Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2003;107:2348-2354
Published online before print April 21, 2003, doi: 10.1161/01.CIR.0000066697.19571.AF
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
107/18/2348    most recent
01.CIR.0000066697.19571.AFv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, H.
Right arrow Articles by Förstermann, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, H.
Right arrow Articles by Förstermann, U.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*HISTAMINE
*NITRIC OXIDE
Related Collections
Right arrow Gene regulation
Right arrow Endothelium/vascular type/nitric oxide

(Circulation. 2003;107:2348.)
© 2003 American Heart Association, Inc.


Basic Science Reports

Histamine Upregulates Gene Expression of Endothelial Nitric Oxide Synthase in Human Vascular Endothelial Cells

Huige Li, MD, PhD; Christian Burkhardt; Ulf-Rüdiger Heinrich, PhD; Isolde Brausch; Ning Xia, MD; Ulrich Förstermann, MD, PhD

From the Departments of Pharmacology (H.L., C.B., I.B., U.F.) and Otorhinolaryngology (U.-R.H.), Johannes Gutenberg University, Mainz, Germany; the Department of Cardiology (N.X.), University of Heidelberg, Heidelberg, Germany; and the Department of Pathophysiology (H.L.), Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China.

Correspondence to Ulrich Förstermann, MD, PhD, Department of Pharmacology, Johannes Gutenberg University, Obere Zahlbacher Strasse 67, D-55131 Mainz, Germany. E-mail Ulrich.Forstermann{at}Uni-Mainz.de


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— Histamine has a short-term, transient, stimulating effect on endothelial nitric oxide synthase (eNOS) activity; however, long-term effects on eNOS have not been described yet. In addition, the vascular effect of histamine seems to depend critically on eNOS functionality. Therefore, we studied the effects of histamine on eNOS gene expression and function.

Methods and Results— In human umbilical vein endothelial cells (HUVECs) and HUVEC-derived EA.hy 926 cells, histamine upregulated eNOS mRNA (RNase protection assay) and protein (electron microscopic immunocytochemistry) expression. The upregulation of eNOS could be prevented by mepyramine, a selective antagonist at the H1 receptor, but not by H2 and H3 receptor antagonists. Incubation of EA.hy 926 cells with histamine led to the activation of calcium/calmodulin-dependent protein kinase II (CaMK II; in vitro phosphorylation assay). The histamine-induced eNOS expression was completely prevented by KN-93, an inhibitor of CaMK II. Histamine increased the activity of a 1.6-kb human eNOS promoter fragment (luciferase reporter gene assay), an effect that was also blocked by mepyramine. Under normal conditions, eNOS upregulation by histamine resulted in increased nitric oxide production (measured by nitric oxide chemiluminescence and RFL-6 reporter cell assay). Under conditions of oxidative stress, however, the eNOS upregulated by histamine produced reactive oxygen species (CM-H2DCFDA oxidation-based fluorescence assay).

Conclusions— Stimulation of the H1 receptor increases eNOS transcription in endothelial cells by a signaling pathway involving CaMK II. This eNOS upregulation may be protective under normal conditions, but it may become harmful under conditions of oxidative stress when eNOS produces reactive oxygen species at the expense of nitric oxide.


Key Words: endothelium-derived factors • signal transduction • oxidative stress • atherosclerosis • coronary disease


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Histamine is an established endothelium-dependent vasodilator. There are numerous sources of histamine in the vasculature. In addition to histamine from circulating blood and vascular endothelial cells, histamine can be released locally from subendothelial mast cells1–3 and adventitial mast cells4,5 in coronary arteries. Moreover, histamine can also derive from activated platelets,6 T lymphocytes, and monocytes/macrophages.7 By occupying H1 receptors on endothelial cells, histamine activates endothelial nitric oxide synthase (eNOS).8 The nitric oxide (NO) produced by eNOS dilates all kinds of blood vessels, including human coronary arteries,9 and has protective effects against platelet and leukocyte adhesion and smooth muscle proliferation and, thus, probably atherosclerosis.10 However, the direct activation of eNOS by histamine represents a short-term and probably transient action of the amine. Therefore, the present study was designed to investigate the potential long-term effects of histamine on eNOS gene expression and the ensuing changes in enzyme activity. The results show that under normal, healthy conditions, histamine can upregulate eNOS gene expression, resulting in increased NO production. This would suggest an indirect vasoprotective role for histamine.

However, there is evidence for pro-atherogenic effects of histamine. For example, histamine enhances the expression of adhesion molecules in vascular endothelial cells, thereby augmenting leukocyte-endothelial cell interactions,11–13 an important onset event in atherogenesis. Histamine has also been shown to increase smooth muscle cell proliferation and migration,6 and it has been implicated in intimal thickening and atherogenesis.14,15 In animal models, antihistamines provided protection against intimal thickening and the development of atherosclerosis.14

In conditions of oxidative stress and atherosclerosis, eNOS can "uncouple" and become dysfunctional. A relative lack of (6R)-5,6,7,8-tetrahydro-L-biopterin due to oxidation seems to play a crucial pathophysiological role for eNOS dysfunction.16 The dysfunctional eNOS generates superoxide from its oxygenase domain instead of NO by dissociation of the ferrous-dioxygen complex.16 Therefore, in the present study, we also tested the functional consequences of a histamine-induced upregulation of eNOS under conditions of exogenous oxidative stress.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture
Human umbilical vein endothelial cells (HUVECs, isolated by collagenase digestion) and HUVEC-derived EA.hy 926 cells (kindly provided by Dr Cora-Jean Edgell, Chapel Hill, NC) were cultured as previously described.17 HUVECs from passages 3 to 5 were used.

RNase Protection Assay for eNOS mRNA Analyses
Confluent HUVECs and EA.hy 926 cells were incubated with histamine, and total RNA was isolated. The expression of eNOS mRNA was analyzed by an RNase protection assay, as described previously.17

Reverse-Transcriptase Polymerase Chain Reaction for Analysis of Histamine Receptor Expression
Reverse transcriptase polymerase chain reaction (RT-PCR) was performed using total RNA from HUVECs, EA.hy 926 cells, and human heart, brain, and ileum tissues as templates. Primers were designed to distinguish human H1, H2, and H3 subtypes. The primers were TCTCTCTTTTCTGT- GGGTTATTCC (sense) and CAGCTTAATTTCTGAGAAGGAAGG- (antisense) for H1, ATACCACCTCTAAGTGCAAAGTCC (sense) and GATGGCTTCTAACACCTCATTGAT (antisense) for H2, and CTGA-CT-ACTGGTACGAAACCTCCT (sense) and CTCCTCAGCAATTTTGTCTCTCTT (antisense) for H3. The sizes of the 3 RT-PCR products were 259 bp, 311 bp, and 244 bp, respectively.

Electron Microscopic Immunocytochemistry
After treatment with histamine, EA.hy 926 cells were collected by trypsin digestion. The cells were then concentrated by centrifugation, fixed, and embedded in London Resin White. Ultrathin sections were prepared, and post-embedding immunolabeling was performed using a rabbit polyclonal anti-eNOS antibody (BD Biosciences Pharmingen, San Diego, Calif) and a gold-labeled anti-rabbit secondary antibody (10-nm particles, Sigma, St Louis, Mo). The ultrathin sections were then analyzed with an energy-filtering transmission electron microscope, as previously described.18 The density of gold particles was determined in 20 sections and in 20 frames of 1 µm2 in each section.

Transient Transfection and Reporter Gene Assay for the Analysis of eNOS Promoter Activity
Promoter activity was analyzed by reporter gene assay using the plasmid pGl3-eNOS-Hu-1600 transiently transfected into EA.hy 926 cells. The plasmid contains a 1.6-kb human eNOS promoter fragment (-1600 to 23) cloned before the luciferase gene of pGl3-Basic, as described elsewhere.17

Assay of Ca2+/Calmodulin-Dependent Kinase II Activity
Ca2+/calmodulin-dependent kinase II (CaMK II) activity was assayed using the SignaTect system (Promega). Briefly, 2.5 µg of total protein samples from EA.hy 926 cells were incubated at 30°C for 2 minutes in the presence of [{gamma}-32P]ATP with a biotinylated peptide, which is a selective substrate for CaMK II. The reaction was then spotted onto a streptavidin-coated SAM-Biotin-Capture membrane. The membrane was washed, dried, and exposed to x-ray film.

Determination of Total NO Synthesis as Nitrite/Nitrate and Measurement of Bioactive NO
Oxidation products of NO (NOx, ie, NO2- and NO3-) were assayed in the supernatant of EA.hy 926 cells as a measure of total NO synthesis using a NOA 280 NO Analyzer.19 Bioactive NO produced by EA.hy 926 cells was assayed using rat fetal lung fibroblast (RFL-6) as reporter cells.19

Measurement of Intracellular Reactive Oxygen Species
The determination of intracellular oxidative formation was based on the oxidation of 5-(and-6)-chloromethyl-2',7'-dichlorodihydrofluorescein diacetate (CM-H2DCFDA) to yield an intracellular-trapped fluorescent compound. Fluorescence was measured in a FluoroCount Reader (Packard Bioscience).19 After 24 hours of pretreatment with 1 µmol/L histamine, the cells were washed, and intracellular reactive oxygen species (ROS) formation was assayed in the presence of 10 µmol/L A23187, because superoxide/ROS generation from eNOS is a Ca2+-dependent process.20 Other cells were exposed to oxidative stress (after the 24-hour histamine pretreatment) by a 1-hour incubation with xanthine (200 µmol/L)/xanthine oxidase (5 mU/mL), either alone or in combination with 1 mmol/L NG-nitro-l-arginine methyl ester (L-NAME). Then, the cells were washed several times to remove the xanthine/xanthine oxidase, and ROS production was assayed in the presence of 10 µmol/L A23187 for 1 hour.

Statistics
Statistical differences between mean values were determined by ANOVA followed by Fisher’s protected least-significant-difference test for comparison of different means.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Histamine Upregulates eNOS mRNA Expression in Human Endothelial Cells in a Concentration- and Time-Dependent Manner
Treatment of EA.hy 926 human endothelial cells with histamine increased eNOS mRNA expression (Figure 1); eg, incubation with 1 µmol/L histamine for 24 hours increased eNOS expression to 189.5±16.8% of control. Inducible nitric oxide synthase was not expressed in EA.926 cells, nor was it induced by histamine (3 experiments, data not shown). Also in HUVECs, incubation with 1 µmol/L histamine for 24 hours increased eNOS expression to 230.3±29.4% (mean±SEM of 3 experiments, P<0.001 compared with untreated cells).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 1. Histamine enhances eNOS mRNA expression in human endothelial cells in a concentration- and time-dependent manner. Cells were treated with histamine (His), and eNOS mRNA expression was analyzed with RNase protection assay. A shows a representative RNase protection gel using RNA samples from EA.hy 926 cells treated with the indicated concentrations of histamine. M indicates marker; t, tRNA control; N, antisense eNOS probe; and A, antisense ß-actin probe. B and C show the concentration- and time-dependency of histamine-induced eNOS mRNA expression in human EA.hy 926 cells. Symbols represent the mean±SEM of 3 experiments. *P<0.05, **P<0.01, ***P<0.001 compared with untreated cells, ie, control or time zero.

The Histamine-Induced eNOS Upregulation Is Mediated by the H1 Receptor
mRNAs for H1 and H2, but not H3, were found in HUVECs and EA.hy 926 cells by RT-PCR (Figure 2A). To characterize the receptor subtype functionally responsible for the histamine-induced eNOS upregulation, selective antagonists to H1 (mepyramine), H2 (cimetidine), and H3 (clobenpropit) were used. Mepyramine, but not cimetidine or clobenpropit, completely abolished the eNOS induction by histamine (Figure 2B). The selective H1 agonist HTMT {6-[2-(4-imidazolyl)ethylamine]-N-(4-trifuormethylphenyl)-heptanecardoxamide dimaleate} also increased eNOS mRNA in EA.hy 926 cells in a concentration-dependent fashion (3 experiments, data not shown).



View larger version (42K):
[in this window]
[in a new window]
 
Figure 2. Histamine-induced eNOS mRNA expression is mediated via the H1 receptor. A, mRNA expression of histamine receptor subtypes in HUVECs and EA.hy 926 cells using subtype-specific primers (RT-PCR). Human tissues (heart, brain, and ileum) are shown for comparison. B shows the effects of selective antagonists (1 µmol/L each) for the H1 receptor (mepyramine, Mepy), the H2 receptor (cimetidine, Cime), and the H3 receptor (clobenpropit, Clob) on histamine (His; 1 µmol/L for 24 hours)-induced eNOS expression in EA.hy 926 cells (RNase protection assay). Columns represent mean±SEM of 3 experiments. ***P<0.001 compared with untreated cells; ###P<0.001 compared with cells treated with histamine alone.

Histamine Enhances the Activity of the Human eNOS Promoter
A 1.6-kb human eNOS promoter fragment showed significant basal activity when transiently transfected into EA.hy 926 cells (Figure 3). Incubation with histamine (1 µmol/L) increased the promoter activity >2-fold. This promoter activation was completely prevented by mepyramine. Also in HUVECs, incubation with histamine (1 µmol/L) resulted in a marked increase in eNOS promoter activity (263.1±24.0% of control; P<0.001 versus control; 3 experiments).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 3. Histamine enhances eNOS promoter activity in EA.hy 926 cells. The cells were transfected with either the vector pGl3-Basic (containing a promoterless luciferase gene) or pGl3-eNOS-Hu-1600 (containing a 1.6-kb human eNOS promoter fragment cloned before the luciferase reporter gene). After 24 hours of treatment with either histamine alone (His; 1 µmol/L) or in combination with the H1 receptor antagonist mepyramine (Mepy; 1 µmol/L), the cells were analyzed for luciferase activity. Columns represent the mean±SEM of 3 experiments. ***P<0.001 compared with control (Co); ###P<0.001 compared with cells treated with histamine alone.

Histamine-Induced eNOS Upregulation Is Prevented by an Inhibitor of CaMK II, But Not by Inhibitors of Protein Kinase C, Janus Kinase 2 (JAK2), Mitogen-Activated Protein Kinases, or Phosphatidylinositol-3-Kinase
The specific inhibitor of CaMK II, KN-93, completely abolished the eNOS induction by histamine (Figure 4A). The inactive analog of KN-93, KN-92, did not have any effect on eNOS expression, thus confirming the specificity of KN-93 (Figure 4A).



View larger version (42K):
[in this window]
[in a new window]
 
Figure 4. Activation of Ca2+/calmodulin-dependent-kinase II (CaMK II) is required for histamine-induced eNOS expression in human EA.hy 926 endothelial cells. A, the cells were treated for 24 hours with 1 µmol/L histamine (His), alone or in combination with KN-93 (a specific CaMK II inhibitor; 3 µmol/L) or KN-92 (an inactive analog of KN-93; 3 µmol/L), and eNOS mRNA expression was analyzed with an RNase protection assay. Columns represent the mean±SEM of 3 experiments. ***P<0.001 compared with control; ###P<0.001 compared with histamine-treated cells. B, histamine activates CaMK II in EA.hy 926 cells. Cell lysates were incubated with a biotinylated peptide (a selective substrate for CaMK II) in the presence of [{gamma}-32P]ATP. The phosphorylated peptides were captured by a streptavidin membrane and visualized by autoradiography.

It has been reported that H1 stimulation can also activate protein kinase C, tyrosine kinases, mitogen-activated protein kinases, and phosphatidylinositol-3-kinase. The protein kinase C inhibitors Ro-31-8220 (1 µmol/L) and Gö 6983 (1 µmol/L) did not prevent, but slightly increased, histamine-induced eNOS expression (3 experiments each; data not shown). Inhibitors of tyrosine kinases (10 µmol/L AG 490, 10 µmol/L genistein, 10 µmol/L erbstatin A, or 1 µmol/L herbimycin), mitogen-activated protein kinase kinase (10 µmol/L PD 98059), p38 mitogen-activated protein kinase (10 µmol/L SB 203580), and phosphatidylinositol-3-kinase (10 µmol/L LY 294002) had no effect on histamine-induced eNOS expression (3 experiments each; data not shown). A previous study demonstrated that CaMK II is also involved in H2O2-induced eNOS expression, a pathway that also requires the tyrosine kinase JAK2.21 However, the JAK2 inhibitor, AG 490, and other tyrosine kinase inhibitors did not affect histamine-induced eNOS expression, thus indicating that JAK2 is not involved.

Histamine Activates CaMK II in EA.hy 926 Cells
Incubation of EA.hy 926 cells with histamine led to the activation of CaMK II. The CaMK II-specific phosphorylation was increased after histamine treatment (Figure 4B). This activation was maintained between 5 minutes and 3 hours (Figure 4B). Preincubation with KN-93 (3 µmol/L, 1 hour) reduced the basal activity of CaMK II and completely abolished the activating effect of histamine (Figure 4B).

Histamine Upregulates eNOS Protein Expression in EA.hy 926 Cells
In addition, eNOS protein expression was increased in EA.hy 926 cells by histamine, as determined by electron microscopic immunocytochemistry. The histamine-treated cells showed an increased intracellular eNOS staining (Figure 5).



View larger version (61K):
[in this window]
[in a new window]
 
Figure 5. Histamine increases eNOS protein expression. A, electron microscopic immunocytochemistry showing eNOS expression in EA.hy 926 cells (treated with or without 1 µmol/L histamine [His] for 24 hours). Post-embedding immunolabeling was performed using a rabbit polyclonal anti-eNOS antibody and a gold-labeled anti-rabbit secondary antibody. The ultrathin sections were then analyzed with an energy-filtering transmission electron microscope. B shows the quantified density of gold particles in 20 sections. Columns represent mean±SEM. ***P<0.001 vs untreated controls (Co).

Short- and Long-Term Effects of Histamine on NO Production in EA.hy 926 Cells Under Normal Conditions
After 24 hours of treatment of EA.hy 926 cells with 1 µmol/L histamine, the cumulative NO production (determined as NOx in the culture supernatant) increased almost 4-fold (Figure 6A). When histamine was present only during the last hour of the 24-hour incubation, the increase in NOx was only {approx}2-fold. After washout, EA.hy 926 cells were stimulated with 10 µmol/L Ca2+ ionophore A23187 for 1 hour. An increase in NOx was only seen in those cells that had been pretreated with histamine for 24 hours (Figure 6A). These results were confirmed with a different method, the RFL-6 reporter cell assay. This assay demonstrated that EA.hy 926 cells whose eNOS had been upregulated by histamine (24 hours of pretreatment) showed an increased production of bioactive NO on stimulation with the Ca2+ ionophore A23187 (Figure 6B).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 6. Short-term and long-term effects of histamine on endothelial NO production. A, EA.hy 926 cells were left untreated (control, Co) or were treated with 1 µmol/L histamine. Histamine was present either for 24 hours (His 24h) or only during the last hour (His 1 hour, without changing the media). Supernatants were collected at the end of the 24-hour incubation, and NO2-/NO3- (NOx) was measured with an NO Analyzer (upper left). Then, the cells were washed twice, kept in normal media for 2 hours, washed again, and stimulated with 10 µmol/L Ca2+ ionophore A23187 for 1 hour. Supernatants were collected again for NOx measurement (upper right). NOx amount was normalized to protein content of cell lysates. B, EA.hy 926 cells were left untreated or were treated with 1 µmol/L histamine for 24 hours. The cells were then washed, stimulated with 10 µmol/L Ca2+ ionophore A23187 for 2 minutes, and bioactive NO was determined by RFL-6 reporter cell assay. Columns represent mean±SEM of 3 experiments. **P<0.01; ***P<0.001.

Histamine-Induced eNOS Produces ROS Under Conditions of Oxidative Stress
The treatment of EA.hy 926 cells with 1 µmol/L histamine for 24 hours under normal cell culture conditions did not increase ROS generation (Figure 7A). However, when the cells were preexposed to oxidative stress (1-hour treatment with xanthine/xanthine oxidase), a significant increase in ROS formation was observed in cells pretreated with histamine (Figure 7B). This increase was prevented by the NOS inhibitor L-NAME, indicating that eNOS contributed to ROS production under these conditions.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 7. Contribution of histamine-induced eNOS to the production of ROS after exposure of endothelial cells to oxidative stress. EA.hy 926 cells were left untreated (control, Co) or were pretreated with 1 µmol/L histamine for 24 hours (His). Then, the cells were washed, and intracellular ROS formation was assayed by CM-H2DCFDA oxidation-based fluorescence in the presence of 10 µmol/L A23187 (A). Other cells were exposed to oxidative stress using xanthine (200 µmol/L) and xanthine oxidase (5 mU/mL) (XXO) for 1 hour (the 25th hour) after the 24-hour histamine pretreatment. A subgroup of cells received 1 mmol/L L-NAME together with XXO (B). After the incubation, the cells were washed several times to remove the XXO. Then, ROS production was assayed in the presence of 10 µmol/L A23187. Columns represent the mean±SEM of 3 experiments (**P<0.01).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The present study demonstrates that histamine upregulated eNOS mRNA and protein expression in HUVECs and HUVEC-derived EA.hy 926 cells (Figures 1 and 5).

Results from RT-PCR using subtype-specific primers indicated that H1 and H2 were expressed in HUVECs and EA.hy 926 cells (Figure 2A). However, the selective H2 antagonist cimetidine had no effect on histamine-induced eNOS expression, indicating that the H2 receptor is not involved in eNOS upregulation. Moreover, H2 receptors signal through adenylyl cyclase and cAMP, and our previous work has demonstrated that cAMP analogs do not affect eNOS expression in EA.hy 926 cells.17 Thus, the histamine-induced eNOS expression in human endothelial cells is probably mediated by the H1 receptor, because (1) eNOS induction was prevented by the selective H1-antagonist mepyramine (Figure 2B) and (2) the selective H1 agonist HTMT upregulated eNOS expression.

The histamine-induced eNOS expression is likely a transcriptional event. Histamine increased the activity of the 1.6-kb human eNOS promoter fragment in HUVECs and EA.hy 926 cells (Figure 3). In good agreement with mRNA expression data, activation of the eNOS promoter was blocked by mepyramine, indicating that the transcriptional activation is mediated through the H1 receptor.

H1 receptor stimulation results in an activation of phospholipase C and the production of inositol-1,4,5-trisphosphate, which in turn releases Ca2+ from inositol-1,4,5-trisphosphate-sensitive stores. Increases in intracellular free Ca2+, [Ca2+]i, in response to histamine, have been demonstrated for EA.hy 926 cells,22 as well as HUVECs.8

In human endothelial cells, the Ca2+-sensitive target responsible for the histamine-induced eNOS expression seems to be CaMK II, a ubiquitous enzyme that is also present in vascular endothelial cells.23 The histamine-induced eNOS expression was completely abolished by KN-93, a specific inhibitor of CaMK II (Figure 4A), whereas the inactive analog of KN-93, KN-92, was without effect (Figure 4A). Histamine treatment of EA.hy 926 cells led to activation of CaMK II, which was sensitive to KN-93 (Figure 4B). Also in HUVECs, histamine activated CaMK II.23 These data indicate that the histamine-induced eNOS expression involves CaMK II.

An upregulation of eNOS gene expression could result in a sustained enhancement of NO production in addition to the known short-term and transient effect of histamine on eNOS activity. Stimulation of EA.hy 926 cells with histamine for 1 hour resulted in an {approx}2-fold increase in NOx (Figure 6A). This likely reflects the short-term activation of eNOS by histamine. If, however, the cells were treated with histamine for 24 hours, the increase of accumulative NOx was {approx}4-fold. Agonist-stimulated eNOS enzyme activation is usually transient, and the enzyme activity returns to control levels within 30 minutes.23 Thus, the cumulative NO released from endothelial cells during 24 hours is likely to consist of 2 components: short-term NO release due to eNOS activation and a persistent NO release, probably resulting from increased eNOS expression. Indeed, when the cells were washed and then stimulated with Ca2+ ionophore, increased NO production was only seen in cells pretreated with histamine for 24 hours, not in those treated for 1 hour (Figure 6A). In agreement with this, bioactive NO, as measured by RFL-6 reporter cell assay, was increased after 24 hours of treatment with histamine (Figure 6B). Thus, under normal conditions and even at the early stages of vascular disease, the histamine-induced eNOS expression may represent a vasoprotective factor.

However, advanced stages of vascular diseases (atherosclerosis, diabetes, and hypertension) are associated with endothelial dysfunction and oxidative stress. In the present study, we tried to mimic these conditions by exposing endothelial cells to xanthine/xanthine oxidase. Under these conditions, the eNOS upregulated by histamine indeed contributed to ROS production (Figure 7) and, thus, may enhance the preexisting oxidative stress. We have previously reported similar phenomena in animals with experimental diabetes and hypertension.16,24,25 In all of these cases, the NO bioavailability decreased despite an upregulation of eNOS.

Decreased NO bioavailability can also contribute to histamine-induced coronary vasospasm. Under conditions of dysfunctional eNOS, the histamine-induced vasorelaxation is converted into a contraction, which is mediated via H1 receptors on smooth muscle cells.9,26 Histamine-induced vasoconstriction has also been observed in atherosclerotic coronary arteries26–28 and may contribute to the onset of an acute coronary syndrome. Interestingly, an increased histamine content has been found in atherosclerotic coronary segments.5,27,29

In conclusion, the present study demonstrates a novel effect of histamine on endothelial NO production. In addition to its short-term and transient action on eNOS activity, histamine also possesses a long-term effect on eNOS expression. The effect is H1 receptor-dependent and CaMK II-mediated. This eNOS upregulation may be protective under normal conditions by increasing NO production, but it may become harmful under conditions of oxidative stress when eNOS produces ROS at the expense of NO.


*    Acknowledgments
 
This work was supported by the Collaborative Research Center SFB 553 (project A1 to Dr Li and Dr Förstermann) from the Deutsche Forschungsgemeinschaft, Bonn, Germany, and by a grant from the National Natural Sciences Foundation of China (No. 39900055 to Dr Li). This work contains parts of the doctor of medicine thesis of Christian Burkhardt. We thank Dr Petra M. Schwarz for carefully reading the manuscript.

Received December 31, 2002; revision received February 20, 2003; accepted February 26, 2003.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Kelley JL, Chi DS, Abou-Auda W, et al. The molecular role of mast cells in atherosclerotic cardiovascular disease. Mol Med Today. 2000; 6: 304–308.[CrossRef][Medline] [Order article via Infotrieve]

2. Jeziorska M, McCollum C, Woolley DE. Mast cell distribution, activation, and phenotype in atherosclerotic lesions of human carotid arteries. J Pathol. 1997; 182: 115–122.[CrossRef][Medline] [Order article via Infotrieve]

3. Huang M, Pang X, Letourneau R, et al. Acute stress induces cardiac mast cell activation and histamine release, effects that are increased in apolipoprotein E knockout mice. Cardiovasc Res. 2002; 55: 150–160.[Abstract/Free Full Text]

4. Laine P, Naukkarinen A, Heikkila L, et al. Adventitial mast cells connect with sensory nerve fibers in atherosclerotic coronary arteries. Circulation. 2000; 101: 1665–1669.[Abstract/Free Full Text]

5. Laine P, Kaartinen M, Penttila A, et al. Association between myocardial infarction and the mast cells in the adventitia of the infarct-related coronary artery. Circulation. 1999; 99: 361–369.[Abstract/Free Full Text]

6. Bell L, Madri JA. Effect of platelet factors on migration of cultured bovine aortic endothelial and smooth muscle cells. Circ Res. 1989; 65: 1057–1065.[Abstract/Free Full Text]

7. Higuchi S, Tanimoto A, Arima N, et al. Effects of histamine and interleukin-4 synthesized in arterial intima on phagocytosis by monocytes/macrophages in relation to atherosclerosis. FEBS Lett. 2001; 505: 217–222.[CrossRef][Medline] [Order article via Infotrieve]

8. Lantoine F, Iouzalen L, Devynck MA, et al. Nitric oxide production in human endothelial cells stimulated by histamine requires Ca2+ influx. Biochem J. 1998; 330: 695–699.[Medline] [Order article via Infotrieve]

9. Toda N. Mechanism of histamine actions in human coronary arteries. Circ Res. 1987; 61: 280–286.[Abstract/Free Full Text]

10. Li H, Förstermann U. Nitric oxide in the pathogenesis of vascular disease. J Pathol. 2000; 190: 244–254.[CrossRef][Medline] [Order article via Infotrieve]

11. Eppihimer MJ, Wolitzky B, Anderson DC, et al. Heterogeneity of expression of E- and P-selectins in vivo. Circ Res. 1996; 79: 560–569.[Abstract/Free Full Text]

12. Jones DA, Abbassi O, McIntire LV, et al. P-selectin mediates neutrophil rolling on histamine-stimulated endothelial cells. Biophys J. 1993; 65: 1560–1569.[Medline] [Order article via Infotrieve]

13. Asako H, Kurose I, Wolf R, et al. Role of H1 receptors and P-selectin in histamine-induced leukocyte rolling and adhesion in postcapillary venules. J Clin Invest. 1994; 93: 1508–1515.[Medline] [Order article via Infotrieve]

14. Miyazawa N, Watanabe S, Matsuda A, et al. Role of histamine H1 and H2 receptor antagonists in the prevention of intimal thickening. Eur J Pharmacol. 1998; 362: 53–59.[CrossRef][Medline] [Order article via Infotrieve]

15. Takagishi T, Sasaguri Y, Nakano R, et al. Expression of the histamine H1 receptor gene in relation to atherosclerosis. Am J Pathol. 1995; 146: 981–988.[Abstract]

16. Li H, Wallerath T, Münzel T, et al. Regulation of endothelial-type NO synthase expression in pathophysiology and in response to drugs. Nitric Oxide. 2002; 7: 149–164.[CrossRef][Medline] [Order article via Infotrieve]

17. Li H, Förstermann U. Structure-activity relationship of staurosporine analogs in regulating expression of endothelial nitric-oxide synthase gene. Mol Pharmacol. 2000; 57: 427–435.[Abstract/Free Full Text]

18. Heinrich U, Maurer J, Koesling D, et al. Immuno-electron microscopic localization of the alpha(1) and beta(1)- subunits of soluble guanylyl cyclase in the guinea pig organ of corti. Brain Res. 2000; 885: 6–13.[CrossRef][Medline] [Order article via Infotrieve]

19. Li H, Junk P, Huwiler A, et al. Dual effect of ceramide on human endothelial cells: Induction of oxidative stress and transcriptional upregulation of endothelial nitric oxide synthase. Circulation. 2002; 106: 2250–2256.[Abstract/Free Full Text]

20. Xia Y, Tsai AL, Berka V, et al. Superoxide generation from endothelial nitric-oxide synthase. A Ca2+/calmodulin-dependent and tetrahydrobiopterin regulatory process. J Biol Chem. 1998; 273: 25804–25808.[Abstract/Free Full Text]

21. Cai H, Davis ME, Drummond GR, et al. Induction of endothelial NO synthase by hydrogen peroxide via a Ca(2+)/calmodulin-dependent protein kinase II/janus kinase 2-dependent pathway. Arterioscler Thromb Vasc Biol. 2001; 21: 1571–1576.[Abstract/Free Full Text]

22. Paltauf-Doburzynska J, Frieden M, Spitaler M, et al. Histamine-induced Ca2+ oscillations in a human endothelial cell line depend on transmembrane ion flux, ryanodine receptors and endoplasmic reticulum Ca2+-ATPase. J Physiol. 2000; 524: 701–713.[Abstract/Free Full Text]

23. Fleming I, Fisslthaler B, Dimmeler S, et al. Phosphorylation of Thr(495) regulates Ca(2+)/calmodulin-dependent endothelial nitric oxide synthase activity. Circ Res. 2001; 88: E68–E75.[CrossRef][Medline] [Order article via Infotrieve]

24. Mollnau H, Wendt M, Szöcs K, et al. Effects of Angiotensin II Infusion on the expression and function of NAD(P)H oxidase and components of nitric oxide/cGMP signaling. Circ Res. 2002; 90: E58–E65.[CrossRef][Medline] [Order article via Infotrieve]

25. Hink U, Li H, Mollnau H, et al. Mechanisms underlying endothelial dysfunction in diabetes mellitus. Circ Res. 2001; 88: E14–E22.[Medline] [Order article via Infotrieve]

26. Okumura K, Yasue H, Matsuyama K, et al. Effect of H1 receptor stimulation on coronary artery diameter in patients with variant angina: comparison with effect of acetylcholine. J Am Coll Cardiol. 1991; 17: 338–345.[Abstract]

27. Kalsner S, Richards R. Coronary arteries of cardiac patients are hyperreactive and contain stores of amines: a mechanism for coronary spasm. Science. 1984; 223: 1435–1437.[Abstract/Free Full Text]

28. Ginsburg R, Bristow MR, Davis K, et al. Quantitative pharmacologic responses of normal and atherosclerotic isolated human epicardial coronary arteries. Circulation. 1984; 69: 430–440.[Abstract/Free Full Text]

29. Forman MB, Oates JA, Robertson D, et al. Increased adventitial mast cells in a patient with coronary spasm. N Engl J Med. 1985; 313: 1138–1141.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Biol. Reprod.Home page
C. Mondillo, R. M. Pagotto, B. Piotrkowski, C. G. Reche, Z. J. Patrignani, C. B. Cymeryng, and O. P. Pignataro
Involvement of Nitric Oxide Synthase in the Mechanism of Histamine-Induced Inhibition of Leydig Cell Steroidogenesis via Histamine Receptor Subtypes in Sprague-Dawley Rats
Biol Reprod, January 1, 2009; 80(1): 144 - 152.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
H. Cai, D. Liu, and J. G.N. Garcia
CaM Kinase II-dependent pathophysiological signalling in endothelial cells
Cardiovasc Res, January 1, 2008; 77(1): 30 - 34.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Tanimoto, K.-Y. Wang, Y. Murata, S. Kimura, M. Nomaguchi, S. Nakata, M. Tsutsui, and Y. Sasaguri
Histamine Upregulates the Expression of Inducible Nitric Oxide Synthase in Human Intimal Smooth Muscle Cells via Histamine H1 Receptor and NF-{kappa}B Signaling Pathway
Arterioscler. Thromb. Vasc. Biol., July 1, 2007; 27(7): 1556 - 1561.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. V. R. Santhanam, L. A. Smith, K. A. Nath, and Z. S. Katusic
In vivo stimulatory effect of erythropoietin on endothelial nitric oxide synthase in cerebral arteries
Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H781 - H786.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
H. Li, K. Witte, M. August, I. Brausch, U. Godtel-Armbrust, A. Habermeier, E. I. Closs, M. Oelze, T. Munzel, and U. Forstermann
Reversal of Endothelial Nitric Oxide Synthase Uncoupling and Up-Regulation of Endothelial Nitric Oxide Synthase Expression Lowers Blood Pressure in Hypertensive Rats
J. Am. Coll. Cardiol., June 20, 2006; 47(12): 2536 - 2544.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
Y. Murata, A. Tanimoto, K.-Y. Wang, M. Tsutsui, Y. Sasaguri, F. De Corte, and H. Matsushita
Granulocyte Macrophage-Colony Stimulating Factor Increases the Expression of Histamine and Histamine Receptors in Monocytes/Macrophages in Relation to Arteriosclerosis
Arterioscler. Thromb. Vasc. Biol., February 1, 2005; 25(2): 430 - 435.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
H. Li, N. Xia, I. Brausch, Y. Yao, and U. Forstermann
Flavonoids from Artichoke (Cynara scolymus L.) Up-Regulate Endothelial-Type Nitric-Oxide Synthase Gene Expression in Human Endothelial Cells
J. Pharmacol. Exp. Ther., September 1, 2004; 310(3): 926 - 932.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
107/18/2348    most recent
01.CIR.0000066697.19571.AFv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, H.
Right arrow Articles by Förstermann, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, H.
Right arrow Articles by Förstermann, U.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*HISTAMINE
*NITRIC OXIDE
Related Collections
Right arrow Gene regulation
Right arrow Endothelium/vascular type/nitric oxide