| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
(Circulation. 2002;105:950.)
© 2002 American Heart Association, Inc.
Clinical Investigation and Reports |
Gene Regulates Left Ventricular Growth in Response to Exercise and Hypertension
From the Centre for Cardiovascular Genetics, Department of Medicine (Y.J., H.E.M., S.G.M., S.E.H.), University College London Medical School, London, UK; Institut fur Epidemiologie und Sozialmedizin (H.-W. H.), University of Munster, Germany; U.325 INSERM, Département dAthérosclérose, Institut Pasteur and Faculté de Pharmacie (I.P.T., B.S.), Université de Lille II, Lille, France; Royal Defence Medical College (M.W.), Gosport, Hampshire, UK; GSF-Forschungszentrum (A.D.), Institut fuer Epidemiologie, Neuherberg, Germany; and Klinik und Poliklinik fur Innere Medizin II (J.E., C.H., H.S.), University of Regensburg, Germany.
Correspondence to Dr David M. Flavell, Centre for Cardiovascular Genetics, Department of Medicine, University College London Medical School, Rayne Building, 5 University St, London, WC1E 6JJ UK. E-mail rmhadfl{at}ucl.ac.uk
| Abstract |
|---|
|
|
|---|
(PPAR
) regulates genes responsible for myocardial fatty acid oxidation and is downregulated during cardiac hypertrophy, concomitant with the switch from fatty acid to glucose utilization.
Methods and Results The role of PPAR
in left ventricular growth was investigated in 144 young male British Army recruits undergoing a 10-week physical training program and in 1148 men and women participating in the echocardiographic substudy of the Third Monitoring Trends and Determinants in Cardiovascular Disease (MONICA) Augsburg study. A G/C polymorphism in intron 7 of the PPAR
gene significantly influenced left ventricular (LV) growth in response to exercise (P=0.009). LV mass increased by 6.7±1.5 g in G allele homozygotes but was significantly greater in heterozygotes for the C allele (11.8±1.9 g) and in CC homozygotes (19.4±4.2 g). Likewise, C allele homozygotes had significantly higher LV mass, which was greater still in hypertensive subjects, and a higher prevalence of LVH in the Third MONICA Augsburg study.
Conclusions We demonstrate that variation in the PPAR
gene influences human left ventricular growth in response to exercise and hypertension, indicating that maladaptive cardiac substrate utilization can play a causative role in the pathogenesis of LVH.
Key Words: genetics hypertrophy exercise hypertension fatty acids
| Introduction |
|---|
|
|
|---|
An important molecular adaptation in the hypertrophied heart is the increase in glucose utilization and decrease in fatty acid oxidation (FAO) attributable to downregulation of FAO enzyme mRNA levels.8 Defects in mitochondrial FAO enzymes cause childhood hypertrophic cardiomyopathy,9 and perturbation of FAO in animal models causes cardiac hypertrophy,10,11 indicating that substrate utilization is important in the pathogenesis of hypertrophy. Peroxisome proliferatoractivated receptor
(PPAR
) is a ligand-activated transcription factor12 that regulates the expression of genes involved in fatty acid (FA) uptake and oxidation, lipid metabolism, and inflammation.13 Ligands for PPAR
include long-chain fatty acids14 and the fibrate class of lipid-lowering drugs.15 PPAR
is expressed at high levels in tissues that catabolize FA, such as the liver, skeletal muscle, and heart.16 PPAR
regulates the expression of cardiac mitochondrial FAO enzymes17 and is downregulated during cardiac hypertrophy in vitro and in vivo, leading to reduced FAO and impaired cellular lipid homeostasis.18 PPAR
-knockout mice have markedly reduced FAO and exhibit cardiac lipid accumulation and fibrosis19 and die on inhibition of mitochondrial fatty acid uptake.20
The influence of PPAR
on cardiac growth was examined using the previously described functional leucine 162 valine (L162V) variant21 and a novel G/C polymorphism in intron 7 of the human PPAR
gene. In particular, the role of PPAR
in the physiological left ventricular hypertrophic response to exercise was examined in 144 young male British Army recruits undergoing an intense 10-week physical training program.22 The role of PPAR
in the pathophysiological response to hypertension was investigated in a population-based sample of 1148 German men and women participating in the Third Monitoring Trends and Determinants in Cardiovascular Disease (MONICA) Augsburg survey.23
| Methods |
|---|
|
|
|---|
The echocardiographic substudy of the third MONICA Augsburg survey has been previously described.23 Subjects originate from a sex- and age-stratified random sample of all German residents of the Augsburg study area aged 25 to 74 years. Hypertension was defined as systolic blood pressure
160 mm Hg or diastolic blood pressure
95 mm Hg or intake of antihypertensive medication during the 7 days preceding the examination. A 2-dimensionally guided M-mode echocardiogram was performed on each subject. Structures for M-modeguided calculation of LVM were measured according to the guidelines of the American Society of Echocardiography, and LVM was calculated and indexed to body surface area as LVM index in g/m2 of body surface area. LVH was defined when LVM index was >134 g/m2 body surface area in men or >110 g/m2 body surface area in women.
Genotype Determination
Genotyping was carried out by polymerase chain reaction (PCR) and restriction enzyme digestion. PPAR
L162V and ACE I/D genotyping was performed as previously described.21,22 Intron 7 genotyping was performed in NH3 buffer (16 mmol/L [NH4]2SO4, 67 mmol/L TRIS, pH 8.4, 0.01% Tween 20, 0.02 mmol/L each dNTP), 2 mmol/L MgCl2, 8 pmol each primer, and 0.2 U Taq polymerase. PCR primers were forward ACAATCACTCCTTAAATATGGTGG and reverse AAGTAGGGACAGACAGGACCAGTA, generating a fragment of 266 bp. PCR products were digested with 3 U TaqI (Helena Biotech) for 4 hours at 65°C and analyzed using the microtiter array diagonal gel electrophoresis system.24
Statistical Analysis
Association between PPAR
genotype and variables was analyzed using SPSS 6.1 statistical package and SAS 6.12 statistical software. Allele frequencies were determined by the gene-counting method. The effect of PPAR
genotype at baseline and after training characteristics in BigHeart 2 was examined by ANOVA and multiple linear regression. The effect of intron 7 genotype in the Third MONICA Augsburg study was investigated by multiple linear regression with age, body mass index (BMI), sex (where necessary), systolic blood pressure, and antihypertensive medication in the models.
| Results |
|---|
|
|
|---|
gene.
Effects in Response to Exercise
Intron 7 and L162V genotypes were determined in 144 young healthy male white British Army recruits, randomized to receive either low-dose Losartan or placebo. Losartan treatment did not affect LV growth.22 Intron 7 C allele frequency was 0.181 (95%CI, 0.136 to 0.225), V162 allele frequency was 0.074 (95% CI, 0.043 to 0.105), and genotype distributions were in Hardy-Weinberg equilibrium (Table 1). At baseline, age, weight, BMI, systolic and diastolic blood pressure, and measures of heart size were not significantly different between genotypes (not shown). With 10 weeks of an intense training program, LV mass determined by cardiac magnetic resonance increased significantly by 8.6±1.2 g (P<0.0001). This increase in LV mass was significantly influenced by intron 7 genotype (P=0.009), being modest among those of GG genotype (6.7±1.5 g), significantly greater in heterozygotes for the C allele (11.8±1.9 g), and 3-fold greater in CC homozygotes (19.4±4.2 g) (Figure 1A). These effects remained significant when LV mass was adjusted for body surface area (P=0.02) or lean mass (P=0.03), and there was no interaction between effect of genotype and losartan treatment. PPAR
genotype did not significantly influence change in left and right ventricle volume measures (data not shown). PPAR
L162V genotype alone did not influence change in LV mass (LeuLeu, 8.9±1.4 g; LeuVal, 6.7±2.7 g; P=0.54), but the V162 allele attenuated the hypertrophic effect of the intron 7 C allele when examined in combination with the intron 7 polymorphism (intron 7, P=0.07; L162V, P=0.08; combined, P=0.05) (Figure 1B). Given that participants were selected for homozygosity for the ACE gene I/D polymorphism,22 we also examined for interaction between the ACE I/D and PPAR
intron 7 genotypes. This analysis revealed that the ACE I/D and PPAR
intron 7 genotypes had an independent effect on change in LV mass (ACE, P=0.003; PPAR
, P=0.026). Subjects of II/GG genotype exhibited the lowest cardiac growth, whereas the individuals of DD/CC genotype exhibited the greatest exercise-related growth (Figure 1C). In a multiple regression model including all 3 genotypes determined, the effect on change in LV mass is calculated as +7.47±2.37 g for ACE DD, +5.06±2.80 g for carriers of the intron 7 C allele, +15.61±6.45g for intron 7 C allele homozygotes, and -6.2±3.74g for carriers of the V162 allele compared with ACE II, PPAR
L162V LL, and intron 7 GG genotypes. Total variance in LV growth attributable to ACE I/D genotype was 8% (P=0.002), PPAR
intron 7 genotype was 6% (P=0.026), and PPAR
L162V genotype was 2.2% (P=0.1).
|
|
Effects in Response to Hypertension
To examine whether PPAR
influences LV growth in response to pathophysiological stimuli, L162V and intron 7 genotype was determined in 578 men and 564 women participating in the echocardiographic substudy of the third MONICA Augsburg survey.23 V162 allele frequency was 0.065 (95% CI, 0.055 to 0.075) and intron 7 C allele frequency was 0.179 (95% CI, 0.163 to 0.195), and the V162 and intron 7 C alleles showed significant allelic association. Both polymorphisms were in Hardy-Weinberg equilibrium.
There was no difference in age, BMI, or plasma lipid measures between L162V or intron 7 genotypes (data not shown). Systolic blood pressure was on average 6.8 mm Hg lower in male intron 7 C allele homozygotes than G allele homozygotes or C allele carriers (P=0.13) (Table 2). In multivariate regression analysis including age, antihypertensive medication, BMI, and systolic blood pressure, intron 7 genotype was significantly associated with left ventricular mass indexed to body surface area (LVMI) in men, with women showing a similar but nonsignificant trend. Male G allele homozygotes had an LVMI of 91.8±1.0, C allele carriers had an LVMI of 92.2±1.3 g/m2, whereas C allele homozygotes had 15% greater mean LVMI of 105.7±4.8 g/m2 (P=0.005). Female G allele homozygotes had an LVMI of 79.0±0.7 g/m2, C allele carriers had an LVMI of 78.7±1.2 g/m2, whereas C allele homozygotes had 7% higher LVMI of 84.6±3.8 g/m2 (P=0.14). Similar effects were observed on septum and posterior wall measurements in men, and in women posterior wall diameter was significantly greater in C allele homozygotes than in homozygotes or carriers of the C allele, although septal wall thickness was similar between genotypes in women (Table 2). In the entire sample, with men and women combined, the hypertrophic effect of the CC genotype was highly significant for LVMI (CC 95.2±3.2 g/m2 versus GG+GC 84.8±0.5 g/m2, P=0.001), posterior wall (CC 9.43±0.21 mm versus GG+GC 8.66±0.03 mm, P=0.0002), and septum (CC 11.26±0.29 mm versus GG+GC 10.50±0.04 mm, P=0.009).
|
Interestingly, the effect of PPAR
intron 7 genotype on LVMI was exacerbated in hypertensive individuals (n=319) (Figure 2). In normotensive individuals, C allele homozygotes had an LVMI of 87.3±3.2 g/m2 (P=0.04 versus GG homozygotes) compared with 80.5±0.6 g/m2 in G allele homozygotes and 81.2±0.9 g/m2 in C allele carriers (overall effect of genotype, P=0.07) (Figure 2A). Hypertensive C allele homozygotes had a significantly greater LVMI of 114.6±7.0 g/m2 compared with 99.0±1.5 g/m2 for G allele homozygotes (P=0.03 CC versus GG) and 97.7±2.2 g/m2 in C allele carriers (P=0.02) (Figure 2B). Male C allele homozygotes were 4 times more likely to have clinically defined LVH than G allele homozygotes or C allele carriers (0.20 versus 0.05, P=0.03), an effect not observed in females (0.13 versus 0.10, P=0.89) (Figure 3). L162V genotype had no effect on LV measures (data not shown). No effect was observed on left ventricle end-diastolic dimensions, left atrial diameter, and aortic root diameter for either PPAR
genotype (data not shown).
|
|
| Discussion |
|---|
|
|
|---|
plays a key role in the regulation of cardiac FA uptake and oxidation and may be the mediator, at least in part, of the metabolic switch from FA to glucose during hypertrophy. It is conceivable that PPAR
could influence cardiac growth through the modulation of cardiac FAO. The data presented support this notion, because they demonstrate that common variation in the PPAR
gene influences human LV growth in response to exercise and hypertension, 2 distinct stimuli that influence LVH. There is a growing body of evidence that appropriate substrate use is critical for cardiac function. Defects in FAO enzymes cause childhood cardiomyopathies,9 and pharmacological inhibition of cardiac FA import induces cardiac hypertrophy26 and causes rapid death in PPAR
-knockout mice.20 Transgenic mice that overexpress long-chain acyl-CoA synthetase and take up excess long chain fatty acids initially exhibit cardiac hypertrophy, followed by LV dysfunction and death.11 These data clearly show that appropriate regulation of cardiac substrate use is essential for normal cardiac function.
Exercise-induced LV growth in healthy young men was strongly influenced by the intron 7 polymorphism of the PPAR
gene, an effect modulated by the L162V polymorphism. Individuals homozygous for the C allele had a 3-fold greater and heterozygotes had a 2-fold greater increase in LV mass than G allele homozygotes. The additive effect of the PPAR
intron 7 and ACE I/D polymorphisms indicates that these hypertrophic pathways act independently. Thus, PPAR
is a regulator of LV growth in response to an intense short-term physiological stimulus.
The PPAR
intron 7 polymorphism was also associated with left ventricular mass and the presence of clinically defined LVH in a population-based sample of the third MONICA Augsburg survey. The effect on left ventricular mass was much stronger in men, although women showed a similar nonsignificant trend, and was significant in the whole population when men and women were combined. The hypertrophic effect of the intron 7 C allele was
2-fold greater in hypertensive than normotensive subjects, indicating that PPAR
influences the degree of LV growth in response to hypertension but also influences growth in the absence of an obvious stimulus. The hypertrophic effect of the intron 7 C allele is not mediated through raised systolic blood pressure, because intron 7 C allele homozygotes have lower systolic blood pressure than G allele homozygotes or C allele carriers. In contrast to exercise-induced hypertrophy, in which an intermediate effect on change in LV mass was observed in GC heterozygotes, the hypertrophic effect of the intron 7 polymorphism was restricted to C allele homozygotes, with heterozygotes having virtually identical LV measures to G allele homozygotes. The L162V polymorphism did not influence LV measures in the Third MONICA Augsburg study. We hypothesize that these differences are attributable to the contrasting nature of a strong short-term exercise stimulus and the low-level long-term stimulus of hypertension. These data clearly demonstrate that PPAR
plays an important role in the regulation of LV growth in response to both exercise and blood pressure stimuli, thus identifying a novel pathway for the regulation of cardiac growth. The genetic contribution to total variance in LV mass is estimated at >60% in early pubertal children,5 whereas heritability of LV mass was estimated at 0.24 to 0.32 in adults in the Framingham Study.27 In the army study, PPAR
intron 7 and L162V genotypes explained 6% and 2.2% of total variance in change in LV mass in the study, whereas the ACE I/D genotype was responsible for an additional 8% of variance.
The sexually dimorphic effect on cardiac growth of PPAR
polymorphisms parallels effects observed in PPAR
-knockout mice. Male PPAR
-knockout mice treated with etomoxir, an inhibitor of mitochondrial LCFA import, show massive hepatic and cardiac lipid accumulation and hypoglycemia, and all die after 4 days of treatment, whereas mortality is only 25% in females. The female mice that died also had severe hypoglycemia, and male mice exhibiting lethargy recovered on dextrose injection, indicating that severe hypoglycemia may be directly responsible for death. Male mice pretreated with estradiol were protected from the ill effects of etomoxir.20 Aging male PPAR
-knockout mice also exhibit hepatic steatohepatitis, whereas females show late-onset obesity and hypertriglyceridemia.28
The mechanism by which the intron 7 polymorphism affects PPAR
function remains unclear. The intron 7 C allele is in allelic association with the V162 allele, which encodes a more transcriptionally active PPAR
21 and attenuates the effect of the intron 7 C allele on exercise-induced LVH. We speculate that the intron 7 polymorphism is in allelic association with an unidentified variant in a regulatory region of the PPAR
gene that affects PPAR
levels, which in turn affect transcriptional activation of PPAR
target genes. Efforts to examine the effect of intron 7 genotype on PPAR
mRNA levels and to identify functional promoter variants are presently underway.
In summary, these data constitute strong evidence that PPAR
regulates left ventricular growth in response to exercise and hypertension stimuli and illustrate the important role of cardiac fatty acid metabolism in cardiac growth. These data may have therapeutic implications for patients with LVH. Stimulation of FAO by PPAR
activation with fibrates may prove a useful therapeutic strategy for treatment of a subset of patients with LVH.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received November 29, 2001; revision received December 18, 2001; accepted December 21, 2001.
| References |
|---|
|
|
|---|
2. Marian AJ, Roberts R. The molecular genetic basis for hypertrophic cardiomyopathy. J Mol Cell Cardiol. 2001; 33: 655670.
3. Casale PN, Devereux RB, Milner M, et al. Value of echocardiographic measurement of left ventricular mass in predicting cardiovascular morbid events in hypertensive men. Ann Intern Med. 1986; 105: 173178.
4. Levy D, Garrison RJ, Savage DD, et al. Left ventricular mass and incidence of coronary heart disease in an elderly cohort: the Framingham Heart Study. Ann Intern Med. 1989; 110: 101107.
5. Verhaaren HA, Schieken RM, Mosteller M, et al. Bivariate genetic analysis of left ventricular mass and weight in pubertal twins (the Medical College of Virginia twin study). Am J Cardiol. 1991; 68: 661668.
6. Devereux RB, Roman MJ, de Simone G, et al. Relations of left ventricular mass to demographic and hemodynamic variables in American Indians: the Strong Heart Study. Circulation. 1997; 96: 14161423.
7. Schunkert H, Brockel U, Hengstenberg C, et al. Familial predisposition of left ventricular hypertrophy. J Am Coll Cardiol. 1999; 33: 16851691.
8. Sack MN, Rader TA, Park S, et al. Fatty acid oxidation enzyme gene expression is downregulated in the failing heart. Circulation. 1996; 94: 28372842.
9. Kelly DP, Strauss AW. Inherited cardiomyopathies. N Engl J Med. 1994; 330: 913919.
10. Binas B, Danneberg H, McWhir J, et al. Requirement for the heart-type fatty acid binding protein in cardiac fatty acid utilization. FASEB J. 1999; 13: 805812.
11. Chiu HC, Kovacs A, Ford DA, et al. A novel mouse model of lipotoxic cardiomyopathy. J Clin Invest. 2001; 107: 813822.
12. Issemann I, Green S. Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature. 1990; 347: 645650.
13. Fruchart J-C, Duriez P, Staels B. Peroxisome proliferator-activated receptor-alpha activators regulate genes governing lipoprotein metabolism, vascular inflammation and atherosclerosis. Curr Opin Lipidol. 1999; 10: 245257.
14.
Murakami K, Ide T, Suzuki M, et al. Evidence for direct binding of fatty acids and eicosanoids to human peroxisome proliferators-activated receptor
. Biochem Biophys Res Commun. 1999; 260: 609613.
15. Krey G, Braissant O, LHorset F, et al. Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by coactivator-dependent receptor ligand assay. Mol Endocrinol. 1997; 11: 779791.
16. Auboeuf D, Rieusset J, Fajas L, et al. Tissue distribution and quantification of the expression of mRNAs of peroxisome proliferator-activated receptors and liver X receptor-alpha in humans: no alteration in adipose tissue of obese and NIDDM patients. Diabetes. 1997; 46: 13191327.
17.
Djouadi F, Brandt JM, Weinheimer CJ, et al. The role of the peroxisome proliferator-activated receptor
(PPAR
) in the control of cardiac lipid metabolism. Prostaglandins Leukot Essent Fatty Acids. 1999; 60: 339343.
18.
Barger PM, Brandt JM, Leone TC, et al. Deactivation of peroxisome proliferator-activated receptor-
during cardiac hypertrophic growth. J Clin Invest. 2000; 105: 17231730.
19.
Watanabe K, Fujii H, Takahashi T, et al. Constitutive regulation of cardiac fatty acid metabolism through peroxisome proliferator-activated receptor
associated with age-dependent cardiac toxicity. J Biol Chem. 2000; 275: 2229322299.
20.
Djouadi F, Weinheimer CJ, Saffitz JE, et al. A gender-related defect in lipid metabolism and glucose homeostasis in peroxisome proliferator-activated receptor
-deficient mice. J Clin Invest. 1998; 102: 10831091.
21.
Flavell DM, Pineda Torra I, Jamshidi Y, et al. Variation in the PPAR
gene is associated with altered function in vitro and plasma lipid concentrations in type II diabetic subjects. Diabetologia. 2000; 43: 673680.
22. Myerson SG, Montgomery HE, Whittingham M, et al. Left ventricular hypertrophy with exercise and the angiotensin converting enzyme gene I/D polymorphism: a randomised controlled trial with losartan. Circulation. 2001; 103: 226230.
23. Schunkert H, Hengstenberg C, Holmer SR, et al. Lack of association between a polymorphism of the aldosterone synthase gene and left ventricular structure. Circulation. 1999; 99: 22552260.
24. Day IN, Humphries SE. Electrophoresis for genotyping: microtiter array diagonal gel electrophoresis on horizontal polyacrylamide gels, hydrolink, or agarose. Anal Biochem. 1994; 222: 389395.
25. Sher T, Yi HF, McBride OW, et al. cDNA cloning, chromosomal mapping, and functional characterization of the human peroxisome proliferator activated receptor. Biochemistry. 1993; 32: 55985604.
26. Litwin SE, Raya TE, Gay RG, et al. Chronic inhibition of fatty acid oxidation: new model of diastolic dysfunction. Am J Physiol. 1990; 258: H51H56.
27. Post WS, Larson MG, Myers RH, et al. Heritability of left ventricular mass: the Framingham Heart Study. Hypertension. 1997; 30: 10251028.
28. Costet P, Legendre C, More J, et al. Peroxisome proliferator-activated receptor alpha-isoform deficiency leads to progressive dyslipidemia with sexually dimorphic obesity and steatosis. J Biol Chem. 1998; 273: 2957729585.
This article has been cited by other articles:
![]() |
R. S. Vasan, N. L. Glazer, J. F. Felix, W. Lieb, P. S. Wild, S. B Felix, N. Watzinger, M. G. Larson, N. L. Smith, A. Dehghan, et al. Genetic Variants Associated With Cardiac Structure and Function: A Meta-analysis and Replication of Genome-wide Association Data JAMA, July 8, 2009; 302(2): 168 - 178. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. F. Soto, P. Herrero, K. B. Schechtman, A. D. Waggoner, J. M. Baumstark, A. A. Ehsani, and R. J. Gropler Exercise training impacts the myocardial metabolism of older individuals in a gender-specific manner Am J Physiol Heart Circ Physiol, August 1, 2008; 295(2): H842 - H850. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Takahashi, T. Asai, H. Murakami, R. Murakami, M. Tsuzuki, Y. Numaguchi, H. Matsui, T. Murohara, and K. Okumura Pressure Overload-Induced Cardiomyopathy in Heterozygous Carrier Mice of Carnitine Transporter Gene Mutation Hypertension, September 1, 2007; 50(3): 497 - 502. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tanaka, J. M. Ordovas, J. Delgado-Lista, F. Perez-Jimenez, C. Marin, P. Perez-Martinez, P. Gomez, and J. Lopez-Miranda Peroxisome proliferator-activated receptor {alpha} polymorphisms and postprandial lipemia in healthy men J. Lipid Res., June 1, 2007; 48(6): 1402 - 1408. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Gilde, J.-C. Fruchart, and B. Staels Peroxisome Proliferator-Activated Receptors at the Crossroads of Obesity, Diabetes, and Cardiovascular Disease J. Am. Coll. Cardiol., October 27, 2006; 48(9_Suppl_A): A24 - A32. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Morgan, J. H. Rennison, M. E. Young, T. A. McElfresh, T. A. Kung, K.-Y. Tserng, B. D. Hoit, W. C. Stanley, and M. P. Chandler Effects of chronic activation of peroxisome proliferator-activated receptor-{alpha} or high-fat feeding in a rat infarct model of heart failure Am J Physiol Heart Circ Physiol, May 1, 2006; 290(5): H1899 - H1904. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Planavila, R. Rodriguez-Calvo, M. Jove, L. Michalik, W. Wahli, J. C. Laguna, and M. Vazquez-Carrera Peroxisome proliferator-activated receptor {beta}/{delta} activation inhibits hypertrophy in neonatal rat cardiomyocytes Cardiovasc Res, March 1, 2005; 65(4): 832 - 841. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Flavell, H. Ireland, J. W. Stephens, E. Hawe, J. Acharya, H. Mather, S. J. Hurel, and S. E. Humphries Peroxisome Proliferator-Activated Receptor {alpha} Gene Variation Influences Age of Onset and Progression of Type 2 Diabetes Diabetes, February 1, 2005; 54(2): 582 - 586. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Huss and D. P. Kelly Nuclear Receptor Signaling and Cardiac Energetics Circ. Res., September 17, 2004; 95(6): 568 - 578. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E Hardt and J. Sadoshima Negative regulators of cardiac hypertrophy Cardiovasc Res, August 15, 2004; 63(3): 500 - 509. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Alfakih, A. Maqbool, M. Sivananthan, K. Walters, G. Bainbridge, J. Ridgway, A. J. Balmforth, and A. S. Hall Left Ventricle Mass Index and the Common, Functional, X-Linked Angiotensin II Type-2 Receptor Gene Polymorphism (-1332 G/A) in Patients With Systemic Hypertension Hypertension, June 1, 2004; 43(6): 1189 - 1194. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Marx, H. Duez, J.-C. Fruchart, and B. Staels Peroxisome Proliferator-Activated Receptors and Atherogenesis: Regulators of Gene Expression in Vascular Cells Circ. Res., May 14, 2004; 94(9): 1168 - 1178. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Frey, H. A. Katus, E. N. Olson, and J. A. Hill Hypertrophy of the Heart: A New Therapeutic Target? Circulation, April 6, 2004; 109(13): 1580 - 1589. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Liang, F. Wang, S. Zhang, and D. G. Gardner Peroxisome Proliferator Activated Receptor (PPAR){alpha} Agonists Inhibit Hypertrophy of Neonatal Rat Cardiac Myocytes Endocrinology, September 1, 2003; 144(9): 4187 - 4194. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lipsanen-Nyman, J. Perheentupa, J. Rapola, A. Sovijarvi, and M. Kupari Mulibrey Heart Disease: Clinical Manifestations, Long-Term Course, and Results of Pericardiectomy in a Series of 49 Patients Born Before 1985 Circulation, June 10, 2003; 107(22): 2810 - 2815. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. de las Fuentes, P. Herrero, L. R. Peterson, D. P. Kelly, R. J. Gropler, and V. G. Davila-Roman Myocardial Fatty Acid Metabolism: Independent Predictor of Left Ventricular Mass in Hypertensive Heart Disease Hypertension, January 1, 2003; 41(1): 83 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Schunkert and M. Fischer Old and simple tools may do better--sometimes Eur. Heart J., December 2, 2002; 23(24): 1900 - 1902. [PDF] |
||||
![]() |
P. Razeghi, M. E. Young, T. C. Cockrill, O. H. Frazier, and H. Taegtmeyer Downregulation of Myocardial Myocyte Enhancer Factor 2C and Myocyte Enhancer Factor 2C-Regulated Gene Expression in Diabetic Patients With Nonischemic Heart Failure Circulation, July 23, 2002; 106(4): 407 - 411. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Frey and E. N. Olson Modulating Cardiac Hypertrophy by Manipulating Myocardial Lipid Metabolism? Circulation, March 12, 2002; 105(10): 1152 - 1154. [Full Text] [PDF] |
||||
![]() |
D. P. Kelly Peroxisome Proliferator-Activated Receptor {alpha} as a Genetic Determinant of Cardiac Hypertrophic Growth: Culprit or Innocent Bystander? Circulation, March 5, 2002; 105(9): 1025 - 1027. [Full Text] [PDF] |
||||
![]() |
B.N. FINCK, J.J. LEHMAN, P.M. BARGER, and D.P. KELLY Regulatory Networks Controlling Mitochondrial Energy Production in the Developing, Hypertrophied, and Diabetic Heart Cold Spring Harb Symp Quant Biol, January 1, 2002; 67(0): 371 - 382. [Abstract] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Circulation Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2002 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |