| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2003;107:1355.)
© 2003 American Heart Association, Inc.
Brief Rapid Communication |
From the Cardiovascular Research Center and Cardiology Division, Massachusetts General Hospital, Boston.
Correspondence to Dr Calum MacRae, Cardiovascular Research Center, 149 13th St, 4th Floor, Charlestown, MA 02129. E-mail cmacrae{at}partners.org
| Abstract |
|---|
|
|
|---|
Methods and Results During a screen for the effects of 100 small molecules on the heart rate of the zebrafish, Danio rerio, we found that drugs that cause QT prolongation in humans consistently caused bradycardia and AV block in the zebrafish. Of 23 such drugs tested, 18 were positive in this initial screen. Poor absorption explained 4 of 5 false-negative results, as demonstrated by microinjection. Overall, 22 of 23 compounds that cause repolarization abnormalities were positive in this assay. Antisense "knockdown" of the zebrafish KCNH2 ortholog yielded bradycardia in a dose dependent manner confirming the effects of reduction of repolarizing potassium current in this model. Classical drug-drug interactions between erythromycin and cisapride, as well as cimetidine and terfenadine, were also reproduced.
Conclusion This simple high-throughput assay is a promising addition to the repertoire of preclinical tests for drug-induced repolarization abnormalities. The genetic tractability of the zebrafish will allow the exploration of heritable modifiers of such drug effects.
Key Words: drugs electrophysiology arrhythmia genes
| Introduction |
|---|
|
|
|---|
Repolarization is complex, depending on individual channels, receptors, cytoskeletal elements, and the membrane. Additional complexity results from regional heterogeneity within the heart.4 Further, some drugs, although safe in isolation, cause repolarization abnormalities when given with other medications,1 through pharmacokinetic or pharmacodynamic interactions. Genetic variation may contribute to individual susceptibility to drug-induced arrhythmias.3 A tractable model system enabling the identification of genes responsible for such variation would represent a significant advance.
Virtually all QT-prolonging drugs identified to date inhibit the rapid component of the repolarizing potassium current (IKr). A channel composed of at least two subunits, KCNH2 and KCNE2, is responsible for this current. In vitro assays focusing on IKr are limited by biological simplicity, low throughput, and inability to detect drug-drug interactions.5,6 Animal models, although more physiological, have an even lower throughput, restricting their ability to screen systematically for drug-drug interactions.6
The zebrafish has a beating heart with both a complex repertoire of ion channels and functioning metabolism within 26 hours of fertilization.7 The transparency of the embryo facilitates rapid evaluation of heart rate (HR) and rhythm. In addition, dramatic effects on cardiac function are tolerated by the larval fish which survive for 4 to 5 days without a circulation.8 In the course of screening 100 small molecules for their effects on embryonic HR, we noted that compounds known to cause QT prolongation and TdP in humans consistently caused bradycardia in the zebrafish.
| Methods |
|---|
|
|
|---|
Determination of Small Molecule Effects on Heart Rate
At 48 hpf, compounds were added to the wells from dimethylsulfoxide stocks (final concentration <2%). Vehicle alone was used as a control. HR measurement: 15 second video recordings were obtained with a Nikon TE200 microscope and a Hamamatsu ORCA-ER camera. Analysis was performed with Metamorph Software (Universal Imaging). The average pixel density was measured for a region of interest over the heart and plotted against time. Fast-Fourier Transform was performed to determine HR. Because some compounds caused AV block, whereas others slowed both atrial and ventricular rates, the ventricular rate was chosen as the most sensitive index of HR effect. Each compound was tested at 1, 10, and 100 mcg/mL, and the highest, nonlethal concentration was reported. Two-tailed Students t-tests were performed.
Microinjections
Zebrafish larvae at 48 hpf were anesthetized with tricaine and 5 nL of 10 mg/mL stock solutions of each compound dissolved in Danieaus solution (58 mmol/L NaCl, 7 mmol/L KCl, 0.4 mmol/L MgSO4, 6.0 mmol/L Ca(NO3)2, and 5.0 mmol/L HEPES pH 7.6) were injected into the yolk sac. The fish recovered for 4 hours before recording HR.
Approximately 5 nL of the morpholino antisense oligonucleotide (MO), diluted in Danieaus solution, were injected into zebrafish embryos at the single cell stage.9 The KCNH2 MO was directed against the initiator codon of the zebrafish KCNH2 ortholog (5'- CCGTCGTACAGGCATGTTGTCCTA -3').
To explore interactions between known IKr blockers and the KCNH2 MO, embryos were injected with the oligonucleotide at the single cell stage and exposed to drug at 24 hpf before HR was determined at 48 hpf.
| Results |
|---|
|
|
|---|
|
|
Antisense MO directed against zebrafish KCNH2 demonstrated a dose-dependent effect on HR (Figure 2B). Control MO and vehicle alone had no effect. As higher doses of IKr blockade resulted in asystole, we explored drug-morpholino interactions with submaximal terfenadine doses. The effects of the MO and drug are additive (Figure 2C).
Increasing amounts of erythromycin potentiated the effects of cisapride, demonstrating evidence of drug-drug interaction (Figure 2D). A 10-fold decrease in the ED50 on HR for cisapride is seen with increasing doses of erythromycin. A second example demonstrates the interaction of cimetidine and terfenadine (Figure 2E).
| Discussion |
|---|
|
|
|---|
IKr and Bradycardia
Bradycardia previously has been reported as a result of IKr blockade in several experimental and clinical situations.6,10 This effect has been attributed to action potential prolongation.11 Of the 23 known IKr-blockers tested in our initial screen, 18 caused bradycardia. Five compounds (erythromycin, N-acetyl-procainamide, pentamadine, procainamide, and sotalol) failed to elicit the expected effect. We deduced that erythromycin is absorbed from its interaction with cisapride (Figure 2D). Poor absorption remained a possible explanation for the lack of effect of the four other compounds. Supporting this is the hydrophilicity of these molecules, each with a logarithm of the octanol:water partition coefficient <1. Microinjection revealed that these compounds cause bradycardia in the zebrafish once the absorption barrier is bypassed. When the microinjection experiments are included, 22 of 23 known IKr-blocking agents were positive in this assay.
This simple assay is useful as a screen, presenting an opportunity to test not only large numbers of molecules, but also their quantitative interactions with a throughput superior to current methods.
Zebrafish KCNH2 "Knock-Down" Experiments
To demonstrate a mechanistic link between IKr blockade and bradycardia in the zebrafish, we performed "knock-down" experiments against the zebrafish ortholog of KCNH2. Antisense MO injected into the embryo elicited dose-dependent bradycardia. Combination of MO with submaximal terfenadine doses resulted in additive effects. Although not conclusive, these data are consistent with a model in which drug and MO act on the same target. Of note, submaximal doses of two IKr-blocking drugs have been shown to have additive properties.
The drugs we used are known to cause IKr blockade in a wide range of experimental models. In addition, IKr blockade causes bradycardia, and at high doses asystole, in whole animal and cellular systems. Taken together these data strongly suggest that IKr blockade is the cause of the bradycardia observed in the zebrafish. Some of the effects seen in the fish (as in other models) may reflect interactions with targets other than KCNH2. The zebrafish offers the potential to address such complexity.
Drug-Drug Interactions
The observation of two drug-drug interactions demonstrates another advantage of this zebrafish model. In humans, these interactions have been shown to be pharmacokinetic: the inhibition of hepatic metabolism by one drug resulting in increased levels of the other.12 Although the CYP3A4 gene is present in the zebrafish, further work will be required to define the mechanism of these interactions in this model.
Limitations
Hydrophilicity affects drug absorption and can lead to false-negatives in this assay. However, this problem appears to be predictable from the physicochemical characteristics of these compounds, and can be overcome by injection. Like any model system, the zebrafish does not perfectly predict human clinical outcomes. For instance, erythromycin, which prolongs the QT interval and can cause TdP,13 did not affect zebrafish HR. An additional limitation is the lack of specificity of drug-induced bradycardia. Not all molecules that result in bradycardia do so through IKr blockade; for example, propranolol and clonidine both reduce HR in this assay.
Future Directions
The observation that progesterone causes bradycardia raises the possibility that gender influences on drug-induced repolarization effects may be accessible.14 Possible differences in the mechanisms of action of IKr-blockers could be addressed with this whole animal model. The development of sensitized or resistant zebrafish strains may improve the specificity of this system. Finally, human pharmacogenetic studies of cardiac repolarization have been limited to the evaluation of candidate genes, as more powerful segregation-based family studies of drug responses are not feasible.1518 The ease of genetic manipulation in the zebrafish should allow the unbiased identification of inherited modifiers of drug responses.
| Acknowledgments |
|---|
Received December 31, 2002; revision received January 28, 2003; accepted February 3, 2003.
| References |
|---|
|
|
|---|
2. Keating MT, Sanguinetti MC. Molecular and cellular mechanisms of cardiac arrhythmias. Cell. 2001; 104: 569580.[CrossRef][Medline] [Order article via Infotrieve]
3. Roden DM. Pharmacogenetics and drug-induced arrhythmias. Cardiovasc Res. 2001; 50: 224231.
4. Antzelevitch C, Fish J. Electrical heterogeneity within the ventricular wall. Basic Res Cardiol. 2001; 96: 517527.[CrossRef][Medline] [Order article via Infotrieve]
5. Yang T, Snyders D, Roden DM. Drug block of I(kr): model systems and relevance to human arrhythmias. J Cardiovasc Pharmacol. 2001; 38: 737744.[CrossRef][Medline] [Order article via Infotrieve]
6. Eckardt L, Haverkamp W, Borggrefe M, et al. Experimental models of torsade de pointes. Cardiovasc Res. 1998; 39: 178193.
7. Baker K, Warren KS, Yellen G, et al. Defective "pacemaker" current (Ih) in a zebrafish mutant with a slow heart rate. Proc Natl Acad Sci U S A. 1997; 94: 45544559.
8. Warren KS, Fishman MC. "Physiological genomics": mutant screens in zebrafish. Am J Physiol. 1998; 275(1 Pt 2): H1H7.
9. Nasevicius A, Ekker SC. Effective targeted gene knockdown in zebrafish. Nat Genet. 2000; 26: 216220.[CrossRef][Medline] [Order article via Infotrieve]
10. De Clerck F, Van de Water A, DAubioul J, et al. In vivo measurement of QT prolongation, dispersion and arrhythmogenesis: application to the preclinical cardiovascular safety pharmacology of a new chemical entity. Fundamental & Clinical Pharmacology. 2002; 16: 125140.[CrossRef][Medline] [Order article via Infotrieve]
11. Verheijck EE, van Ginneken AC, Bourier J, et al. Effects of delayed rectifier current blockade by E-4031 on impulse generation in single sinoatrial nodal myocytes of the rabbit. Circ Res. 1995; 76: 607615.
12. Roden DM. Acquired long QT syndromes and the risk of proarrhythmia. J Cardiovasc Electrophysiol. 2000; 11: 938940.[Medline] [Order article via Infotrieve]
13. Antzelevitch C, Sun ZQ, Zhang ZQ, et al. Cellular and ionic mechanisms underlying erythromycin-induced long QT intervals and torsade de pointes. J Am Coll Cardiol. 1996; 28: 18361848.[Abstract]
14. Pham TV, Rosen MR. Sex, hormones, and repolarization. Cardiovasc Res. 2002; 53: 740751.
15. Yang P, Kanki H, Drolet B, et al. Allelic variants in long-QT disease genes in patients with drug-associated torsades de pointes. Circulation. 2002; 105: 19431948.
16. Sesti F, Abbott GW, Wei J, et al. A common polymorphism associated with antibiotic-induced cardiac arrhythmia. Proc Natl Acad Sci U S A. 2000; 97: 1061310618.
17. Roden DM, George AL Jr. The genetic basis of variability in drug responses. Nat Rev Drug Discov. 2002; 1: 3744.[CrossRef][Medline] [Order article via Infotrieve]
18. Splawski I, Timothy KW, Tateyama M, et al. Variant of SCN5A sodium channel implicated in risk of cardiac arrhythmia. Science. 2002; 297: 13331336.
This article has been cited by other articles:
![]() |
D. J. Milan, A. M. Kim, J. R. Winterfield, I. L. Jones, A. Pfeufer, S. Sanna, D. E. Arking, A. H. Amsterdam, K. M. Sabeh, J. D. Mably, et al. Drug-Sensitized Zebrafish Screen Identifies Multiple Genes, Including GINS3, as Regulators of Myocardial Repolarization Circulation, August 18, 2009; 120(7): 553 - 559. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Kalin, N. E. Banziger-Tobler, M. Detmar, and A. W. Brandli An in vivo chemical library screen in Xenopus tadpoles reveals novel pathways involved in angiogenesis and lymphangiogenesis Blood, July 30, 2009; 114(5): 1110 - 1122. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Schlueter and R. T. Peterson Systematizing Serendipity for Cardiovascular Drug Discovery Circulation, July 21, 2009; 120(3): 255 - 263. [Full Text] [PDF] |
||||
![]() |
M. Eijgelsheim, A. L.H.J. Aarnoudse, F. Rivadeneira, J. A. Kors, J. C. M. Witteman, A. Hofman, C. M. van Duijn, A. G. Uitterlinden, and B. H.C. Stricker Identification of a common variant at the NOS1AP locus strongly associated to QT-interval duration Hum. Mol. Genet., January 15, 2009; 18(2): 347 - 357. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kokel and R. T. Peterson Chemobehavioural phenomics and behaviour-based psychiatric drug discovery in the zebrafish Brief Funct Genomic Proteomic, November 1, 2008; 7(6): 483 - 490. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Mangoni and J. Nargeot Genesis and Regulation of the Heart Automaticity Physiol Rev, July 1, 2008; 88(3): 919 - 982. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Tran, B. Sneed, J. Haider, D. Blavo, A. White, T. Aiyejorun, T. C. Baranowski, A. L. Rubinstein, T. N. Doan, R. Dingledine, et al. Automated, Quantitative Screening Assay for Antiangiogenic Compounds Using Transgenic Zebrafish Cancer Res., December 1, 2007; 67(23): 11386 - 11392. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Strevel, D. J. Ing, and L. L. Siu Molecularly Targeted Oncology Therapeutics and Prolongation of the QT Interval J. Clin. Oncol., August 1, 2007; 25(22): 3362 - 3371. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Stehr, T. L. Linbo, J. P. Incardona, and N. L. Scholz The Developmental Neurotoxicity of Fipronil: Notochord Degeneration and Locomotor Defects in Zebrafish Embryos and Larvae Toxicol. Sci., July 1, 2006; 92(1): 270 - 278. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Milan, I. L. Jones, P. T. Ellinor, and C. A. MacRae In vivo recording of adult zebrafish electrocardiogram and assessment of drug-induced QT prolongation Am J Physiol Heart Circ Physiol, July 1, 2006; 291(1): H269 - H273. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Milan, A. C. Giokas, F. C. Serluca, R. T. Peterson, and C. A. MacRae Notch1b and neuregulin are required for specification of central cardiac conduction tissue Development, March 15, 2006; 133(6): 1125 - 1132. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Costache, P. K. Pullela, P. Kasha, H. Tomasiewicz, and D. S. Sem Homology-Modeled Ligand-Binding Domains of Zebrafish Estrogen Receptors {alpha}, {beta}1, and {beta}2: From in Silico to in Vivo Studies of Estrogen Interactions in Danio rerio as a Model System Mol. Endocrinol., December 1, 2005; 19(12): 2979 - 2990. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Milan and C. A. MacRae Animal models for arrhythmias Cardiovasc Res, August 15, 2005; 67(3): 426 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Hill, H. Teraoka, W. Heideman, and R. E. Peterson Zebrafish as a Model Vertebrate for Investigating Chemical Toxicity Toxicol. Sci., July 1, 2005; 86(1): 6 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kopp, T. Schwerte, and B. Pelster Cardiac performance in the zebrafish breakdance mutant J. Exp. Biol., June 1, 2005; 208(11): 2123 - 2134. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2003 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |