Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2002;105:950-955
Published online before print January 22, 2002, doi: 10.1161/hc0802.104535
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
105/8/950    most recent
hc0802.104535v2
hc0802.104535v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jamshidi, Y.
Right arrow Articles by Flavell, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jamshidi, Y.
Right arrow Articles by Flavell, D. M.
Related Collections
Right arrow Clinical genetics
Right arrow Energy metabolism
Right arrow Gene regulation
Right arrow Hypertrophy
Right arrow Clinical Studies
Right arrow Exercise/exercise testing/rehabilitation
Right arrow CT and MRI

(Circulation. 2002;105:950.)
© 2002 American Heart Association, Inc.


Clinical Investigation and Reports

Peroxisome Proliferator–Activated Receptor {alpha} Gene Regulates Left Ventricular Growth in Response to Exercise and Hypertension

Yalda Jamshidi, PhD; Hugh E. Montgomery, BSc, MD, MRCP; Hans-Werner Hense, MD; Saul G. Myerson, MRCP; Ines Pineda Torra, PhD; Bart Staels, PhD; Michael J. World, BSc, MD, FRCP; Angela Doering, MD; Jeanette Erdmann, PhD; Christian Hengstenberg, MD; Steve E. Humphries, PhD, FRCPath, MRCP; Heribert Schunkert, MD; David M. Flavell, PhD

From the Centre for Cardiovascular Genetics, Department of Medicine (Y.J., H.E.M., S.G.M., S.E.H.), University College London Medical School, London, UK; Institut fur Epidemiologie und Sozialmedizin (H.-W. H.), University of Munster, Germany; U.325 INSERM, Département d’Athérosclérose, Institut Pasteur and Faculté de Pharmacie (I.P.T., B.S.), Université de Lille II, Lille, France; Royal Defence Medical College (M.W.), Gosport, Hampshire, UK; GSF-Forschungszentrum (A.D.), Institut fuer Epidemiologie, Neuherberg, Germany; and Klinik und Poliklinik fur Innere Medizin II (J.E., C.H., H.S.), University of Regensburg, Germany.

Correspondence to Dr David M. Flavell, Centre for Cardiovascular Genetics, Department of Medicine, University College London Medical School, Rayne Building, 5 University St, London, WC1E 6JJ UK. E-mail rmhadfl{at}ucl.ac.uk


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background Left ventricular hypertrophy (LVH) occurs as an adaptive response to a physiological (such as exercise) or pathological (valvular disease, hypertension, or obesity) increase in cardiac work. The molecular mechanisms regulating the LVH response are poorly understood. However, inherited defects in fatty acid oxidation are known to cause severe early-onset cardiac hypertrophy. Peroxisome proliferator–activated receptor {alpha} (PPAR{alpha}) regulates genes responsible for myocardial fatty acid oxidation and is downregulated during cardiac hypertrophy, concomitant with the switch from fatty acid to glucose utilization.

Methods and Results The role of PPAR{alpha} in left ventricular growth was investigated in 144 young male British Army recruits undergoing a 10-week physical training program and in 1148 men and women participating in the echocardiographic substudy of the Third Monitoring Trends and Determinants in Cardiovascular Disease (MONICA) Augsburg study. A G/C polymorphism in intron 7 of the PPAR{alpha} gene significantly influenced left ventricular (LV) growth in response to exercise (P=0.009). LV mass increased by 6.7±1.5 g in G allele homozygotes but was significantly greater in heterozygotes for the C allele (11.8±1.9 g) and in CC homozygotes (19.4±4.2 g). Likewise, C allele homozygotes had significantly higher LV mass, which was greater still in hypertensive subjects, and a higher prevalence of LVH in the Third MONICA Augsburg study.

Conclusions We demonstrate that variation in the PPAR{alpha} gene influences human left ventricular growth in response to exercise and hypertension, indicating that maladaptive cardiac substrate utilization can play a causative role in the pathogenesis of LVH.


Key Words: genetics • hypertrophy • exercise • hypertension • fatty acids


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Left ventricular hypertrophy (LVH) is generally understood to be an adaptive response to increased workload. In fact, both physiological and pathological stimuli (valvular disease, hypertension, obesity, and exercise1) may stimulate cardiac growth. In addition, mutations in genes encoding sarcomeric proteins affecting contractility may cause LVH.2 LVH is an independent risk factor for cardiovascular morbidity and mortality3,4 through largely unknown mechanisms. However, studies in related5 and unrelated6 individuals clearly demonstrate that a high proportion of interindividual variability in left ventricular mass and risk of LVH is attributable to genetic factors.7

An important molecular adaptation in the hypertrophied heart is the increase in glucose utilization and decrease in fatty acid oxidation (FAO) attributable to downregulation of FAO enzyme mRNA levels.8 Defects in mitochondrial FAO enzymes cause childhood hypertrophic cardiomyopathy,9 and perturbation of FAO in animal models causes cardiac hypertrophy,10,11 indicating that substrate utilization is important in the pathogenesis of hypertrophy. Peroxisome proliferator–activated receptor {alpha} (PPAR{alpha}) is a ligand-activated transcription factor12 that regulates the expression of genes involved in fatty acid (FA) uptake and oxidation, lipid metabolism, and inflammation.13 Ligands for PPAR{alpha} include long-chain fatty acids14 and the fibrate class of lipid-lowering drugs.15 PPAR{alpha} is expressed at high levels in tissues that catabolize FA, such as the liver, skeletal muscle, and heart.16 PPAR{alpha} regulates the expression of cardiac mitochondrial FAO enzymes17 and is downregulated during cardiac hypertrophy in vitro and in vivo, leading to reduced FAO and impaired cellular lipid homeostasis.18 PPAR{alpha}-knockout mice have markedly reduced FAO and exhibit cardiac lipid accumulation and fibrosis19 and die on inhibition of mitochondrial fatty acid uptake.20

The influence of PPAR{alpha} on cardiac growth was examined using the previously described functional leucine 162 valine (L162V) variant21 and a novel G/C polymorphism in intron 7 of the human PPAR{alpha} gene. In particular, the role of PPAR{alpha} in the physiological left ventricular hypertrophic response to exercise was examined in 144 young male British Army recruits undergoing an intense 10-week physical training program.22 The role of PPAR{alpha} in the pathophysiological response to hypertension was investigated in a population-based sample of 1148 German men and women participating in the Third Monitoring Trends and Determinants in Cardiovascular Disease (MONICA) Augsburg survey.23


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Study Populations
The army exercise study comprises 144 healthy normotensive white male British Army recruits, selected for homozygosity of the angiotensin-converting enzyme (ACE) insertion/deletion (I/D) genotype, randomized to receive placebo or 25 mg/d losartan, an AT1 receptor antagonist, throughout a 10-week training program. Recruits underwent an identical standard supervised training regime consisting of mixed upper and lower body strength and endurance training. At the start and end of training, height, weight and blood pressure were determined and cardiac MRI was performed. Briefly, 10-mm ECG-gated short-axis cardiac images (single breath holding, 0.5T) were obtained, and left ventricular (LV) mass was determined by multiplying myocardial tissue volume by myocardial tissue-specific density. Chamber volumes were calculated by summing end-diastolic and end-systolic endocardial areas in each slice.22 The effects of environmental variation are minimized by the racial, age, and sex homogeneity of the cohort, the absence of cardiorespiratory disease, identical living quarters and clothing, and access to a high-carbohydrate diet.

The echocardiographic substudy of the third MONICA Augsburg survey has been previously described.23 Subjects originate from a sex- and age-stratified random sample of all German residents of the Augsburg study area aged 25 to 74 years. Hypertension was defined as systolic blood pressure >=160 mm Hg or diastolic blood pressure >=95 mm Hg or intake of antihypertensive medication during the 7 days preceding the examination. A 2-dimensionally guided M-mode echocardiogram was performed on each subject. Structures for M-mode–guided calculation of LVM were measured according to the guidelines of the American Society of Echocardiography, and LVM was calculated and indexed to body surface area as LVM index in g/m2 of body surface area. LVH was defined when LVM index was >134 g/m2 body surface area in men or >110 g/m2 body surface area in women.

Genotype Determination
Genotyping was carried out by polymerase chain reaction (PCR) and restriction enzyme digestion. PPAR{alpha} L162V and ACE I/D genotyping was performed as previously described.21,22 Intron 7 genotyping was performed in NH3 buffer (16 mmol/L [NH4]2SO4, 67 mmol/L TRIS, pH 8.4, 0.01% Tween 20, 0.02 mmol/L each dNTP), 2 mmol/L MgCl2, 8 pmol each primer, and 0.2 U Taq polymerase. PCR primers were forward ACAATCACTCCTTAAATATGGTGG and reverse AAGTAGGGACAGACAGGACCAGTA, generating a fragment of 266 bp. PCR products were digested with 3 U TaqI (Helena Biotech) for 4 hours at 65°C and analyzed using the microtiter array diagonal gel electrophoresis system.24

Statistical Analysis
Association between PPAR{alpha} genotype and variables was analyzed using SPSS 6.1 statistical package and SAS 6.12 statistical software. Allele frequencies were determined by the gene-counting method. The effect of PPAR{alpha} genotype at baseline and after training characteristics in BigHeart 2 was examined by ANOVA and multiple linear regression. The effect of intron 7 genotype in the Third MONICA Augsburg study was investigated by multiple linear regression with age, body mass index (BMI), sex (where necessary), systolic blood pressure, and antihypertensive medication in the models.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
The intron 7 polymorphism, originally reported as a TaqI RFLP,25 was found by direct sequencing to be a G to C transversion at nt 2528 of intron 7 of the PPAR{alpha} gene.

Effects in Response to Exercise
Intron 7 and L162V genotypes were determined in 144 young healthy male white British Army recruits, randomized to receive either low-dose Losartan or placebo. Losartan treatment did not affect LV growth.22 Intron 7 C allele frequency was 0.181 (95%CI, 0.136 to 0.225), V162 allele frequency was 0.074 (95% CI, 0.043 to 0.105), and genotype distributions were in Hardy-Weinberg equilibrium (Table 1). At baseline, age, weight, BMI, systolic and diastolic blood pressure, and measures of heart size were not significantly different between genotypes (not shown). With 10 weeks of an intense training program, LV mass determined by cardiac magnetic resonance increased significantly by 8.6±1.2 g (P<0.0001). This increase in LV mass was significantly influenced by intron 7 genotype (P=0.009), being modest among those of GG genotype (6.7±1.5 g), significantly greater in heterozygotes for the C allele (11.8±1.9 g), and 3-fold greater in CC homozygotes (19.4±4.2 g) (Figure 1A). These effects remained significant when LV mass was adjusted for body surface area (P=0.02) or lean mass (P=0.03), and there was no interaction between effect of genotype and losartan treatment. PPAR{alpha} genotype did not significantly influence change in left and right ventricle volume measures (data not shown). PPAR{alpha} L162V genotype alone did not influence change in LV mass (LeuLeu, 8.9±1.4 g; LeuVal, 6.7±2.7 g; P=0.54), but the V162 allele attenuated the hypertrophic effect of the intron 7 C allele when examined in combination with the intron 7 polymorphism (intron 7, P=0.07; L162V, P=0.08; combined, P=0.05) (Figure 1B). Given that participants were selected for homozygosity for the ACE gene I/D polymorphism,22 we also examined for interaction between the ACE I/D and PPAR{alpha} intron 7 genotypes. This analysis revealed that the ACE I/D and PPAR{alpha} intron 7 genotypes had an independent effect on change in LV mass (ACE, P=0.003; PPAR{alpha}, P=0.026). Subjects of II/GG genotype exhibited the lowest cardiac growth, whereas the individuals of DD/CC genotype exhibited the greatest exercise-related growth (Figure 1C). In a multiple regression model including all 3 genotypes determined, the effect on change in LV mass is calculated as +7.47±2.37 g for ACE DD, +5.06±2.80 g for carriers of the intron 7 C allele, +15.61±6.45g for intron 7 C allele homozygotes, and -6.2±3.74g for carriers of the V162 allele compared with ACE II, PPAR{alpha} L162V LL, and intron 7 GG genotypes. Total variance in LV growth attributable to ACE I/D genotype was 8% (P=0.002), PPAR{alpha} intron 7 genotype was 6% (P=0.026), and PPAR{alpha} L162V genotype was 2.2% (P=0.1).


View this table:
[in this window]
[in a new window]
 
Table 1. Baseline Characteristics of Sample Populations



View larger version (24K):
[in this window]
[in a new window]
 
Figure 1. PPAR{alpha} genotype influences increase in LV mass in response to exercise training. a, Intron 7 genotype influences cardiac growth response, and L162V genotype has no effect on cardiac growth. b, L162V genotype modifies effect of intron 7 genotype. L162 allele homozygotes are depicted as unfilled bars (LL); V162 allele carriers are depicted as filled bars (LV). c, ACE I/D genotype shows additive effects with PPAR{alpha} intron 7 genotype. II allele homozygotes are depicted as unfilled bars (II); DD allele homozygotes are depicted as filled bars (DD). Numbers in each group are indicated in parentheses.

Effects in Response to Hypertension
To examine whether PPAR{alpha} influences LV growth in response to pathophysiological stimuli, L162V and intron 7 genotype was determined in 578 men and 564 women participating in the echocardiographic substudy of the third MONICA Augsburg survey.23 V162 allele frequency was 0.065 (95% CI, 0.055 to 0.075) and intron 7 C allele frequency was 0.179 (95% CI, 0.163 to 0.195), and the V162 and intron 7 C alleles showed significant allelic association. Both polymorphisms were in Hardy-Weinberg equilibrium.

There was no difference in age, BMI, or plasma lipid measures between L162V or intron 7 genotypes (data not shown). Systolic blood pressure was on average 6.8 mm Hg lower in male intron 7 C allele homozygotes than G allele homozygotes or C allele carriers (P=0.13) (Table 2). In multivariate regression analysis including age, antihypertensive medication, BMI, and systolic blood pressure, intron 7 genotype was significantly associated with left ventricular mass indexed to body surface area (LVMI) in men, with women showing a similar but nonsignificant trend. Male G allele homozygotes had an LVMI of 91.8±1.0, C allele carriers had an LVMI of 92.2±1.3 g/m2, whereas C allele homozygotes had 15% greater mean LVMI of 105.7±4.8 g/m2 (P=0.005). Female G allele homozygotes had an LVMI of 79.0±0.7 g/m2, C allele carriers had an LVMI of 78.7±1.2 g/m2, whereas C allele homozygotes had 7% higher LVMI of 84.6±3.8 g/m2 (P=0.14). Similar effects were observed on septum and posterior wall measurements in men, and in women posterior wall diameter was significantly greater in C allele homozygotes than in homozygotes or carriers of the C allele, although septal wall thickness was similar between genotypes in women (Table 2). In the entire sample, with men and women combined, the hypertrophic effect of the CC genotype was highly significant for LVMI (CC 95.2±3.2 g/m2 versus GG+GC 84.8±0.5 g/m2, P=0.001), posterior wall (CC 9.43±0.21 mm versus GG+GC 8.66±0.03 mm, P=0.0002), and septum (CC 11.26±0.29 mm versus GG+GC 10.50±0.04 mm, P=0.009).


View this table:
[in this window]
[in a new window]
 
Table 2. LV Mass and Blood Pressure Measurements in the Third MONICA Augsburg Study by PPAR{alpha} Intron 7 Genotype

Interestingly, the effect of PPAR{alpha} intron 7 genotype on LVMI was exacerbated in hypertensive individuals (n=319) (Figure 2). In normotensive individuals, C allele homozygotes had an LVMI of 87.3±3.2 g/m2 (P=0.04 versus GG homozygotes) compared with 80.5±0.6 g/m2 in G allele homozygotes and 81.2±0.9 g/m2 in C allele carriers (overall effect of genotype, P=0.07) (Figure 2A). Hypertensive C allele homozygotes had a significantly greater LVMI of 114.6±7.0 g/m2 compared with 99.0±1.5 g/m2 for G allele homozygotes (P=0.03 CC versus GG) and 97.7±2.2 g/m2 in C allele carriers (P=0.02) (Figure 2B). Male C allele homozygotes were 4 times more likely to have clinically defined LVH than G allele homozygotes or C allele carriers (0.20 versus 0.05, P=0.03), an effect not observed in females (0.13 versus 0.10, P=0.89) (Figure 3). L162V genotype had no effect on LV measures (data not shown). No effect was observed on left ventricle end-diastolic dimensions, left atrial diameter, and aortic root diameter for either PPAR{alpha} genotype (data not shown).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 2. Effect of PPAR{alpha} intron 7 genotype on LVMI in normotensive and hypertensive individuals.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. PPAR{alpha} intron 7 genotype increases risk of clinically defined LVH.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
PPAR{alpha} plays a key role in the regulation of cardiac FA uptake and oxidation and may be the mediator, at least in part, of the metabolic switch from FA to glucose during hypertrophy. It is conceivable that PPAR{alpha} could influence cardiac growth through the modulation of cardiac FAO. The data presented support this notion, because they demonstrate that common variation in the PPAR{alpha} gene influences human LV growth in response to exercise and hypertension, 2 distinct stimuli that influence LVH. There is a growing body of evidence that appropriate substrate use is critical for cardiac function. Defects in FAO enzymes cause childhood cardiomyopathies,9 and pharmacological inhibition of cardiac FA import induces cardiac hypertrophy26 and causes rapid death in PPAR{alpha}-knockout mice.20 Transgenic mice that overexpress long-chain acyl-CoA synthetase and take up excess long chain fatty acids initially exhibit cardiac hypertrophy, followed by LV dysfunction and death.11 These data clearly show that appropriate regulation of cardiac substrate use is essential for normal cardiac function.

Exercise-induced LV growth in healthy young men was strongly influenced by the intron 7 polymorphism of the PPAR{alpha} gene, an effect modulated by the L162V polymorphism. Individuals homozygous for the C allele had a 3-fold greater and heterozygotes had a 2-fold greater increase in LV mass than G allele homozygotes. The additive effect of the PPAR{alpha} intron 7 and ACE I/D polymorphisms indicates that these hypertrophic pathways act independently. Thus, PPAR{alpha} is a regulator of LV growth in response to an intense short-term physiological stimulus.

The PPAR{alpha} intron 7 polymorphism was also associated with left ventricular mass and the presence of clinically defined LVH in a population-based sample of the third MONICA Augsburg survey. The effect on left ventricular mass was much stronger in men, although women showed a similar nonsignificant trend, and was significant in the whole population when men and women were combined. The hypertrophic effect of the intron 7 C allele was {approx}2-fold greater in hypertensive than normotensive subjects, indicating that PPAR{alpha} influences the degree of LV growth in response to hypertension but also influences growth in the absence of an obvious stimulus. The hypertrophic effect of the intron 7 C allele is not mediated through raised systolic blood pressure, because intron 7 C allele homozygotes have lower systolic blood pressure than G allele homozygotes or C allele carriers. In contrast to exercise-induced hypertrophy, in which an intermediate effect on change in LV mass was observed in GC heterozygotes, the hypertrophic effect of the intron 7 polymorphism was restricted to C allele homozygotes, with heterozygotes having virtually identical LV measures to G allele homozygotes. The L162V polymorphism did not influence LV measures in the Third MONICA Augsburg study. We hypothesize that these differences are attributable to the contrasting nature of a strong short-term exercise stimulus and the low-level long-term stimulus of hypertension. These data clearly demonstrate that PPAR{alpha} plays an important role in the regulation of LV growth in response to both exercise and blood pressure stimuli, thus identifying a novel pathway for the regulation of cardiac growth. The genetic contribution to total variance in LV mass is estimated at >60% in early pubertal children,5 whereas heritability of LV mass was estimated at 0.24 to 0.32 in adults in the Framingham Study.27 In the army study, PPAR{alpha} intron 7 and L162V genotypes explained 6% and 2.2% of total variance in change in LV mass in the study, whereas the ACE I/D genotype was responsible for an additional 8% of variance.

The sexually dimorphic effect on cardiac growth of PPAR{alpha} polymorphisms parallels effects observed in PPAR{alpha}-knockout mice. Male PPAR{alpha}-knockout mice treated with etomoxir, an inhibitor of mitochondrial LCFA import, show massive hepatic and cardiac lipid accumulation and hypoglycemia, and all die after 4 days of treatment, whereas mortality is only 25% in females. The female mice that died also had severe hypoglycemia, and male mice exhibiting lethargy recovered on dextrose injection, indicating that severe hypoglycemia may be directly responsible for death. Male mice pretreated with estradiol were protected from the ill effects of etomoxir.20 Aging male PPAR{alpha}-knockout mice also exhibit hepatic steatohepatitis, whereas females show late-onset obesity and hypertriglyceridemia.28

The mechanism by which the intron 7 polymorphism affects PPAR{alpha} function remains unclear. The intron 7 C allele is in allelic association with the V162 allele, which encodes a more transcriptionally active PPAR{alpha}21 and attenuates the effect of the intron 7 C allele on exercise-induced LVH. We speculate that the intron 7 polymorphism is in allelic association with an unidentified variant in a regulatory region of the PPAR{alpha} gene that affects PPAR{alpha} levels, which in turn affect transcriptional activation of PPAR{alpha} target genes. Efforts to examine the effect of intron 7 genotype on PPAR{alpha} mRNA levels and to identify functional promoter variants are presently underway.

In summary, these data constitute strong evidence that PPAR{alpha} regulates left ventricular growth in response to exercise and hypertension stimuli and illustrate the important role of cardiac fatty acid metabolism in cardiac growth. These data may have therapeutic implications for patients with LVH. Stimulation of FAO by PPAR{alpha} activation with fibrates may prove a useful therapeutic strategy for treatment of a subset of patients with LVH.


*    Acknowledgments
 
This work was supported by the British Heart Foundation (grant No. FS 98058 to Y. Jamshidi, FS 97030 to S. Myerson, SP 98003 to Dr Montgomery, and RG 95007 to S.E. Humphries), Deutsche Forschungsgemeinschaft (DFG Schu672/9-1, Schu672/10-1, and Schu672/12-1), Bundesministerium für Forschung und Technologie, Wilhelm-Vaillant-Stiftung, Deutsche Stiftung für Herzforschung, and Ernst-und-Berta-Grimmke-Stiftung (to Dr Schunkert, J. Erdmann, Dr Hengstenberg, and Dr Hense). I.P. Torra is supported by a European Community grant (ERBFMBICT983214), and B. Staels is supported by grants of the Institut Pasteur de Lille and INSERM. We thank Stefan Mitsching and Krause for technical support.


*    Footnotes
 
Dr Daniel P. Kelly has written an editorial for this article, and it will be published in the March 5, 2002, issue of Circulation.

Received November 29, 2001; revision received December 18, 2001; accepted December 21, 2001.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Savage DD, Levy D, Dannenberg AL, et al. Association of echocardiographic left ventricular mass with body size, blood pressure and physical activity (the Framingham Study). Am J Cardiol. 1990; 65: 371–376.

2. Marian AJ, Roberts R. The molecular genetic basis for hypertrophic cardiomyopathy. J Mol Cell Cardiol. 2001; 33: 655–670.

3. Casale PN, Devereux RB, Milner M, et al. Value of echocardiographic measurement of left ventricular mass in predicting cardiovascular morbid events in hypertensive men. Ann Intern Med. 1986; 105: 173–178.

4. Levy D, Garrison RJ, Savage DD, et al. Left ventricular mass and incidence of coronary heart disease in an elderly cohort: the Framingham Heart Study. Ann Intern Med. 1989; 110: 101–107.

5. Verhaaren HA, Schieken RM, Mosteller M, et al. Bivariate genetic analysis of left ventricular mass and weight in pubertal twins (the Medical College of Virginia twin study). Am J Cardiol. 1991; 68: 661–668.

6. Devereux RB, Roman MJ, de Simone G, et al. Relations of left ventricular mass to demographic and hemodynamic variables in American Indians: the Strong Heart Study. Circulation. 1997; 96: 1416–1423.

7. Schunkert H, Brockel U, Hengstenberg C, et al. Familial predisposition of left ventricular hypertrophy. J Am Coll Cardiol. 1999; 33: 1685–1691.

8. Sack MN, Rader TA, Park S, et al. Fatty acid oxidation enzyme gene expression is downregulated in the failing heart. Circulation. 1996; 94: 2837–2842.

9. Kelly DP, Strauss AW. Inherited cardiomyopathies. N Engl J Med. 1994; 330: 913–919.

10. Binas B, Danneberg H, McWhir J, et al. Requirement for the heart-type fatty acid binding protein in cardiac fatty acid utilization. FASEB J. 1999; 13: 805–812.

11. Chiu HC, Kovacs A, Ford DA, et al. A novel mouse model of lipotoxic cardiomyopathy. J Clin Invest. 2001; 107: 813–822.

12. Issemann I, Green S. Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature. 1990; 347: 645–650.

13. Fruchart J-C, Duriez P, Staels B. Peroxisome proliferator-activated receptor-alpha activators regulate genes governing lipoprotein metabolism, vascular inflammation and atherosclerosis. Curr Opin Lipidol. 1999; 10: 245–257.

14. Murakami K, Ide T, Suzuki M, et al. Evidence for direct binding of fatty acids and eicosanoids to human peroxisome proliferators-activated receptor {alpha}. Biochem Biophys Res Commun. 1999; 260: 609–613.

15. Krey G, Braissant O, L’Horset F, et al. Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by coactivator-dependent receptor ligand assay. Mol Endocrinol. 1997; 11: 779–791.

16. Auboeuf D, Rieusset J, Fajas L, et al. Tissue distribution and quantification of the expression of mRNAs of peroxisome proliferator-activated receptors and liver X receptor-alpha in humans: no alteration in adipose tissue of obese and NIDDM patients. Diabetes. 1997; 46: 1319–1327.

17. Djouadi F, Brandt JM, Weinheimer CJ, et al. The role of the peroxisome proliferator-activated receptor {alpha} (PPAR {alpha}) in the control of cardiac lipid metabolism. Prostaglandins Leukot Essent Fatty Acids. 1999; 60: 339–343.

18. Barger PM, Brandt JM, Leone TC, et al. Deactivation of peroxisome proliferator-activated receptor-{alpha} during cardiac hypertrophic growth. J Clin Invest. 2000; 105: 1723–1730.

19. Watanabe K, Fujii H, Takahashi T, et al. Constitutive regulation of cardiac fatty acid metabolism through peroxisome proliferator-activated receptor {alpha} associated with age-dependent cardiac toxicity. J Biol Chem. 2000; 275: 22293–22299.

20. Djouadi F, Weinheimer CJ, Saffitz JE, et al. A gender-related defect in lipid metabolism and glucose homeostasis in peroxisome proliferator-activated receptor {alpha}-deficient mice. J Clin Invest. 1998; 102: 1083–1091.

21. Flavell DM, Pineda Torra I, Jamshidi Y, et al. Variation in the PPAR{alpha} gene is associated with altered function in vitro and plasma lipid concentrations in type II diabetic subjects. Diabetologia. 2000; 43: 673–680.

22. Myerson SG, Montgomery HE, Whittingham M, et al. Left ventricular hypertrophy with exercise and the angiotensin converting enzyme gene I/D polymorphism: a randomised controlled trial with losartan. Circulation. 2001; 103: 226–230.

23. Schunkert H, Hengstenberg C, Holmer SR, et al. Lack of association between a polymorphism of the aldosterone synthase gene and left ventricular structure. Circulation. 1999; 99: 2255–2260.

24. Day IN, Humphries SE. Electrophoresis for genotyping: microtiter array diagonal gel electrophoresis on horizontal polyacrylamide gels, hydrolink, or agarose. Anal Biochem. 1994; 222: 389–395.

25. Sher T, Yi HF, McBride OW, et al. cDNA cloning, chromosomal mapping, and functional characterization of the human peroxisome proliferator activated receptor. Biochemistry. 1993; 32: 5598–5604.

26. Litwin SE, Raya TE, Gay RG, et al. Chronic inhibition of fatty acid oxidation: new model of diastolic dysfunction. Am J Physiol. 1990; 258: H51–H56.

27. Post WS, Larson MG, Myers RH, et al. Heritability of left ventricular mass: the Framingham Heart Study. Hypertension. 1997; 30: 1025–1028.

28. Costet P, Legendre C, More J, et al. Peroxisome proliferator-activated receptor alpha-isoform deficiency leads to progressive dyslipidemia with sexually dimorphic obesity and steatosis. J Biol Chem. 1998; 273: 29577–29585.




This article has been cited by other articles:


Home page
JAMAHome page
R. S. Vasan, N. L. Glazer, J. F. Felix, W. Lieb, P. S. Wild, S. B Felix, N. Watzinger, M. G. Larson, N. L. Smith, A. Dehghan, et al.
Genetic Variants Associated With Cardiac Structure and Function: A Meta-analysis and Replication of Genome-wide Association Data
JAMA, July 8, 2009; 302(2): 168 - 178.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
R. Takahashi, T. Asai, H. Murakami, R. Murakami, M. Tsuzuki, Y. Numaguchi, H. Matsui, T. Murohara, and K. Okumura
Pressure Overload-Induced Cardiomyopathy in Heterozygous Carrier Mice of Carnitine Transporter Gene Mutation
Hypertension, September 1, 2007; 50(3): 497 - 502.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
T. Tanaka, J. M. Ordovas, J. Delgado-Lista, F. Perez-Jimenez, C. Marin, P. Perez-Martinez, P. Gomez, and J. Lopez-Miranda
Peroxisome proliferator-activated receptor {alpha} polymorphisms and postprandial lipemia in healthy men
J. Lipid Res., June 1, 2007; 48(6): 1402 - 1408.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
A. J. Gilde, J.-C. Fruchart, and B. Staels
Peroxisome Proliferator-Activated Receptors at the Crossroads of Obesity, Diabetes, and Cardiovascular Disease
J. Am. Coll. Cardiol., October 27, 2006; 48(9_Suppl_A): A24 - A32.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. E. Morgan, J. H. Rennison, M. E. Young, T. A. McElfresh, T. A. Kung, K.-Y. Tserng, B. D. Hoit, W. C. Stanley, and M. P. Chandler
Effects of chronic activation of peroxisome proliferator-activated receptor-{alpha} or high-fat feeding in a rat infarct model of heart failure
Am J Physiol Heart Circ Physiol, May 1, 2006; 290(5): H1899 - H1904.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Planavila, R. Rodriguez-Calvo, M. Jove, L. Michalik, W. Wahli, J. C. Laguna, and M. Vazquez-Carrera
Peroxisome proliferator-activated receptor {beta}/{delta} activation inhibits hypertrophy in neonatal rat cardiomyocytes
Cardiovasc Res, March 1, 2005; 65(4): 832 - 841.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
D. M. Flavell, H. Ireland, J. W. Stephens, E. Hawe, J. Acharya, H. Mather, S. J. Hurel, and S. E. Humphries
Peroxisome Proliferator-Activated Receptor {alpha} Gene Variation Influences Age of Onset and Progression of Type 2 Diabetes
Diabetes, February 1, 2005; 54(2): 582 - 586.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. M. Huss and D. P. Kelly
Nuclear Receptor Signaling and Cardiac Energetics
Circ. Res., September 17, 2004; 95(6): 568 - 578.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. E Hardt and J. Sadoshima
Negative regulators of cardiac hypertrophy
Cardiovasc Res, August 15, 2004; 63(3): 500 - 509.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. Alfakih, A. Maqbool, M. Sivananthan, K. Walters, G. Bainbridge, J. Ridgway, A. J. Balmforth, and A. S. Hall
Left Ventricle Mass Index and the Common, Functional, X-Linked Angiotensin II Type-2 Receptor Gene Polymorphism (-1332 G/A) in Patients With Systemic Hypertension
Hypertension, June 1, 2004; 43(6): 1189 - 1194.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. Marx, H. Duez, J.-C. Fruchart, and B. Staels
Peroxisome Proliferator-Activated Receptors and Atherogenesis: Regulators of Gene Expression in Vascular Cells
Circ. Res., May 14, 2004; 94(9): 1168 - 1178.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
N. Frey, H. A. Katus, E. N. Olson, and J. A. Hill
Hypertrophy of the Heart: A New Therapeutic Target?
Circulation, April 6, 2004; 109(13): 1580 - 1589.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F. Liang, F. Wang, S. Zhang, and D. G. Gardner
Peroxisome Proliferator Activated Receptor (PPAR){alpha} Agonists Inhibit Hypertrophy of Neonatal Rat Cardiac Myocytes
Endocrinology, September 1, 2003; 144(9): 4187 - 4194.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. Lipsanen-Nyman, J. Perheentupa, J. Rapola, A. Sovijarvi, and M. Kupari
Mulibrey Heart Disease: Clinical Manifestations, Long-Term Course, and Results of Pericardiectomy in a Series of 49 Patients Born Before 1985
Circulation, June 10, 2003; 107(22): 2810 - 2815.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
L. de las Fuentes, P. Herrero, L. R. Peterson, D. P. Kelly, R. J. Gropler, and V. G. Davila-Roman
Myocardial Fatty Acid Metabolism: Independent Predictor of Left Ventricular Mass in Hypertensive Heart Disease
Hypertension, January 1, 2003; 41(1): 83 - 87.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart JHome page
H. Schunkert and M. Fischer
Old and simple tools may do better--sometimes
Eur. Heart J., December 2, 2002; 23(24): 1900 - 1902.
[PDF]


Home page
CirculationHome page
P. Razeghi, M. E. Young, T. C. Cockrill, O. H. Frazier, and H. Taegtmeyer
Downregulation of Myocardial Myocyte Enhancer Factor 2C and Myocyte Enhancer Factor 2C-Regulated Gene Expression in Diabetic Patients With Nonischemic Heart Failure
Circulation, July 23, 2002; 106(4): 407 - 411.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
N. Frey and E. N. Olson
Modulating Cardiac Hypertrophy by Manipulating Myocardial Lipid Metabolism?
Circulation, March 12, 2002; 105(10): 1152 - 1154.
[Full Text] [PDF]


Home page
CirculationHome page
D. P. Kelly
Peroxisome Proliferator-Activated Receptor {alpha} as a Genetic Determinant of Cardiac Hypertrophic Growth: Culprit or Innocent Bystander?
Circulation, March 5, 2002; 105(9): 1025 - 1027.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
105/8/950    most recent
hc0802.104535v2
hc0802.104535v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jamshidi, Y.
Right arrow Articles by Flavell, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jamshidi, Y.
Right arrow Articles by Flavell, D. M.
Related Collections
Right arrow Clinical genetics
Right arrow Energy metabolism
Right arrow Gene regulation
Right arrow Hypertrophy
Right arrow Clinical Studies
Right arrow Exercise/exercise testing/rehabilitation
Right arrow CT and MRI