Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2002;106:773-775
Published online before print August 5, 2002, doi: 10.1161/01.CIR.0000028420.27813.C0
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
106/7/773    most recent
01.CIR.0000028420.27813.C0v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Trip, M. D.
Right arrow Articles by Bergen, A. A.B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trip, M. D.
Right arrow Articles by Bergen, A. A.B.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*UniGene
Medline Plus Health Information
*Coronary Artery Disease
*Genetics Home Reference
Related Collections
Right arrow Clinical genetics
Right arrow Risk Factors
Right arrow Genetics of cardiovascular disease

(Circulation. 2002;106:773.)
© 2002 American Heart Association, Inc.


Brief Rapid Communications

Frequent Mutation in the ABCC6 Gene (R1141X) Is Associated With a Strong Increase in the Prevalence of Coronary Artery Disease

Mieke D. Trip, MD; Yvo M. Smulders, MD, PhD; Jurgen J. Wegman, MD; Xiaofeng Hu, MD; Jolanda M.A. Boer, PhD; Jacoline B. ten Brink, Ing; Aeilko H. Zwinderman, PhD; John J.P. Kastelein, MD, PhD; Edith J.M. Feskens, PhD; Arthur A.B. Bergen, PhD

From the Departments of Cardiology (M.D.T.), Clinical Epidemiology and Biostatistics (A.H.Z.), and Vascular Medicine (Y.MS, J.J.W., J.J.P.K.), Clinical Genetics (A.A.B.B.), Academic Medical Centre, University of Amsterdam, Amsterdam; Department of Chronic Diseases Epidemiology, National Institute of Public Health and the Environment (J.B., E.J.M.F.), Bilthoven; and The Netherlands Ophthalmic Research Institute (J.B.t.B., X.H., A.A.B.B.), Amsterdam, the Netherlands.

Correspondence to Mieke D. Trip, Department of Cardiology, Academic Medical Centre, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands. E-mail M.D.Trip{at}AMC.UVA.NL


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— Pseudoxanthoma elasticum (PXE) is an inborn disorder of the connective tissue with specific skin, ocular, and cardiovascular disease (CVD) manifestations. Recently, we and others have identified mutations in the gene coding for the ABCC6 transporter in PXE patients with ocular and skin involvement. In the Netherlands, as in the rest of Europe, a particular premature truncation variant ABCC6 (R1141X) was found in a large cohort of PXE patients. Given the association between CVD and PXE, we hypothesized that heterozygosity of this ABCC6 mutation could also confer an increased risk for CVD.

Methods and Results— To assess the relationship between the frequent R1141X mutation in the ABCC6 gene and the prevalence of premature coronary artery disease (CAD), we conducted a case-control study of 441 patients under the age of 50 years who had definite CAD and 1057 age- and sex-matched population-based controls who were free of coronary disease. Strikingly, the prevalence of the R1141X mutation was 4.2 times higher among patients than among controls (3.2% versus 0.8%; P<0.001). Consequently, among subjects with the R1141X mutation, the odds ratio for a coronary event was 4.23 (95% CI: 1.76 to 10.20, P= 0.001).

Conclusion— The presence of the R1141X mutation in the ABCC6 gene is associated with a sharply increased risk of premature CAD.


Key Words: cardiovascular diseases • coronary disease • atherosclerosis • genes


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Pseudoxanthoma elasticum (PXE) is an inborn disorder, the hallmark of which is dystrophic mineralization of elastic tissues of the skin, retina, and arterial walls.14 Most PXE patients seem random, but autosomal recessive and autosomal dominant inheritance also is observed.5,6 The frequency of PXE in the general population is unknown, particularly because it is likely that individuals with a mild clinical phenotype will escape diagnosis. Recently, we and others elucidated the molecular basis of PXE by demonstrating mutations in an ATP-binding cassette (ABC) transporter gene (ABCC6) as the cause for this disorder.712 Cardiovascular manifestations of PXE include accelerated atherosclerosis, which results in myocardial infarction at a young age and is attributed to calcification of the internal elastic laminae of the coronary arteries. On several occasions we were struck by the fact that, in our patients suffering from premature cardiovascular disease, PXE was found to be concomitantly present. Whether carriership of a single ABCC6 gene mutation on one allele would also confer additional risk for coronary artery disease (CAD) was hitherto impossible to assess. This situation changed with the elucidation of the molecular basis of PXE. In parallel studies (Xiaofeng Hu, unpublished data), we found that the R1141X mutation is the most common mutation in Dutch PXE patients and families, and it seems as though this is the case for the rest of Europe as well. We therefore studied the prevalence of the R1141X mutation in the ABCC6 gene in patients with premature CAD and in a large population-based group of healthy controls to further delineate the role of this genetic variation as a risk factor for CAD.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Case and Control Population
Consecutive Dutch patients under the age of 50 years with CAD (n=441) referred between 1995 and 2001 to the Atherosclerosis Outpatient Clinic of the Academic Medical Center of the University of Amsterdam were included in the study. Patients qualified for inclusion after a myocardial infarction, surgical or percutaneous coronary revascularization, or a coronary angiogram with evidence of at least a 70% stenosis in a major epicardial artery. The Institutional Review Board approved the protocol. All patients gave informed consent.

Control subjects (n=1057) were selected from the participants of the Cardiovascular Disease Risk Factor Monitoring Project, a large project that screened for cardiovascular risk factors and was carried out in 3 Dutch towns (Amsterdam, Doetinchem, and Maastricht) between 1987 and 1991. All participants completed an informed consent form, agreeing to the use of stored blood samples for further scientific research. A detailed description of these examinations was published previously.13 Approximately 2 controls per case were selected, group matched for sex and age (within 5 years). All controls were Dutch and reported no history of myocardial infarction, percutaneous transluminal coronary angiography, or coronary artery bypass grafting in a self-administered questionnaire.

Mutation Analysis
Genomic DNA was extracted according to standard protocols. The polymerase chain reaction primers used to amplify exon 24 were MRP6 ex 24F:AAGGTCTTCTCTGCCCTGGCTCTT and MRP6 ex 24R:CTTCCCTCTCCCATCCATCCTTCT.

After polymerase chain reaction (20 ng/µL DNA in 25 µL), the product and an internal control were digested with the restriction enzyme BsiY1. Mutated products remained uncut. The fragments obtained were separated on a 3% agarose gel and visualized after staining with ethidium bromide. The presence of the mutation was confirmed by direct sequencing.

Biochemical Analysis
In the CAD patients, plasma cholesterol and triglycerides were determined with commercially available enzymatic methods (Boehringer Mannheim, FRG, No. 237574, and Sera-PAK, No. 6639, respectively). To determine high-density lipoprotein cholesterol, the polyethylene glycol 6000 precipitation method was used. Low-density lipoprotein cholesterol was calculated by the Friedewald formula. The biochemical analysis for the controls has been described previously.13

Statistical Analysis
Fisher’s exact test was applied to compare allele frequencies between groups, and exact 95% CIs were calculated for the odds ratio, with adjustment for matching criteria. Risk factors were compared between cases and controls and between carriers and noncarriers with the use of either Fisher’s exact test or t test, where appropriate.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
The characteristics of the 441 cases and 1057 controls are presented in Table 1. As expected, the frequency of increased body mass index, dyslipidemia, smoking, hypertension, and diabetes was increased in cases versus controls. In cases, 14 of 441 (3.2%, 95% CI: 1.9 to 5.6) were carriers of the R1141X truncation variant, whereas 8 of 1057 controls (0.8%, 95% CI: 0.3 to 1.5) carried this ABCC6 mutation, yielding a statistically significant difference at a probability value <0.001 with an odds ratio corrected for age and sex of 4.23 (95% CI: 1.76 to 10.20).


View this table:
[in this window]
[in a new window]
 
Table 1. Characteristics of Cases and Controls

We subsequently categorized the premature CAD patients in carriers (n=14) and noncarriers (n=427) of the R1141X variant of the ABCC6 gene (Table 2). The major risk factors for CAD were equally divided in both groups.


View this table:
[in this window]
[in a new window]
 
Table 2. Baseline Characteristics of Patients According to R1141X Genotype


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
We demonstrate in a large case-control study that a strong association exists between a frequent mutation in the ABCC6 gene (R1141X) and the presence of premature CAD. Carriers of this mutation had an odds ratio of 4.2 for CAD when compared with noncarriers. In addition, we could not find a relation between this mutation and other major CAD risk factors, suggesting that this mutation in the ABCC6 transporter is operating through a novel pathway in atherogenesis.

PXE is characterized by deranged elastic fiber metabolism, resulting in fragmentation and calcification of elastic fibers, with resultant changes in the skin, eyes, gastrointestinal tract, and cardiovascular system. Cardiovascular manifestations in PXE include premature CAD, cerebrovascular disease, peripheral vascular disease, and renovascular hypertension. Calcium deposits in the elastic lamina of the arterial wall indeed resemble the other calcium deposits seen in PXE patients.

PXE-like elastic tissue disorders have also been documented in sickle cell disease, ß-thalassemia and sickle thalassemia, Marfan’s syndrome, Ehlers-Danlos’ syndrome, and Paget’s disease.14 The pathology of these PXE-like syndromes is generally considered to be one of the manifestations of the underlying systemic illness. PXE, or at least a number of its clinical manifestations, could therefore also be considered as secondary to an underlying systemic disorder.15

Recently, mutations in the ABCC6 gene have been established as the cause of PXE. The exact biological function of ABCC6, however, is presently still unknown, as is the functional relationship of this transmembrane transporter to the pathogenesis of the PXE phenotype. ABCC6 messenger-RNA was reported to be highly expressed in the liver and kidney, in contrast to tissues characteristically affected by PXE.16

Whatever the specific pathophysiology of PXE, our study results seem to indicate that mutations in the ABCC6 gene are not rare in the general population and contribute to an increased propensity toward premature atherosclerotic vascular disease. If our data are subsequently confirmed in other cohorts, this might have implications for genetic screening in PXE kindreds and may require a more aggressive approach toward CAD prevention in these individuals.


*    Acknowledgments
 
Dr Kastelein is an Established Investigator of the Netherlands Heart Foundation (2000D039). Dr Boer was funded by the Netherlands Heart Foundation (98.067).

Received May 1, 2002; revision received June 17, 2002; accepted June 18, 2002.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Yap EY, Gleaton MS, Buettner H. Visual loss associated with pseudoxanthoma elasticum. Retina. 1992; 12: 315–319.[Medline] [Order article via Infotrieve]

2. Mendelsohn G, Bulkley BH, Hutchins GM. Cardiovascular manifestations of pseudoxanthoma elasticum. Arch Pathol Lab Med. 1978; 102: 298–302.[Medline] [Order article via Infotrieve]

3. Lebwohl M, Schwartz E, Lemlich G, et al. Abnormalities of connective tissue components in lesional and non-lesional tissue of patients with pseudoxanthoma elasticum. Arch Dermatol Res. 1993; 285: 121–126.[CrossRef][Medline] [Order article via Infotrieve]

4. Hausser I, Anton-Lamprecht I. Early preclinical diagnosis of dominant pseudoxanthoma elasticum by specific ultrastructural changes of dermal elastic and collagen tissue in a family at risk. Hum Genet. 1991; 87: 693–700.[Medline] [Order article via Infotrieve]

5. Christiano AM, Lebwohl MB, Boyd CD, et al. Workshop on pseudoxanthoma elasticum: molecular biology and pathology of the elastic fibres. Jefferson Medical College, Philadelphia, Pennsylvania. J Invest Dermatol. 1992; 99: 660–663.[CrossRef][Medline] [Order article via Infotrieve]

6. Lebwohl M, et al. Classification of pseudoxanthoma elasticum: report of a consensus conference. J Am Acad Dermatol. 1994; 30: 103–107.[Medline] [Order article via Infotrieve]

7. Bergen AAB, Plomp AS, Schuurman EJ, et al. Mutations in ABCC6 cause pseudoxanthoma elasticum. Nat Genet. 2000; 25: 228–231.[CrossRef][Medline] [Order article via Infotrieve]

8. Le Saux O, Urban Z, Tschuch C, et al. Mutations in a gene encoding an ABC transporter cause pseudoxanthoma elasticum. Nat Genet. 2000; 25: 223–227.[CrossRef][Medline] [Order article via Infotrieve]

9. Le Saux O, Beck K, Sachsinger C, et al. A spectrum of ABCC6 mutations is responsible for pseudoxanthoma elasticum. Am J Hum Genet. 2001; 69: 749–764.[CrossRef][Medline] [Order article via Infotrieve]

10. Ringpfeil F, Lebwohl MG, Christiano AM, et al. Pseudoxanthoma elasticum: mutations in the MRP6 gene encoding a transmembrane ATP-binding cassette (ABC) transporter. Proc Natl Acad Sci U S A. 2000; 97: 6001–6006.[Abstract/Free Full Text]

11. Struk B, Zach S, Ji W, et al. Mutations of the gene encoding the transmembrane transporter protein ABCC6 cause pseudoxanthoma elasticum. J Mol Med. 2000; 78: 282–286.[CrossRef][Medline] [Order article via Infotrieve]

12. Pulkkinen L, Nakano A, Ringpfeil F. Identification of ABCC6 pseudogenes on human chromosome 16p: implications for mutation detection in pseudoxanthoma elasticum. Hum Genet. 2001; 109: 356–365.[CrossRef][Medline] [Order article via Infotrieve]

13. Verschuren WMM, van Leer EM, Blokstra A, et al. Cardiovascular disease risk factors in the Netherlands. Neth J Cardiol. 1993; 6: 205–210.

14. Aessopos A, Farmakis D, Loukopoulos D. Elastic tissue abnormalities resembling pseudoxanthoma elasticum in ß thalassemia and the sickling syndromes. Blood. 2002: 99: 30–35.[Abstract/Free Full Text]

15. Ringpfeil F, Pulkinen L, Uitto J. Molecular genetics of pseudoxanthoma elasticum. Exp Dermatol. 2001; 10: 221–228.[CrossRef][Medline] [Order article via Infotrieve]

16. Scheffer GL, Hu X, Pijnenborg ACLM, et al. MRP6 (ABCC6) detection in normal human tissues and tumors. Lab Invest. 2002; 82: 515–518.[CrossRef][Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Arch DermatolHome page
L. Martin, F. Maitre, P. Bonicel, P. Daudon, C. Verny, D. Bonneau, O. Le Saux, and N. Chassaing
Heterozygosity for a Single Mutation in the ABCC6 Gene May Closely Mimic PXE: Consequences of This Phenotype Overlap for the Definition of PXE
Arch Dermatol, March 1, 2008; 144(3): 301 - 306.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
N Chassaing, L Martin, P Calvas, M Le Bert, and A Hovnanian
Pseudoxanthoma elasticum: a clinical, pathophysiological and genetic update including 11 novel ABCC6 mutations
J. Med. Genet., December 1, 2005; 42(12): 881 - 892.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. F. Klement, Y. Matsuzaki, Q.-J. Jiang, J. Terlizzi, H. Y. Choi, N. Fujimoto, K. Li, L. Pulkkinen, D. E. Birk, J. P. Sundberg, et al.
Targeted Ablation of the Abcc6 Gene Results in Ectopic Mineralization of Connective Tissues
Mol. Cell. Biol., September 15, 2005; 25(18): 8299 - 8310.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
T. G.M.F. Gorgels, X. Hu, G. L. Scheffer, A. C. van der Wal, J. Toonstra, P. T.V.M. de Jong, T. H. van Kuppevelt, C. N. Levelt, A. de Wolf, W. J.P. Loves, et al.
Disruption of Abcc6 in the mouse: novel insight in the pathogenesis of pseudoxanthoma elasticum
Hum. Mol. Genet., July 1, 2005; 14(13): 1763 - 1773.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Aranyi, M. Ratajewski, V. Bardoczy, L. Pulaski, A. Bors, A. Tordai, and A. Varadi
Identification of a DNA Methylation-dependent Activator Sequence in the Pseudoxanthoma Elasticum Gene, ABCC6
J. Biol. Chem., May 13, 2005; 280(19): 18643 - 18650.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
L Hadjinikolaou, K Kotidis, and M Galinanes
Relationship between reduced elasticity of extracardiac vessels and left main stem coronary artery disease
Eur. Heart J., March 2, 2004; 25(6): 508 - 513.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
E. Braunwald
Cardiology: the past, the present, and the future
J. Am. Coll. Cardiol., December 17, 2003; 42(12): 2031 - 2041.
[Full Text] [PDF]


Home page
IOVSHome page
X. Hu, R. Peek, A. Plomp, J. t. Brink, G. Scheffer, S. van Soest, A. Leys, P. T. V. M. de Jong, and A. A. B. Bergen
Analysis of the Frequent R1141X Mutation in the ABCC6 Gene in Pseudoxanthoma Elasticum
Invest. Ophthalmol. Vis. Sci., May 1, 2003; 44(5): 1824 - 1829.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. P. Germain, P. Boutouyrie, B. Laloux, and S. Laurent
Arterial Remodeling and Stiffness in Patients With Pseudoxanthoma Elasticum
Arterioscler Thromb Vasc Biol, May 1, 2003; 23(5): 836 - 841.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
106/7/773    most recent
01.CIR.0000028420.27813.C0v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Trip, M. D.
Right arrow Articles by Bergen, A. A.B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trip, M. D.
Right arrow Articles by Bergen, A. A.B.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*UniGene
Medline Plus Health Information
*Coronary Artery Disease
*Genetics Home Reference
Related Collections
Right arrow Clinical genetics
Right arrow Risk Factors
Right arrow Genetics of cardiovascular disease