P<0.01) and enhanced phosphorylation status of gp130 (+60%, P<0.05) in DCM (bar graphs in Figure 1B). By contrast, the phosphorylation status of JAK1, TYK2, STAT1, and STAT3 was not significantly altered in DCM versus NF (Figure 1B).

Protein expression levels of SOCS1 were elevated (97%, P<0.05), whereas expression levels of SOCS3 were decreased (-49%, P<0.01) in DCM (Figure 1C).

As shown by immunohistochemistry, JAK2 was predominantly expressed in a perinuclear fashion, whereas STAT3 was detectable in the cytoplasm and nuclei of cardiomyocytes from NF and DCM hearts (Figure 2A). Importantly, the number of cardiomyocytes expressing STAT3 was significantly decreased in DCM (-42%, P<0.01) (Figure 2A).

View larger version (67K): [in this window] [in a new window]   Figure 2. Myocardial distributions of JAK2 and STAT3 were analyzed by immunohistochemistry (A). Serial sections were stained for skeletal muscle -actin or myosin to identify cardiac myocytes; a control slide was stained with non-specific immunoglobulin G. Myosin-positive cardiomyocytes (>100 cells per heart) were scored for STAT3 expression; results are summarized in the bar graph in A. **P<0.01 versus NF (NF, n=4; DCM, n=4). B, A schematic representation of gp130-JAK-STAT signaling alterations in DCM.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
Our study demonstrates that signaling via the gp130-JAK-STAT pathway is profoundly altered in the myocardia of patients with DCM, at the levels of both expression and phosphorylation (ie, activation). Differential expression was observed at each step of the signaling cascade, including receptor ligands (IL-6 downregulation, LIF upregulation), receptor subunits (LIFR downregulation), signaling molecules (TYK2 and STAT3 downregulation), and suppressors of cytokine signaling (SOCS1 upregulation, SOCS3 downregulation). Intriguingly, expression levels of tyrosine-phosphorylated JAK2, TYK2, and STAT3 were substantially reduced, whereas the expression level of tyrosine-phosphorylated gp130 was enhanced in DCM (Figure 2B).

Plasma levels of IL-6 and CT-1 are increased in patients with heart failure; however, little is known regarding the cellular source(s) of these cytokines (reviewed in ¹²). IL-6 is elaborated, at least in part, in the peripheral vascular bed in heart failure patients.¹³ As demonstrated here, myocardial IL-6 expression decreases, whereas myocardial CT-1 expression is unchanged in DCM, suggesting that circulating and tissue levels of IL-6 and CT-1 are controlled by distinct mechanisms.

Regulatory circuits controlling phospho-JAK and phospho-STAT abundance are highly complex.¹⁴ Our data indicate that decreases in protein levels are primarily responsible for reduced phospho-TYK2 and phospho-STAT3 levels in the failing heart. By contrast, differences in phosphorylation status per se account for the decreased phospho-JAK2 and increased phospho-gp130 abundance observed in patients with DCM. Angiotensin II activates the JAK-STAT pathway in cardiomyocytes,¹⁵ raising the possibility that decreases in JAK-STAT phosphorylation may be due to ACE-inhibitor treatment of patients with DCM. However, JAK2, TYK2, and STAT3 phosphorylation levels were not different in patients treated with (n=7) or without (n=3) ACE-inhibitors, making such a possibility unlikely (not shown).

JAK2 and STAT3 were readily detectable by immunohistochemistry in cardiomyocytes from NF and DCM hearts. The expression pattern of JAK2 was similar in failing and non-failing hearts, supporting our immunoblotting data, which demonstrated no differences in JAK2 protein expression levels. By contrast, STAT3 protein abundance was significantly reduced in cardiomyocytes from failing hearts. This finding would support the concept that the decrease in STAT3 levels in patients with DCM reflects downregulation, mainly in the cardiomyocyte compartment. Moderate staining was also present in non-myocytes, however, suggesting that part of the alterations in gp130-JAK-STAT signaling may reflect changes in the non-myocyte compartment.

Recently Zolk et al¹⁶ reported increased CT-1 and diminished gp130 protein levels in the face of increased gp130 mRNA levels in a heterogeneous group of patients with ischemic and dilated cardiomyopathy. We focused on patients with DCM, and, importantly, excluded NF hearts with significant BNP mRNA levels.

Experimental studies have provided ample evidence that the JAK-STAT pathway protects cardiomyocytes from apoptosis,^2–5 induces hypertrophy^6–8 and promotes expression of cardioprotective genes, including superoxide dismutase and vascular endothelial growth factor.^5,17 Therefore, reduced JAK-STAT activation may play an important pathophysiological role in patients with end-stage DCM and may represent a target for therapeutic intervention.

	Acknowledgments

 
This study was supported by a grant from the Jean Leducq Foundation.

Received November 7, 2002; revision received December 20, 2002; accepted January 3, 2003.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Hunter JJ, Chien KR. Signaling pathways for cardiac hypertrophy and failure. N Engl J Med. 1999; 341: 1276–1283.[Free Full Text]
   
2. Hirota H, Chen J, Betz UA, et al. Loss of a gp130 cardiac muscle cell survival pathway is a critical event in the onset of heart failure during biomechanical stress. Cell. 1999; 97: 189–198.[CrossRef][Medline] [Order article via Infotrieve]
   
3. Sheng Z, Knowlton K, Chen J, et al. Cardiotrophin-1 inhibition of cardiac myocyte apoptosis via a mitogen-activated protein kinase-dependent pathway. J Biol Chem. 1997; 272: 5783–5791.[Abstract/Free Full Text]
   
4. Kunisada K, Negoro S, Tone E, et al. Signal transducer and activator of transcription 3 in the heart transduces not only a hypertrophic signal but a protective signal against doxorubicin-induced cardiomyopathy. Proc Natl Acad Sci U S A. 2000; 97: 315–319.[Abstract/Free Full Text]
   
5. Negoro S, Kunisada K, Fujio Y, et al. Activation of signal transducer and activator of transcription 3 protects cardiomyocytes from hypoxia/reoxygenation-induced oxidative stress through the upregulation of manganese superoxide dismutase. Circulation. 2001; 104: 979–981.[Abstract/Free Full Text]
   
6. Hirota H, Yoshida K, Kishimoto T, et al. Continuous activation of gp130, a signal-transducing receptor component for interleukin 6-related cytokines, causes myocardial hypertrophy in mice. Proc Natl Acad Sci U S A. 1995; 92: 4862–4866.[Abstract/Free Full Text]
   
7. Wollert KC, Taga T, Saito M, et al. Cardiotrophin-1 activates a distinct form of cardiac muscle cell hypertrophy. J Biol Chem. 1996; 271: 9535–9545.[Abstract/Free Full Text]
   
8. Kunisada K, Tone E, Fujio Y, et al. Activation of gp130 transduces hypertrophic signals via STAT3 in cardiac myocytes. Circulation. 1998; 98: 346–352.[Abstract/Free Full Text]
   
9. Heinrich PC, Behrmann I, Muller-Newen G, et al. Interleukin-6-type cytokine signaling through the gp130/Jak/STAT pathway. Biochem J. 1998; 334: 297–314.[Medline] [Order article via Infotrieve]
   
10. Hamanaka I, Saito Y, Yasukawa H, et al. Induction of JAB/SOCS-1/SSI-1 and CIS3/SOCS-3/SSI-3 is involved in gp130 resistance in cardiovascular system in rat treated with cardiotrophin-1 in vivo. Circ Res. 2001; 88: 727–732.[Abstract/Free Full Text]
    
11. Yasukawa H, Hoshijima M, Gu Y, et al. Suppressor of cytokine signaling-3 is a biomechanical stress-inducible gene that suppresses gp130-mediated cardiac myocyte hypertrophy and survival pathways. J Clin Invest. 2001; 108: 1459–1467.[CrossRef][Medline] [Order article via Infotrieve]
    
12. Wollert KC, Drexler H. The role of interleukin-6 in the failing heart. Heart Fail Rev. 2001; 6: 95–103.[CrossRef][Medline] [Order article via Infotrieve]
    
13. Tsutamoto T, Hisanaga T, Wada A, et al. Interleukin-6 spillover in the peripheral circulation increases with the severity of heart failure, and the high plasma level of interleukin-6 is an important prognostic predictor in patients with congestive heart failure. J Am Coll Cardiol. 1998; 31: 391–398.[Abstract/Free Full Text]
    
14. Yasukawa H, Sasaki A, Yoshimura A. Negative regulation of cytokine signaling pathways. Annu Rev Immunol. 2000; 18: 143–164.[CrossRef][Medline] [Order article via Infotrieve]
    
15. Kodama H, Fukuda K, Pan J, et al. Biphasic activation of the JAK/STAT pathway by angiotensin II in rat cardiomyocytes. Circ Res. 1998; 82: 244–250.[Abstract/Free Full Text]
    
16. Zolk O, Ng LL, O’Brien RJ, et al. Augmented expression of cardiotrophin-1 in failing human hearts is accompanied by diminished glycoprotein 130 receptor protein abundance. Circulation. 2002; 106: 1442–1446.[Abstract/Free Full Text]
    
17. Funamoto M, Fujio Y, Kunisada K, et al. Signal transducer and activator of transcription 3 is required for glycoprotein 130-mediated induction of vascular endothelial growth factor in cardiac myocytes. J Biol Chem. 2000; 275: 10561–10566.[Abstract/Free Full Text]
    

This article has been cited by other articles:

				T. Tsoutsman, M. Kelly, D. C.H. Ng, J.-E. Tan, E. Tu, L. Lam, M. A. Bogoyevitch, C. E. Seidman, J.G. Seidman, and C. Semsarian Severe Heart Failure and Early Mortality in a Double-Mutation Mouse Model of Familial Hypertrophic Cardiomyopathy Circulation, April 8, 2008; 117(14): 1820 - 1831. [Abstract] [Full Text] [PDF]

				T. Higuchi, K. Yamauchi-Takihara, G. Matsumiya, N. Fukushima, H. Ichikawa, T. Kuratani, Y. Maehata, and Y. Sawa Granulocyte Colony-Stimulating Factor Prevents Reperfusion Injury After Heart Preservation Ann. Thorac. Surg., April 1, 2008; 85(4): 1367 - 1373. [Abstract] [Full Text] [PDF]

				D. Hilfiker-Kleiner, U. Landmesser, and H. Drexler Molecular Mechanisms in Heart Failure: Focus on Cardiac Hypertrophy, Inflammation, Angiogenesis, and Apoptosis J. Am. Coll. Cardiol., October 27, 2006; 48(9_Suppl_A): A56 - A66. [Abstract] [Full Text] [PDF]

				X. Zhang, P. Shan, G. Jiang, S. S-M. Zhang, L. E. Otterbein, X.-Y. Fu, and P. J. Lee Endothelial STAT3 is essential for the protective effects of HO-1 in oxidant-induced lung injury FASEB J, October 1, 2006; 20(12): 2156 - 2158. [Abstract] [Full Text] [PDF]

				K. L. Butler, L. C. Huffman, S. E. Koch, H. S. Hahn, and J. K. Gwathmey STAT-3 activation is necessary for ischemic preconditioning in hypertrophied myocardium Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H797 - H803. [Abstract] [Full Text] [PDF]

				T. Mohri, Y. Fujio, M. Maeda, T. Ito, T. Iwakura, Y. Oshima, Y. Uozumi, M. Segawa, H. Yamamoto, T. Kishimoto, et al. Leukemia Inhibitory Factor Induces Endothelial Differentiation in Cardiac Stem Cells J. Biol. Chem., March 10, 2006; 281(10): 6442 - 6447. [Abstract] [Full Text] [PDF]

				G. Colombo, S. Gatti, F. Turcatti, A. Sordi, L. R. Fassati, F. Bonino, J. M. Lipton, and A. Catania Gene Expression Profiling Reveals Multiple Protective Influences of the Peptide {alpha}-Melanocyte-Stimulating Hormone in Experimental Heart Transplantation J. Immunol., September 1, 2005; 175(5): 3391 - 3401. [Abstract] [Full Text] [PDF]

				C. A. Ahern, J.-F. Zhang, M. J. Wookalis, and R. Horn Modulation of the Cardiac Sodium Channel NaV1.5 by Fyn, a Src Family Tyrosine Kinase Circ. Res., May 13, 2005; 96(9): 991 - 998. [Abstract] [Full Text] [PDF]

				D. Hilfiker-Kleiner, A. Hilfiker, M. Fuchs, K. Kaminski, A. Schaefer, B. Schieffer, A. Hillmer, A. Schmiedl, Z. Ding, E. Podewski, et al. Signal Transducer and Activator of Transcription 3 Is Required for Myocardial Capillary Growth, Control of Interstitial Matrix Deposition, and Heart Protection From Ischemic Injury Circ. Res., July 23, 2004; 95(2): 187 - 195. [Abstract] [Full Text] [PDF]

				G. A.M. Plenz, H. Eschert, M. C. Deng, K. C. Wollert, E. K. Podewski, D. Hilfiker-Kleiner, A. Hilfiker, H. Drexler, A. Lichtenberg, and H. Morawietz What Are Appropriate Controls for Cardiac Interleukin-6 Expression in Heart Failure? * Response Circulation, October 28, 2003; 108 (17): e129 - e130. [Full Text] [PDF]

				N. M. Nathanson An Array of Details on G-Protein Coupled Receptor Signaling: Differential Effects of alpha 1-Adrenergic Receptor Subtypes on Gene Expression and Cytokine Receptor Signaling Mol. Pharmacol., May 1, 2003; 63(5): 959 - 960. [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 107/6/798    most recent 01.CIR.0000057545.82749.FFv1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Podewski, E. K. Articles by Drexler, H. Search for Related Content PubMed PubMed Citation Articles by Podewski, E. K. Articles by Drexler, H. Pubmed/NCBI databases Substance via MeSH Medline Plus Health Information Cardiomyopathy Related Collections Congestive