Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2001;104:1407-1412
doi: 10.1161/hc3701.095583
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miyata, M.
Right arrow Articles by Tei, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miyata, M.
Right arrow Articles by Tei, C.
Right arrowPubmed/NCBI databases
*Gene*Protein
*UniGene
*Substance via MeSH
Related Collections
Right arrow Restenosis
Right arrow Gene expression
Right arrow Smooth muscle proliferation and differentiation

(Circulation. 2001;104:1407.)
© 2001 American Heart Association, Inc.


Basic Science Reports

Apolipoprotein J/Clusterin Is Induced in Vascular Smooth Muscle Cells After Vascular Injury

Masaaki Miyata, MD, PhD; Sadatoshi Biro, MD, PhD; Hiroshi Kaieda, MD, PhD; Hideyuki Eto, MD; Koji Orihara, MD; Takashi Kihara, MD; Hachiro Obata, MD, PhD; Noriko Matsushita, PhD; Takami Matsuyama, MD, PhD; Chuwa Tei, MD, PhD

From the First Department of Internal Medicine (M.M., S.B., H.K., H.E., K.O., T.K., H.O., C.T.) and Medical Zoology and Immunology (N.M., T.M.), Faculty of Medicine, Kagoshima University, Kagoshima, Japan.

Correspondence to Sadatoshi Biro, MD, PhD, First Department of Internal Medicine, Faculty of Medicine, Kagoshima University, 8-35-1 Sakuragaoka, Kagoshima 890-8520, Japan. E-mail biro{at}m2.kufm.kagoshima-u.ac.jp


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— Understanding the precise molecular mechanisms underlying the phenomenon of restenosis after PTCA may help us to develop a new strategy for the treatment of restenosis after PTCA. The purpose of this study was to identify the genes involved in vascular restenosis.

Methods and Results— Applying a differential hybridization method to a model of the balloon-injured rabbit aorta, we identified 6 cDNA clones that were upregulated after injury. Northern blot showed that 5 genes, but not apolipoprotein J (apoJ)/clusterin, were constitutively expressed in noninjured aorta and upregulated after balloon injury. ApoJ mRNA was not detectable in noninjured aorta (control), began to be expressed at 6 hours after injury, showed a peak level at 24 hours (a 48-fold increase), gradually declined, and returned to the control level at 24 weeks. Western blot and immunohistochemistry demonstrated no expression of apoJ protein in noninjured aorta, an expression of apoJ at 2 days after balloon injury, and a peak level (a 55-fold increase) at 2 to 8 weeks. The expression of apoJ protein continued until 24 weeks after injury. In situ hybridization revealed that apoJ mRNA was expressed in smooth muscle cells (SMCs) of media at 2 days after injury and in SMCs of media and neointima at 2 weeks. To analyze the function of apoJ, stably transfected rabbit SMCs were created. The expression of apoJ stimulated proliferation and migration of SMCs.

Conclusions— ApoJ is dramatically induced in media and neointima after vascular injury, suggesting that apoJ contributes to restenosis after angioplasty.


Key Words: angioplasty • restenosis • muscle, smooth • apolipoproteins


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Percutaneous transluminal coronary angioplasty (PTCA) is a useful technique for treating patients with coronary atherosclerosis. The long-term efficacy of PTCA, however, is limited by vascular restenosis, which occurs in up to 40% of patients undergoing this procedure.1 Restenosis after PTCA is a consequence of balloon-induced smooth muscle cell (SMC) migration, proliferation, matrix production, and remodeling. Numerous attempts to prevent restenosis after PTCA have met with very limited success. This failure reflects the complexity of the pathophysiological process of restenosis. Our understanding of the cellular and molecular mechanisms of restenosis has made it difficult to identify appropriate cellular or molecular targets for therapy of restenosis after PTCA.

Intimal thickening and constrictive remodeling are main elements of the process of restenosis, and SMCs play a key role in this phenomenon. Balloon catheter injury to the artery wall induces the migration and proliferation of and matrix production by arterial SMCs, resulting in neointima formation. This animal model is frequently used to study vascular restenosis.2 Using this in vivo model, we performed a differential hybridization method to compare gene expression before and after vascular injury. This type of hybridization method has been successfully used to identify many differentially expressed genes.

The mechanism of restenosis after balloon injury is believed to involve cascades of autocrine and paracrine cytokine and growth factor signaling after vascular injury.3 There may be a master gene that controls this cascade. To begin to search for such a gene, we used differential hybridization to identify mRNAs that showed increased levels of expression at 24 hours after balloon injury in a rabbit aorta model.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Rabbit Aorta Model
Male Japanese white rabbits (2.5 kg, 6 months old) were used in all experiments. All surgical procedures on the animals were carried out under general anesthesia with sodium pentobarbital (40 mg/kg body wt), ketamine (2 mg/kg body wt), and xylazine (8 mg/kg body wt) IV. Injury of the aorta was performed according to a standard protocol4 with minor modifications. Briefly, a 4F Fogarty balloon catheter (Baxter Healthcare Co) was inserted into the femoral artery and advanced to the aortic arch. The balloon was then inflated and passed 3 times along the length of the aorta. The balloon catheter was removed, and the femoral artery was permanently ligated. At specified time points after injury, animals were anesthetized, killed, and perfused with PBS, and the aortas were harvested. For RNA isolation, the adventitia was stripped away from the aorta with fine forceps in PBS and then snap-frozen in liquid nitrogen. Sham-operated animals, anesthetized and operated on without catheter insertion, were used as controls. This study was carried out in accordance with the Guide for Animal Experimentation, Faculty of Medicine, Kagoshima University.

RNA Isolation
Total RNA for use in the differential hybridization and Northern blot analysis was isolated by the standard guanidinium thiocyanate method.5 For differential hybridization, poly (A)+ RNA was prepared with the polyATract mRNA Isolation System (Promega) according to the manufacturer’s instructions.

Differential Hybridization
By use of a cDNA library construction kit (Stratagene), a directional cDNA library was constructed in a {lambda}ZAP II phage vector with poly (A)+ RNA extracted from the balloon-injured aorta. The cDNA library was plated, and 2 replica nitrocellulose filters were made from each plate. The duplicate filters were hybridized with 32P-labeled single-strand cDNA probes generated with poly (A)+ RNA from either the balloon-injured aorta or noninjured (control) aorta by use of avian myeloblastosis virus reverse transcriptase (Promega) and [32P]dCTP [3000 Ci/(mmol/L); NEN-Dupont]. The phage plaques that preferentially hybridized to the probe derived from the balloon-injured aorta were picked and rescreened twice. Plasmids were generated from consistently positive plaques by an in vivo rescue procedure according to the manufacturer’s protocol (Stratagene). Plasmid DNA was isolated for sequence analysis and for the preparation of a radioactive DNA probe by a random priming reaction,6 which was used for the Northern blot analysis.

DNA Sequence and Analysis
Automated direct sequencing of the cDNA clones was performed in both directions with some primers and an Applied Biosystem 310 DNA sequencer with the ABI BigDye Terminator Cycle Sequencing kit (Applied Biosystems). Sequences were compared by use of the GenBank database at the National Center for Biotechnology Information with the BLAST alignment algorithm network service.

Northern Blot Analysis
Northern blot was performed as described previously.7 GAPDH probe (Clontech) was used as control, and all densitometric data of the Northern blot were normalized for GAPDH signals. For quantification, images were analyzed with NIH Image software.

Western Blot Analysis
For Western blot analysis, aortas were ground to a fine powder under liquid nitrogen and incubated in ice-cold 0.1% Triton lysis solution (mmol/L: HEPES 10 [pH 7.4], sodium pyrophosphate 50, NaF 50, EDTA 5, EGTA 5, and NaCl 50; and 100 µmol/L Na3VO4, 0.1% Triton X-100, 500 µmol/L PMSF, and 10 µg/mL leupeptin) for 30 minutes. Insoluble matter was removed by centrifugation, and the protein concentration was measured by bicinchoninic acid assay (Pierce). Equal amounts of protein (20 µg) were run on a gel. Western blot was performed as described previously8 with primary antibody against human apolipoprotein J (apoJ) (Rockland). It was repeated 4 times, and similar results were obtained. For quantification, images were analyzed with NIH Image software.

Immunohistochemical Staining
Immunohistochemical staining was performed as described previously9 by the labeled streptavidin-biotin complex method [Histofine SAB-PO(G) or (M) kit, Nichirei]. A goat polyclonal antibody against human apoJ (Rockland) or a mouse monoclonal antibody against muscle actin (Enzo Diagnostics) was used as primary antibody. The specificity of the immunoreaction was evaluated in comparison with a negative control specimen in which goat or mouse IgG was used instead of primary antibody.

In Situ Hybridization
In situ hybridization was carried out as reported previously10,11 with thymine-thymine (T-T) dimerized synthetic oligonucleotides complementary to a rabbit apoJ mRNA as probe. A 45-base sequence (italic type) complementary to the mRNA of rabbit apoJ (345–389) was chosen. A computer-assisted search (GenBank) of the antisense sequences, as well as the sense sequences, revealed no significant homology with any known sequences other than that of apoJ. For haptenization of the oligo-DNAs with T-T dimers, 2 and 3 TTA repeats of the 5' and 3' ends of the sequences were added, respectively, as follows: antisense probe, TTATTATTCGACTTCCGTAAGGGCCTTCACACGTTGCTCTGGTACTACCGGATTATTATT; sense probe, TTATTAAAGCTGAAGGCATTCCCGGAAGT-GTGCAACGAGACCATGATGGCCATTATTATT.

Stably Transfected Cell Lines
Rabbit SMCs were isolated from the media of rabbit aortas. ApoJ cDNA was ligated into the mammalian expression plasmid vector pcDNA3.1 (Invitrogen). Rabbit SMCs, in 35-mm culture dishes, were transfected with 5 µg of the expression plasmid by use of lipofectamine (Life Technologies). The following day, the cells were trypsinized, plated into 100-mm culture dishes, and treated with 800 mg/mL Geneticin (Life Technologies) to select for cells stably integrating the neor gene. Individual colonies were picked and expanded to test for expression of the transfected gene by Northern blot.

SMC Proliferation and Migration Assay
SMC proliferation was determined by measurement of [3H]thymidine incorporation in SMCs as described previously.12 The chemotactic migration of SMCs was measured with a transwell migration apparatus. M199 medium with 10% FBS was added to the lower wells of the transwell chamber (Chemotaxicell, Kurabou). Transfected SMCs were trypsinized, resuspended in M199 with 0.5% BSA at a density of 5x105 cell/mL, and added into the upper wells of the transwell chamber with a PVP-free filter with 8-µm pores. The chambers were incubated for 6 hours, and cells were fixed and stained with hematoxylin. All migrated cells attached to the bottom of the filter were counted. All the experiments were performed in quadruplicate, and each experiment was repeated 4 times. An unpaired Student’s t test was used for statistical analysis.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
mRNA was isolated from control (noninjured) and balloon-injured rabbit aortas at 24 hours after injury, and differential hybridization was performed to identify changes in gene expression that occur in the SMCs of aorta after balloon injury. After tertiary screening, 6 overexpressed phage plaques were obtained. These 6 cDNA clones were sequenced and analyzed by searching for homologies against the GenBank database. Homologies to the following sequences were found: apoJ/clusterin, importin-ß, tumor-associated protein, {alpha}-globin, {alpha}-actin, and mitochondrial DNA.

With these 6 cDNA clones used as probes, Northern blot analysis was performed to confirm the gene regulation patterns observed in the differential hybridization (Figure 1; data for {alpha}-actin and mitochondrial DNA are not shown). Although an equal amount of total RNA was loaded, as shown by the intensity of the 28S ribosomal RNA of each lane, the GAPDH mRNA level was increased 24 hours after vascular injury (a 1.5-fold increase). Therefore, the expression level of genes was normalized for GAPDH. Northern blot analyses of control and balloon-injured aortas obtained 24 hours after balloon injury showed that all the identified genes, except for apoJ, were constitutively expressed in the noninjured aorta and upregulated at 24 hours after balloon injury. Of these, apoJ mRNA was the most significantly induced after injury (a 48-fold increase, Figure 1), as assessed by Northern blot analysis. Therefore, we focused on apoJ.



View larger version (76K):
[in this window]
[in a new window]
 
Figure 1. Northern blot analysis of RNA from rabbit aorta subjected to balloon injury probed with cDNA obtained by differential hybridization method. Left, Molecular weight standards. GAPDH served as inner marker and 28S ribosomal RNA as control for loading. Signal intensity of each gene was normalized for GAPDH. Values show fold increase relative to noninjured aorta. TAP indicates tumor-associated protein; (-), noninjured aorta; and (+), balloon-injured aorta obtained 24 hours after injury.

The cDNA of rabbit apoJ was sequenced in both directions. This cDNA contained the full-length cDNA of apoJ deduced from other species and had an open reading frame of 447 amino acid residues with a hydrophobic signal sequence (GenBank accession No. AF118852). By Northern blot analysis using this cDNA, the time course of mRNA expression of apoJ after balloon injury was analyzed (Figure 2). ApoJ mRNA was not detectable in noninjured aorta (control), began to be expressed at 6 hours after injury, showed a peak level at 24 hours (a 48-fold increase compared with control), gradually declined, and then returned to the control level at 24 weeks after injury.



View larger version (50K):
[in this window]
[in a new window]
 
Figure 2. Time course of induction of apoJ mRNA after balloon injury of rabbit aorta. Total RNA was isolated from noninjured aorta (0) and balloon-injured aorta obtained at 6, 12, and 24 hours (h); 2, 5, and 7 days (d); and 2, 8, 16, and 24 weeks (W) after vascular injury. A, Representative time course of apoJ expression after balloon injury by Northern blot analysis. GAPDH served as inner marker and 28S ribosomal RNA as control for loading. B, Quantification of apoJ signals in 3 different experiments. Signal intensity of apoJ was normalized for GAPDH. Fold increase relative to noninjured aorta (mean±SD).

To quantify the expression level of apoJ protein, Western blot analysis was performed with primary antibody against human apoJ (Figure 3). Densitometric analysis of 4 independent experiments demonstrated no expression of apoJ protein in noninjured aorta, an expression of apoJ protein at 2 days after balloon injury, and a peak level (a 55-fold increase) at 2 to 8 weeks. A high level of apoJ protein was maintained even at 24 weeks after injury.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 3. Time course of induction of apoJ protein after balloon injury of rabbit aorta. Equal amounts of protein (20 µg) obtained from noninjured aorta (0) and balloon-injured aorta at 2, 5, and 7 days (d) and 2, 8, and 24 weeks (W) after vascular injury were run on gel. A, Representative time course of apoJ expression after balloon injury by Western blot analysis. Serum was obtained from control rabbit. B, Quantification of expression of apoJ protein in 4 different experiments. Fold increase relative to noninjured aorta (mean±SD).

To localize the expression of apoJ protein in the balloon-injured rabbit aorta, we performed immunohistochemical staining with polyclonal antibodies raised against human apoJ (Figure 4). ApoJ protein was not expressed in the media of noninjured aortas. It was expressed, however, in the SMCs of the media at 2 days after injury and in the SMCs of the media and neointima at 2 and 8 weeks after injury (Figure 4) and 24 weeks after injury (data not shown). To confirm that apoJ exists in SMCs, immunohistochemical staining for muscle actin was also performed on serial sections from aorta 2 weeks after injury. It showed that not only media but also neointima was composed predominantly of SMCs (Figure 4f).



View larger version (106K):
[in this window]
[in a new window]
 
Figure 4. Immunohistochemical staining for apoJ in balloon-injured rabbit aorta. ApoJ protein was not detected in media of noninjured aorta (a) but was expressed in SMCs of media 2 days after balloon injury (b) and in SMCs of media and neointima 2 (c) and 8 (d) weeks after balloon injury. e, Negative immunostaining control of aorta 2 weeks after injury. Immunohistochemical staining for muscle actin was also performed on serial sections from aorta 2 weeks after injury and showed that not only media but also neointima was composed predominantly of SMCs (f). Arrows indicate internal elastic lamina. Magnification x400.

To confirm that the SMCs were synthesizing apoJ, in situ hybridization analysis was performed (Figure 5). No apoJ mRNA was detected in the media of control aortas, whereas mRNA for apoJ was expressed in the SMCs of the media at 2 days after injury and the SMCs of the media and neointima at 2 weeks after injury.



View larger version (97K):
[in this window]
[in a new window]
 
Figure 5. In situ hybridization of apoJ in balloon-injured rabbit aorta. With antisense probe, apoJ mRNA was not detected in media of noninjured aorta (a) but was observed in SMCs of media 2 days after balloon injury (c) and in SMCs of media and neointima 2 weeks after balloon injury (e). With sense probe, no signal was detected in noninjured aorta (b) and aorta 2 days (d) and 2 weeks (f) after balloon injury. Arrows indicate internal elastic lamina. Magnification x400. 

To examine the effects of apoJ on proliferation and migration of SMCs, stably transfected rabbit SMC cell lines were established. Northern blot demonstrated robust expression of apoJ mRNA in apoJ-transfected cells (data not shown). On 10% FBS or 10 ng/mL platelet-derived growth factor medium, [3H]thymidine incorporation in apoJ-transfected SMCs was significantly higher than that in SMCs transfected with plasmid vector (control) (Figure 6A). The number of migrating apoJ-transfected SMCs induced by 10% FBS was significantly higher than that of control (Figure 6B).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 6. Effects of apoJ expression on SMC proliferation and migration. A, Proliferation assay: after starvation with 0.1% FBS for 48 hours, SMCs were stimulated by 10% FBS or 10 ng/mL platelet-derived growth factor (PDGF). On 10% FBS or 10 ng/mL PDGF medium, [3H]thymidine incorporation in apoJ-transfected SMCs (solid bar) was significantly higher than that in SMCs transfected with plasmid vector (control, open bar). Results are presented as percentage increase from each control. B, Migration assay: number of migrating apoJ-transfected SMCs induced by 10% FBS was significantly higher than in control. All experiments were performed in quadruplicate, and each experiment was repeated 4 times. Values are mean±SD. *P<0.005, **P<0.001 vs control.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Although many reports have focused on gene expression in proliferating and migrating SMCs after vascular injury, this is the first report to use differential hybridization to focus on an early time point, 24 hours after balloon injury. We chose this early time course to identify master genes controlling the cascade reaction leading to neointimal formation after vascular injury. The differential hybridization method is a powerful technique for identifying differentially expressed genes. In this study, 6 balloon-injury-induced genes were identified, including apoJ/clusterin, importin ß, tumor-associated protein, {alpha}-globin, {alpha}-actin, and mitochondrial DNA.

Because apoJ mRNA is dramatically induced after balloon injury, we focused on apoJ in this article. ApoJ is a highly conserved secretory glycoprotein and is identical to the proteins previously named clusterin, serum protein 40-40, testosterone-repressed protein message-2, sulfated glycoprotein-2, and complement lysis inhibitor. ApoJ has been found in most physiological fluids, including human plasma, urine, breast milk, semen, and cerebrospinal fluid.13,14 The wide distribution and sequence conservation of apoJ suggests that this protein performs functions of fundamental biological importance. These include lipid transport,15 sperm maturation,16 regulation of the complement cascade,17 apoptosis,18 and membrane recycling.19

Using immunohistochemistry and in situ hybridization, we confirmed that the protein and mRNA for apoJ exist in SMCs of the media and neointima after balloon injury. Although the mRNA of apoJ vanished at 24 weeks after injury by Northern blot analysis, a high level of apoJ protein was maintained at 24 weeks by Western blot and immunohistochemistry. The reason for this discrepancy is thought to be that apoJ accumulated in the media and neointima of aorta at 24 weeks, because apoJ is distributed in the intima and media of human aortas with intimal thickening or atherosclerotic lesion.20

Several investigators have reported that apoJ is induced after tissue injury or inflammation in a variety of tissues. Swertfeger et al21 reported that apoJ protein accumulates in myocytes at the interface between degenerated myocardial tissue and the surrounding cardiac tissue in myosin-induced and viral myocarditis. These authors proposed that apoJ functions to limit and/or promote tissue injury. In another report, the apoJ mRNA was found to be upregulated in kidney epithelial cells after obstruction by ureteral ligation compared with the contralateral nonobstructed kidney.22 Therefore, apoJ is likely to be involved in the process of tissue remodeling.

Cordero et al23 reported that the expression of a clone with strong homology to apoJ was significantly increased in a distal anastomotic artery segment compared with normal artery segments in the dog. The anastomotic intimal hyperplasia is similar to that seen after balloon injury. Both of these are considered to be forms of accelerated atherosclerosis. In addition, we confirmed that the apoJ protein was expressed in human atherectomy specimens from restenotic lesions after PTCA and transluminal femoral angioplasty using immunohistochemistry (unpublished data). To analyze the function of apoJ, stably transfected rabbit SMC cell lines were created. The expression of apoJ stimulated proliferation and migration of vascular SMCs in vitro, suggesting that apoJ contributes to restenosis after angioplasty. Further in vivo studies are needed to determine the role of apoJ in restenosis after PTCA.

Importin is the nuclear import receptor for nuclear localization signal (NLS)-containing proteins. NLS proteins are transported into the nucleus by the importin-{alpha}/ß heterodimer. Importin-{alpha} binds NLS, whereas importin-ß mediates translocation through the nuclear pore complex.24 Several observations suggest that nuclear transport plays a key role in proliferation of cells through mitosis.25 Therefore, importin-ß may play a role in SMC proliferation after balloon injury.

The gene encoding tumor-associated protein was isolated from a cDNA library made from the midlactating (14 days) rabbit mammary gland and corresponds to casein.26 There is a possibility that this gene may be associated with transcription of some proteins during SMC proliferation. Further examination is necessary, however, to clarify the function of this gene in neointimal formation after balloon injury.

The function of {alpha}-globin in neointimal formation after balloon injury is not known and remains to be determined. De Leon et al27 reported that {alpha}-globin expression decreases after sciatic nerve injury. Thus, {alpha}-globin may play a role in tissue remodeling after injury in both nerve tissue and artery.

Both mitochondrial DNA and {alpha}-actin are necessary for the proliferation of SMCs. Given that SMC proliferation is a hallmark of neointimal formation after vascular injury, upregulation of mRNA for mitochondrial DNA and {alpha}-actin after balloon injury is not surprising.

In conclusion, balloon injury-induced genes were isolated by a differential hybridization technique to identify genes involved in restenosis after PTCA. ApoJ is dramatically induced in media and neointima after balloon injury, and stably transfected rabbit SMCs showed that the expression of apoJ stimulated proliferation and migration of SMCs. These results suggest that apoJ contributes to restenosis after angioplasty.


*    Acknowledgments
 
This study was supported in part by grants from the Study Group of Molecular Cardiology (Japan Heart Foundation) and the Research Meeting on Hypertension and Arteriosclerosis.

Received June 5, 2001; revision received June 21, 2001; accepted June 22, 2001.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Garratt KN, Holmes DR Jr. Restenosis: an interventionalist’s perspective. In: Schwartz RS,ed. Coronary Restenosis. Boston, Mass: Blackwell Scientific Publications; 1993: 55–102.

2. Clowes AW, Reidy MA, Clowes MM. Mechanisms of stenosis after artery injury. Lab Invest. . 1983; 49: 208–215.[Medline] [Order article via Infotrieve]

3. Libby P, Schwartz D, Brogi E, et al. A cascade model for restenosis: a special case of atherosclerosis progression. Circulation. . 1992; 86 (suppl III): III-47–III-52.

4. Clowes AW, Reidy MA, Clowes MM. Kinetics of cellular proliferation after arterial injury, I: smooth muscle growth in the absence of endothelium. Lab Invest. . 1983; 49: 327–333.[Medline] [Order article via Infotrieve]

5. Chirgwin JM, Przybyla AE, MacDonald RJ, et al. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry. . 1979; 18: 5294–5299.[Medline] [Order article via Infotrieve]

6. Feinberg AP, Vogelstein B. A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal Biochem. . 1983; 132: 6–13.[Medline] [Order article via Infotrieve]

7. Takahashi Y, Miyata M, Zhen P, et al. Identification of cAMP analogue inducible genes in RAW264 macrophages. Biochim Biophys Acta. . 2000; 1492: 385–394.[Medline] [Order article via Infotrieve]

8. Miyata M, Smith JD. Apolipoprotein E allele-specific antioxidant activity and effects on cytotoxicity by oxidative insults and ß-amyloid peptide. Nat Genet. . 1996; 14: 55–61.[Medline] [Order article via Infotrieve]

9. Ikeda Y, Biro S, Kamogawa Y, et al. Repeated thermal therapy upregulates arterial endothelial nitric oxide synthase expression in Syrian golden hamsters. Jpn Circ J. . 2001; 65: 434–438.[Medline] [Order article via Infotrieve]

10. Razzaque MS, Koji T, Taguchi T, et al. In situ localization of type III and type IV collagen-expressing cells in human diabetic nephropathy. J Pathol. . 1994; 174: 131–138.[Medline] [Order article via Infotrieve]

11. Koji T, Izumi S, Tanno M, et al. Localization in situ of c-mycmRNA and c-mycprotein in adult mouse testis. Histochem J. . 1988; 20: 551–557.[Medline] [Order article via Infotrieve]

12. Miyata M, Biro S, Kaieda H, et al. Lipoprotein(a) stimulates the proliferation of cultured human arterial smooth muscle cells through two pathways. FEBS Lett. . 1995; 377: 493–496.[Medline] [Order article via Infotrieve]

13. Jordan-Starck TC, Witte DP, Aronow BJ, et al. Apolipoprotein J: a membrane policeman? Curr Opin Lipidol. . 1991; 3: 75–85.

14. Jenne DE, Tschopp J. Clusterin: the intriguing guises of a widely expressed glycoprotein. Trends Biochem Sci. . 1992; 17: 154–159.[Medline] [Order article via Infotrieve]

15. de Silva HV, Stuart WD, Duvic CR, et al. A 70-kDa apolipoprotein designated apoJ is a marker for subclasses of human plasma high density lipoproteins. J Biol Chem. . 1990; 265: 13240–13247.[Abstract/Free Full Text]

16. Blaschuk O, Burdzy K, Fritz IB. Purification and characterization of a cell-aggregating factor (clusterin), the major glycoprotein in ram rete testis fluid. J Biol Chem. . 1983; 258: 7714–7720.[Abstract/Free Full Text]

17. Jenne DE, Tschopp J. Molecular structure and functional characterization of a human complement cytolysis inhibitor found in blood and seminal plasma: identity to sulfate glycoprotein 2, a constituent of rat testis fluid. Proc Natl Acad Sci U S A. . 1989; 86: 7123–7127.[Abstract/Free Full Text]

18. Buttyan R, Ollson CA, Pintar J, et al. Induction of the TRPM-2 gene in cells undergoing programmed cell death. Mol Cell Biol. . 1989; 9: 3473–3481.[Abstract/Free Full Text]

19. Leger JG, Montpetit ML, Tenniswood MP. Characterization and cloning of androgen-repressed mRNA from rat ventral prostate. Biochem Biophys Res Commun. . 1987; 147: 196–203.[Medline] [Order article via Infotrieve]

20. Ishikawa Y, Akasaka Y, Ishii T, et al. Distribution and synthesis of apolipoprotein J in the atherosclerotic aorta. Arterioscler Thromb Vasc Biol. . 1998; 18: 665–672.[Abstract/Free Full Text]

21. Swertfeger DK, Witte DP, Stuart DS, et al. Apolipoprotein J/clusterin induction in myocarditis: a localized response gene to myocardial injury. Am J Pathol. . 1996; 148: 1971–1983.[Abstract]

22. Sawczuk IS, Hoke G, Olsson CA, et al. Gene expression in response to acute unilateral ureteral obstruction. Kidney Int. . 1989; 35: 1315–1319.[Medline] [Order article via Infotrieve]

23. Cordero JA, Quist WC, Hamdan AD, et al. Identification of multiple genes with altered expression at the distal anastomosis of healing polytetrafluoroethylene grafts. J Vasc Surg. . 1998; 28: 157–166.[Medline] [Order article via Infotrieve]

24. Gorlich D, Mattaj IW. Nucleocytoplasmic transport. Science. . 1996; 271: 1513–1518.[Abstract]

25. Koepp DM, Silver PA. Nucleocytoplasmic transport and cell proliferation. Biochim Biophys Acta. . 1998; 1377: M39–M47.[Medline] [Order article via Infotrieve]

26. Dawson SP, Wilde CJ, Tighe PJ, et al. Characterization of two novel casein transcripts in rabbit mammary gland. Biochem J. . 1993; 296: 777–784.

27. De Leon M, Welcher AA, Suter U, et al. Identification of transcriptionally regulated genes after sciatic nerve injury. J Neurosci Res. . 1991; 29: 437–448.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
H.-J. Kim, E.-K. Yoo, J.-Y. Kim, Y.-K. Choi, H.-J. Lee, J.-K. Kim, N. H. Jeoung, K.-U. Lee, I.-S. Park, B.-H. Min, et al.
Protective Role of Clusterin/Apolipoprotein J Against Neointimal Hyperplasia via Antiproliferative Effect on Vascular Smooth Muscle Cells and Cytoprotective Effect on Endothelial Cells
Arterioscler Thromb Vasc Biol, October 1, 2009; 29(10): 1558 - 1564.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
P. A. J. Krijnen, S. A. G. M. Cillessen, R. Manoe, A. Muller, C. A. Visser, C. J. L. M. Meijer, R. J. P. Musters, C. E. Hack, L. A. Aarden, and H. W. M. Niessen
Clusterin: a protective mediator for ischemic cardiomyocytes?
Am J Physiol Heart Circ Physiol, November 1, 2005; 289(5): H2193 - H2202.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
L. Anderson
Candidate-based proteomics in the search for biomarkers of cardiovascular disease
J. Physiol., February 15, 2005; 563(1): 23 - 60.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Orlandi, S. Pucci, A. Ciucci, F. Pichiorri, A. Ferlosio, and L. G. Spagnoli
Modulation of Clusterin Isoforms Is Associated With All-Trans Retinoic Acid-Induced Proliferative Arrest and Apoptosis of Intimal Smooth Muscle Cells
Arterioscler Thromb Vasc Biol, February 1, 2005; 25(2): 348 - 353.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
W. C.Y. Leung, A. Lawrie, S. Demaries, H. Massaeli, A. Burry, S. Yablonsky, J. M. Sarjeant, E. Fera, E. Rassart, J. G. Pickering, et al.
Apolipoprotein D and Platelet-Derived Growth Factor-BB Synergism Mediates Vascular Smooth Muscle Cell Migration
Circ. Res., July 23, 2004; 95(2): 179 - 186.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
H. Eto, S. Biro, M. Miyata, H. Kaieda, H. Obata, T. Kihara, K. Orihara, and C. Tei
Angiotensin II type 1 receptor participates in extracellular matrix production in the late stage of remodeling after vascular injury
Cardiovasc Res, July 1, 2003; 59(1): 200 - 211.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miyata, M.
Right arrow Articles by Tei, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miyata, M.
Right arrow Articles by Tei, C.
Right arrowPubmed/NCBI databases
*Gene*Protein
*UniGene
*Substance via MeSH
Related Collections
Right arrow Restenosis
Right arrow Gene expression
Right arrow Smooth muscle proliferation and differentiation