This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Harada, E. Articles by Ogawa, H. Search for Related Content PubMed PubMed Citation Articles by Harada, E. Articles by Ogawa, H. Related Collections Cardiovascular Pharmacology

(Circulation. 2001;104:137.)
© 2001 American Heart Association, Inc.

Brief Rapid Communications

Aldosterone Induces Angiotensin-Converting-Enzyme Gene Expression in Cultured Neonatal Rat Cardiocytes

Eisaku Harada, MD; Michihiro Yoshimura, MD; Hirofumi Yasue, MD; Osamu Nakagawa, MD; Masayo Nakagawa, MD; Masaki Harada, MD; Yuji Mizuno, MD; Masafumi Nakayama, MD; Yukio Shimasaki, MD; Teruhiko Ito, MD; Shota Nakamura, MD; Koichiro Kuwahara, MD; Yoshihiko Saito, MD; Kazuwa Nakao, MD; Hisao Ogawa, MD

From the Department of Cardiovascular Medicine, Kumamoto University School of Medicine (E.H., M.Y., M. Nakayama, Y.S., T.I., S.N., H.O.); the Division of Cardiology, Kumamoto Aging Research Institute (H.Y., Y.M.), Kumamoto; and the Department of Medicine and Clinical Science, Kyoto University Graduate School of Medicine (O.N., M. Nakagawa, M.H., K.K., Y.S., K.N.), Kyoto, Japan.

Correspondence to Michihiro Yoshimura, MD, Department of Cardiovascular Medicine, Kumamoto University School of Medicine, 1-1-1 Honjo, Kumamoto, 860-8556, Japan. E-mail: bnp{at}kumamoto-u.ac.jp

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background—— The cardiac renin-angiotensin-aldosterone system is activated in failing hearts in proportion to the severity of the disease. We hypothesized that a positive feedback mechanism might exist within this system and contribute to the progression of the heart failure.

Methods and Results—— To test this hypothesis, we examined whether angiotensin II or aldosterone induces the expression of angiotensin-converting-enzyme (ACE) mRNA in cultured neonatal rat ventricular cardiocytes. Expression of ACE mRNA was detected and quantified using real-time reverse transcription-polymerase chain reaction. Exposure to angiotensin II (10^-5 mol/L) for 24 hours had no significant effect on the expression of ACE mRNA (0.7±0.5-fold versus control, P=NS), but similar treatment with aldosterone (10^-5 mol/L) induced a 23.3±7.9-fold increase (P<0.01) in ACE mRNA expression. The effect of aldosterone was both time- (maximal effect, 24 hours) and dose-dependent (EC₅₀, 4x10^-7 mol/L), and it was significantly (P<0.01) inhibited by spironolactone, a specific mineralocorticoid receptor antagonist.

Conclusions—— Aldosterone upregulates ACE mRNA expression, which is blocked by spironolactone in neonatal rat cardiocytes. Thus, spironolactone may suppress the progression of heart failure by blocking the effects of aldosterone and angiotensin II.

Key Words: angiotensin • aldosterone • polymerase chain reaction • cells

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Angiotensin II is formed in the circulation, but recent evidence indicates that angiotensin II is also synthesized locally in various tissues, including the heart and blood vessels, where it takes part in an autocrine/paracrine system.^1,2 We and others have demonstrated that cardiac angiotensin-converting enzyme (ACE) activity and gene expression are increased in the failing hearts of humans and animals.^3–5

Aldosterone, which is a component of the renin-angiotensin-aldosterone system (RAAS), promotes the retention of sodium and the loss of potassium, activates the sympathetic nervous system, stimulates myocardial and vascular fibrosis, and causes baroreceptor dysfunction.^6–8 Although previously thought to be synthesized solely in the adrenal cortex, recent animal studies have shown that aldosterone is also produced in such extra-adrenal tissues as the heart and blood vessels,^9–11 and we have reported that aldosterone is produced in the failing human heart.¹²

The mechanisms by which the cardiac RAAS is activated in the hypertrophied or failing heart are not completely understood. It is known that in heart failure, RAAS activity is upregulated in proportion to the severity of the condition. One explanation for this would be the existence of a positive feedback mechanism within the cardiac RAAS that contributes to the progression of heart failure. The present study was designed to examine whether aldosterone or angiotensin II affects the expression of ACE mRNA in cultured cardiocytes. Cardiocyte culture is a well-established model for studying cardiac hypertrophy,¹³ and cardiocyte cultures including nonmyocytes provide a more physiological condition for testing.^14,15 The effects of angiotensin II and aldosterone on ACE mRNA expression in cultured cardiocytes, including nonmyocytes, were analyzed using real-time reverse transcription-polymerase chain reaction (RT-PCR), a rapid and highly sensitive method of detecting gene expression.¹⁶

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Cell Cultures
The investigation conforms to the "Guide for the Care and Use of Laboratory Animals" published by the US National Institutes of Health. We prepared neonatal rat cardiocyte cultures, consisting of myocytes and nonmyocytes in their native proportion, as previously described.¹⁵ Prepared cardiocytes were plated at a density of 1.0x10⁵ cells/cm² in gelatin-coated 6-well plates (Becton Dickinson).

The cardiocytes were cultured for 30 hours in 10% FCS (Hazleton Biologics)-containing medium and then transferred to serum-free medium containing 0.1% BSA (Sigma) for an additional 10 hours. After this preconditioning period, which was used to examine the effects of aldosterone or angiotensin II, the cultures were provided with fresh medium containing 0.1% BSA, to which angiotensin II (Peptide Institute) or aldosterone (Sigma) was added for selected periods of time. To block aldosterone receptors, spironolactone (10^-6 to 10^-4 mol/L; Sigma) was added 1 hour before the addition of the agonists.

Real-Time RT-PCR for ACE and GAPDH
Design of Primers and Probes
Oligonucleotide primers and TaqMan probes for rat ACE were designed from the GenBank databases (U03734) using Primer Express version 1.0 (Perkin-Elmer Applied Biosystems, Inc), as previously described.^16,17 The forward primer was 5'-²²⁸²GGAGACGACTTACAGTGTAGCC^-2303-3', the reverse primer was 5'-²⁴⁰¹CACACCCAAAGCAATTCTTC^-2382-3', and the TaqMan probe was 5'-²³⁶⁰AATGGCCACGTCCCGGAAAT^-2379-3'. In addition, primers and the TaqMan probe for rat GAPDH were purchased from Perkin-Elmer Applied Biosystems.

Isolation of Total RNA
Total RNA was extracted from cardiocytes cultured in 6-well plates using a QiagenRNeasy kit, as previously described.¹⁸ The RNA was then treated by DNase I (Qiagen) to minimize genomic DNA contamination.

RT-PCR
RT-PCR was performed with the extracted RNA in an ABI PRISM 7700 Sequence Detector (Perkin-Elmer Applied Biosystems) using 96 samples per assay (50 µL per tube). RT was carried out for 1 cycle at 50°C for 2 minutes, 60°C for 30 minutes, and 95°C for 5 minutes; the PCR protocol consisted of 40 cycles of 94°C for 15 seconds and 60°C for 1 minute. To verify that the amplified products were the target genes, the products from one sample tube were sequenced.

Statistical Analysis
Data were expressed as mean±SD. Statistical analysis was performed using one-way ANOVA followed by multiple comparisons using Fisher’s protected least-significant difference and unpaired Student’s t tests, as appropriate. P<0.05 was considered significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Quantification by Real-Time RT-PCR
The linear range of the standard curve for target gene mRNAs (ACE and GAPDH) was determined using the total RNA isolated from the lung tissue of neonatal rats (Figure 1). The threshold cycle was plotted as a function of initial template concentration to generate the standard curve. With this system, the intra-assay and interassay coefficients of variation were 19.5% and 16.9% (n=8 to 10), respectively.

View larger version (14K): [in this window] [in a new window]   Figure 1. Determination of target gene mRNA levels using TaqMan PCR. The graphs show standard curves (threshold cycle versus initial template quantity) for ACE and GAPDH. Samples of total RNA prepared from the lung tissue of neonatal rats (100, 50, 12.5, 6.25, 3.13, and 0.78 ng) were used. Threshold cycle (Ct) is the PCR cycle at which an increase in reporter fluorescence above the baseline signal is first detected.

Effect of Angiotensin II and Aldosterone on Expression of ACE mRNA in Cardiocyte Cultures
Figure 2 shows the level of ACE mRNA expression by cardiocytes after 24 hours of treatment with either angiotensin II (10^-5 mol/L) or aldosterone (10^-5 mol/L). Although angiotensin II had no significant effect on ACE expression (0.7±0.5-fold versus control, P=NS), aldosterone treatment increased ACE mRNA expression 23.3±7.9-fold (P<0.01).

View larger version (39K): [in this window] [in a new window]   Figure 2. The effect of angiotensin II (Ang II) and aldosterone on the expression of ACE mRNA. Cardiocytes were treated for 24 hours with vehicle (control; open bar), angiotensin II (10-5 mol/L; solid bar), or aldosterone (10-5 mol/L; hatched bar). Values are expressed as the mean±SD of the ACE/GAPDH mRNA ratios obtained from 3 independent experiments. Control was arbitrarily assigned a value of 1 U. **P<0.01 vs control.

Characteristics of Aldosterone Effects on Expression of ACE mRNA
Examination of the time-dependency of effects revealed that aldosterone (10^-5 mol/L) induced significant increases in ACE mRNA expression within 6 hours (versus 0 hours); expression levels then peaked after 24 hours (Figure 3a).

View larger version (23K): [in this window] [in a new window]   Figure 3. Characteristics of aldosterone effects on the expression of ACE mRNA. All values are expressed as the mean±SD of the ACE/GAPDH mRNA ratios. a, Time course of aldosterone-induced upregulation of ACE mRNA expression. Cardiocytes were treated with aldosterone (10-5 mol/L) for the indicated time periods. Values are from 2 independent experiments (n=6). The mean value at time zero was arbitrarily expressed as 1 U. **P<0.01 vs time zero. b, Dose-dependency of aldosterone-induced upregulation of ACE mRNA expression. Cardiocytes were treated with aldosterone (10-8 mol/L to 5x10-5 mol/L) for 24 hours. Values are from 3 independent experiments (n=6). The mean value obtained from vehicle-treated cells was arbitrarily expressed as 1 U. **P<0.01 vs vehicle. c, The effect of spironolactone on aldosterone-induced upregulation of ACE mRNA expression in cardiocytes. The indicated concentrations of spironolactone were added 1 hour before treating cells for 24 hours with aldosterone (10-5 mol/L). Values are from 2 independent experiments (n=6 to 12); open bar indicates control (no spironolactone or aldosterone); hatched bars, spironolactone plus aldosterone (concentrations of spironolactone are indicated below bars); and solid bar, aldosterone alone. The mean value obtained from control was arbitrarily expressed as 1 U. **P<0.01 vs aldosterone alone.

The concentration-dependency of the upregulation of ACE mRNA expression by aldosterone was assessed by examining the effects of exposing cardiocytes to 10^-8 mol/L to 5x10^-5 mol/L aldosterone for 24 hours. As shown in Figure 3b, the effect of aldosterone was concentration-dependent. The EC₅₀ was 4x10^-7 mol/L.

As shown in Figure 3c, spironolactone significantly and dose-dependently inhibited the upregulation of ACE mRNA expression induced by treating cardiocytes with aldosterone for 24 hours.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
In the present study using real-time RT-PCR, we found that aldosterone induces the expression of ACE mRNA in cultured neonatal rat cardiocytes. Although earlier studies have described the upregulation and progression of cardiac RAAS activity in heart failure, the mechanism responsible remains unclear.^1,2 This study indicates that a positive feedback pathway exists from aldosterone to cardiac ACE, which would create a reinforcing, circular cascade within the cardiac RAAS.

Aldosterone was originally thought to be important in the pathophysiology of heart failure only because of its ability to increase sodium retention and potassium loss. Recently, however, Pitt et al¹⁹ showed that inhibiting aldosterone using a low dose of spironolactone substantially reduced the risk of morbidity and mortality among patients with severe heart failure (Randomized Aldactone Evaluation Study) and that the efficacy of the aldosterone blockade was likely not due entirely to the prevention of sodium retention and potassium loss. We recently reported that aldosterone production is activated in the failing ventricles of humans.¹² Moreover, given the positive feedback from aldosterone to ACE within the cardiac RAAS demonstrated in the present study, spironolactone might inhibit the positive feedback within the cardiac RAAS by suppressing the effects of angiotensin II and aldosterone.

Angiotensin II did not increase the expression of ACE mRNA at the same molar level as aldosterone. However, increased production of angiotensin II may indirectly increase ACE mRNA expression by activating aldosterone production.

In experimental model, the concentration of myocardial aldosterone is reported from 10^-8 mol/L to 10^-7 mol/L.¹¹ These levels of aldosterone are thought to be enough to increase ACE mRNA from the present results. In patients with heart failure, aldosterone production is increased from the failing ventricles.¹² Also, clinical doses of spironolactone in the plasma range from 10^-7 mol/L to 10^-6 mol/L.²⁰ These levels of spironolactone are approximately one order of magnitude greater than those of cardiac aldosterone. Therefore, a clinical dose of spironolactone is thought to be effective by inhibiting positive feedback from aldosterone to ACE in patients with heart failure.

In summary, our results directly demonstrate that aldosterone increases the expression of ACE mRNA and that this effect is blocked by spironolactone, an inhibitor of the mineralocorticoid receptor, in neonatal rat cardiocytes. Thus, a positive feedback pathway from aldosterone to ACE exists within the local cardiac RAAS.

Received February 23, 2001; revision received May 1, 2001; accepted May 15, 2001.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Dzau VJ. Circulating versus local renin-angiotensin system in cardiovascular homeostasis. Circulation. 1988; 77: 4–13.
   
2. Campbell DJ. Circulating and tissue angiotensin systems. J Clin Invest. 1987; 79: 1–6.
   
3. Hirsch AT, Talsness CE, Schunkert H, et al. Tissue-specific activation of cardiac angiotensin converting enzyme in experimental heart failure. Circ Res. 1991; 69: 475–482.[Abstract/Free Full Text]
   
4. Hokimoto S, Yasue H, Fujimoto K, et al. Increased angiotensin converting enzyme activity in left ventricular aneurysm of patients after myocardial infarction. Cardiovasc Res. 1995; 29: 664–669.[Medline] [Order article via Infotrieve]
   
5. Studer R, Reinecke H, Muller B, et al. Increased angiotensin-I converting enzyme gene expression in the failing human heart: quantification by competitive RNA polymerase chain reaction. J Clin Invest. 1994; 94: 301–310.
   
6. Lyons D, Webster J, Benjamin N. Angiotensin II, adrenergic sympathetic constrictor actions in humans. Circulation. 1995; 91: 1457–1460.[Abstract/Free Full Text]
   
7. Weber KT, Brilla CG. Pathological hypertrophy and cardiac interstitium: fibrosis and renin-angiotensin-aldosterone system. Circulation. 1991; 83: 1849–1865.[Abstract/Free Full Text]
   
8. Young M, Fullerton M, Dilley R, et al. Mineralocorticoids, hypertension, and cardiac fibrosis. J Clin Invest. 1994; 93: 2578–2583.
   
9. Hatakeyama H, Miyamori I, Fujita T, et al. Vascular aldosterone: biosynthesis and a link to angiotensin II-induced hypertrophy of vascular smooth muscle cells. J Biol Chem. 1994; 269: 24316–24320.[Abstract/Free Full Text]
   
10. Slight SH, Joseph J, Ganjam VK, et al. Extra-adrenal mineralocorticoids and cardiovascular tissue. J Mol Cell Cardiol. 1999; 31: 1175–1184.[Medline] [Order article via Infotrieve]
    
11. Silvestre JS, Robert V, Heymes C, et al. Myocardial production of aldosterone and corticosterone in the rat: physiological regulation. J Biol Chem. 1998; 273: 4883–4891.[Abstract/Free Full Text]
    
12. Mizuno Y, Yoshimura M, Yasue H, et al. Aldosterone production is activated in the failing ventricles in humans. Circulation. 2001; 103: 72–77.[Abstract/Free Full Text]
    
13. Chien KR, Zhu H, Knowlton KU, et al. Transcriptional regulation during cardiac growth and development. Annu Rev Physiol. 1993; 55: 77–95.[Medline] [Order article via Infotrieve]
    
14. Harada M, Itoh H, Nakagawa O, et al. Significance of ventricular myocytes and nonmyocytes interaction during cardiocyte hypertrophy: evidence for endothelin-1 as a paracrine hypertrophic factor from cardiac nonmyocytes. Circulation. 1997; 96: 3737–3744.[Abstract/Free Full Text]
    
15. Harada E, Nakagawa O, Yoshimura M, et al. Effect of interleukin-1ß on cardiac hypertrophy and production of natriuretic peptides in rat cardiocyte culture. J Mol Cell Cardiol. 1999; 31: 1997–2006.[Medline] [Order article via Infotrieve]
    
16. Heid CA, Stevens J, Livak KJ, et al. Real-time quantitative PCR. Genome Res. 1996; 6: 986–994.[Abstract/Free Full Text]
    
17. Koike G, Krieger JE, Jacob HJ, et al. Angiotensin converting enzyme and genetic hypertension: cloning of rat cDNAs and characterization of the enzyme. Biochem Biophys Res Commun. 1994; 198: 380–386.[Medline] [Order article via Infotrieve]
    
18. Gurantz D, Cowling RT, Villarreal FJ, et al. Tumor necrosis factor- upregulates angiotensin II type 1 receptors on cardiac fibroblasts. Circ Res. 1999; 85: 272–279.[Abstract/Free Full Text]
    
19. Pitt B, Zannad F, Remme WJ, et al. The effect of spironolactone on morbidity and mortality in patients with severe heart failure. N Engl J Med. 1999; 341: 709–717.[Abstract/Free Full Text]
    
20. Karim A, Zagarella J, Hutsell TC, et al. Spironolactone, III: canrenone-maximum and minimum steady-state plasma levels. Clin Pharmacol Ther. 1976; 19: 177–182.[Medline] [Order article via Infotrieve]
    

This article has been cited by other articles:

				A.C. Montezano, G.E. Callera, A. Yogi, Y. He, R.C. Tostes, G. He, E.L. Schiffrin, and R.M. Touyz Aldosterone and Angiotensin II Synergistically Stimulate Migration in Vascular Smooth Muscle Cells Through c-Src-Regulated Redox-Sensitive RhoA Pathways Arterioscler. Thromb. Vasc. Biol., August 1, 2008; 28(8): 1511 - 1518. [Abstract] [Full Text] [PDF]

				H. Matsui, K. Ando, H. Kawarazaki, A. Nagae, M. Fujita, T. Shimosawa, M. Nagase, and T. Fujita Salt Excess Causes Left Ventricular Diastolic Dysfunction in Rats With Metabolic Disorder Hypertension, August 1, 2008; 52(2): 287 - 294. [Abstract] [Full Text] [PDF]

				M. Yamada, M. Kushibiki, T. Osanai, H. Tomita, and K. Okumura Vasoconstrictor effect of aldosterone via angiotensin II type 1 (AT1) receptor: possible role of AT1 receptor dimerization Cardiovasc Res, July 1, 2008; 79(1): 169 - 178. [Abstract] [Full Text] [PDF]

				E. L. Schiffrin New Twist to the Role of the Renin-Angiotensin System in Heart Failure: Aldosterone Upregulates Renin-Angiotensin System Components in the Brain Hypertension, March 1, 2008; 51(3): 622 - 623. [Full Text] [PDF]

				Y. Yu, S.-G. Wei, Z.-H. Zhang, E. Gomez-Sanchez, R. M. Weiss, and R. B. Felder Does Aldosterone Upregulate the Brain Renin-Angiotensin System in Rats With Heart Failure? Hypertension, March 1, 2008; 51(3): 727 - 733. [Abstract] [Full Text] [PDF]

				Z.-H. Zhang, Y. Yu, Y.-M. Kang, S.-G. Wei, and R. B. Felder Aldosterone acts centrally to increase brain renin-angiotensin system activity and oxidative stress in normal rats Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H1067 - H1074. [Abstract] [Full Text] [PDF]

				N. J. Brown Aldosterone and Vascular Inflammation Hypertension, February 1, 2008; 51(2): 161 - 167. [Full Text] [PDF]

				S. Kasama, T. Toyama, H. Sumino, N. Matsumoto, Y. Sato, H. Kumakura, Y. Takayama, S. Ichikawa, T. Suzuki, and M. Kurabayashi Additive Effects of Spironolactone and Candesartan on Cardiac Sympathetic Nerve Activity and Left Ventricular Remodeling in Patients with Congestive Heart Failure J. Nucl. Med., December 1, 2007; 48(12): 1993 - 2000. [Abstract] [Full Text] [PDF]

				S. A. Cooper, A. Whaley-Connell, J. Habibi, Y. Wei, G. Lastra, C. Manrique, S. Stas, and J. R. Sowers Renin-angiotensin-aldosterone system and oxidative stress in cardiovascular insulin resistance Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2009 - H2023. [Abstract] [Full Text] [PDF]

				S. Stas, A. Whaley-Connell, J. Habibi, L. Appesh, M. R. Hayden, P. R. Karuparthi, M. Qazi, E. M. Morris, S. A. Cooper, C. D. Link, et al. Mineralocorticoid Receptor Blockade Attenuates Chronic Overexpression of the Renin-Angiotensin-Aldosterone System Stimulation of Reduced Nicotinamide Adenine Dinucleotide Phosphate Oxidase and Cardiac Remodeling Endocrinology, August 1, 2007; 148(8): 3773 - 3780. [Abstract] [Full Text] [PDF]

				M. L. Onozato, A. Tojo, N. Kobayashi, A. Goto, H. Matsuoka, and T. Fujita Dual blockade of aldosterone and angiotensin II additively suppresses TGF-{beta} and NADPH oxidase in the hypertensive kidney Nephrol. Dial. Transplant., May 1, 2007; 22(5): 1314 - 1322. [Abstract] [Full Text] [PDF]

				S Kasama, T Toyama, T Hatori, H Sumino, H Kumakura, Y Takayama, S Ichikawa, T Suzuki, and M Kurabayashi Effects of torasemide on cardiac sympathetic nerve activity and left ventricular remodelling in patients with congestive heart failure Heart, October 1, 2006; 92(10): 1434 - 1440. [Abstract] [Full Text] [PDF]

				S. Johar, A. C. Cave, A. Narayanapanicker, D. J. Grieve, and A. M. Shah Aldosterone mediates angiotensin II-induced interstitial cardiac fibrosis via a Nox2-containing NADPH oxidase FASEB J, July 1, 2006; 20(9): 1546 - 1548. [Abstract] [Full Text] [PDF]

				M. Yamamuro, M. Yoshimura, M. Nakayama, K. Abe, M. Shono, S. Suzuki, T. Sakamoto, Y. Saito, K. Nakao, H. Yasue, et al. Direct Effects of Aldosterone on Cardiomyocytes in the Presence of Normal and Elevated Extracellular Sodium Endocrinology, March 1, 2006; 147(3): 1314 - 1321. [Abstract] [Full Text] [PDF]

				E. L. Schiffrin Effects of Aldosterone on the Vasculature Hypertension, March 1, 2006; 47(3): 312 - 318. [Full Text] [PDF]

				T. Nishikimi, N. Maeda, and H. Matsuoka The role of natriuretic peptides in cardioprotection Cardiovasc Res, February 1, 2006; 69(2): 318 - 328. [Abstract] [Full Text] [PDF]

				P. Ye, C. J. Kenyon, S. M. MacKenzie, A. S. Jong, C. Miller, G. A. Gray, A. Wallace, A. S. Ryding, J. J. Mullins, M. W. McBride, et al. The Aldosterone Synthase (CYP11B2) and 11{beta}-Hydroxylase (CYP11B1) Genes Are Not Expressed in the Rat Heart Endocrinology, December 1, 2005; 146(12): 5287 - 5293. [Abstract] [Full Text] [PDF]

				S. Keidar, A. Gamliel-Lazarovich, M. Kaplan, E. Pavlotzky, S. Hamoud, T. Hayek, R. Karry, and Z. Abassi Mineralocorticoid Receptor Blocker Increases Angiotensin-Converting Enzyme 2 Activity in Congestive Heart Failure Patients Circ. Res., October 28, 2005; 97(9): 946 - 953. [Abstract] [Full Text] [PDF]

				T. Karram, A. Abbasi, S. Keidar, E. Golomb, I. Hochberg, J. Winaver, A. Hoffman, and Z. Abassi Effects of spironolactone and eprosartan on cardiac remodeling and angiotensin-converting enzyme isoforms in rats with experimental heart failure Am J Physiol Heart Circ Physiol, October 1, 2005; 289(4): H1351 - H1358. [Abstract] [Full Text] [PDF]

				T. Sugiyama, T. Yoshimoto, K. Tsuchiya, N. Gochou, Y. Hirono, T. Tateno, N. Fukai, M. Shichiri, and Y. Hirata Aldosterone Induces Angiotensin Converting Enzyme Gene Expression via a JAK2-Dependent Pathway in Rat Endothelial Cells Endocrinology, September 1, 2005; 146(9): 3900 - 3906. [Abstract] [Full Text] [PDF]

				D. Fraccarollo, P. Galuppo, I. Schmidt, G. Ertl, and J. Bauersachs Additive amelioration of left ventricular remodeling and molecular alterations by combined aldosterone and angiotensin receptor blockade after myocardial infarction Cardiovasc Res, July 1, 2005; 67(1): 97 - 105. [Abstract] [Full Text] [PDF]

				A D Struthers Pathophysiology of heart failure following myocardial infarction Heart, May 1, 2005; 91(suppl_2): ii14 - ii16. [Abstract] [Full Text] [PDF]

				S. Kasama, T. Toyama, H. Kumakura, Y. Takayama, S. Ichikawa, T. Suzuki, and M. Kurabayashi Effects of candesartan on cardiac sympathetic nerve activity in patients with congestive heart failure and preserved left ventricular ejection fraction J. Am. Coll. Cardiol., March 1, 2005; 45(5): 661 - 667. [Abstract] [Full Text] [PDF]

				B. Pitt A New HOPE for Aldosterone Blockade? Circulation, September 28, 2004; 110(13): 1714 - 1716. [Full Text] [PDF]

				H. Tsuneyoshi, T. Nishina, T. Nomoto, H. Kanemitsu, R. Kawakami, O. Unimonh, K. Nishimura, and M. Komeda Atrial Natriuretic Peptide Helps Prevent Late Remodeling After Left Ventricular Aneurysm Repair Circulation, September 14, 2004; 110(11_suppl_1): II-174 - II-179. [Abstract] [Full Text] [PDF]

				A. Mano, T. Tatsumi, J. Shiraishi, N. Keira, T. Nomura, M. Takeda, S. Nishikawa, S. Yamanaka, S. Matoba, M. Kobara, et al. Aldosterone Directly Induces Myocyte Apoptosis Through Calcineurin-Dependent Pathways Circulation, July 20, 2004; 110(3): 317 - 323. [Abstract] [Full Text] [PDF]

				J E Macdonald, N Kennedy, and A D Struthers Effects of spironolactone on endothelial function, vascular angiotensin converting enzyme activity, and other prognostic markers in patients with mild heart failure already taking optimal treatment Heart, July 1, 2004; 90(7): 765 - 770. [Abstract] [Full Text] [PDF]

				K.-C. Ueng and S.-A. Chen Atrial remodelling in persistent atrial fibrillation: the potential role of aldosterone: Reply Eur. Heart J., June 2, 2004; 25(12): 1087 - 1087. [Full Text] [PDF]

				S. Keidar, M. Kaplan, E. Pavlotzky, R. Coleman, T. Hayek, S. Hamoud, and M. Aviram Aldosterone Administration to Mice Stimulates Macrophage NADPH Oxidase and Increases Atherosclerosis Development: A Possible Role for Angiotensin-Converting Enzyme and the Receptors for Angiotensin II and Aldosterone Circulation, May 11, 2004; 109(18): 2213 - 2220. [Abstract] [Full Text] [PDF]

				J. Tan, H. Wang, and F. H. H. Leenen Increases in brain and cardiac AT1 receptor and ACE densities after myocardial infarct in rats Am J Physiol Heart Circ Physiol, May 1, 2004; 286(5): H1665 - H1671. [Abstract] [Full Text] [PDF]

				F. Michel, M.-L. Ambroisine, M. Duriez, C. Delcayre, B. I. Levy, and J.-S. Silvestre Aldosterone Enhances Ischemia-Induced Neovascularization Through Angiotensin II-Dependent Pathway Circulation, April 27, 2004; 109(16): 1933 - 1937. [Abstract] [Full Text] [PDF]

				H. T. Yu Progression of Chronic Renal Failure Arch Intern Med, June 23, 2003; 163(12): 1417 - 1429. [Abstract] [Full Text] [PDF]

				S. Kasama, T. Toyama, H. Kumakura, Y. Takayama, S. Ichikawa, T. Suzuki, and M. Kurabayashi Addition of Valsartan to an Angiotensin-Converting Enzyme Inhibitor Improves Cardiac Sympathetic Nerve Activity and Left Ventricular Function in Patients with Congestive Heart Failure J. Nucl. Med., June 1, 2003; 44(6): 884 - 890. [Abstract] [Full Text] [PDF]

				A. J. Casal, J.-S. Silvestre, C. Delcayre, and A. M. Capponi Expression and Modulation of Steroidogenic Acute Regulatory Protein Messenger Ribonucleic Acid in Rat Cardiocytes and after Myocardial Infarction Endocrinology, May 1, 2003; 144(5): 1861 - 1868. [Abstract] [Full Text] [PDF]

				T. Ito, M. Yoshimura, S. Nakamura, M. Nakayama, Y. Shimasaki, E. Harada, Y. Mizuno, M. Yamamuro, M. Harada, Y. Saito, et al. Inhibitory Effect of Natriuretic Peptides on Aldosterone Synthase Gene Expression in Cultured Neonatal Rat Cardiocytes Circulation, February 18, 2003; 107(6): 807 - 810. [Abstract] [Full Text] [PDF]

				R. B. Felder, J. Francis, Z.-H. Zhang, S.-G. Wei, R. M. Weiss, and A. K. Johnson Heart failure and the brain: new perspectives Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2003; 284(2): R259 - R276. [Abstract] [Full Text] [PDF]

				J. Francis, R. M. Weiss, A. K. Johnson, and R. B. Felder Central mineralocorticoid receptor blockade decreases plasma TNF-alpha after coronary artery ligation in rats Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2003; 284(2): R328 - R335. [Abstract] [Full Text] [PDF]