Donate Help Contact The AHA Sign In Home
American Heart Association
Circulation
Search: search_blue_button Advanced Search
Circulation. 2001;104:1236-1240
doi: 10.1161/hc3601.095932
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kramers, C.
Right arrow Articles by Adema, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kramers, C.
Right arrow Articles by Adema, G. J.
Right arrowPubmed/NCBI databases
*OMIM*Protein
*Substance via MeSH
Related Collections
Right arrow Clinical genetics
Right arrow Other heart failure
Right arrow ACE/Angiotension receptors
Right arrow Other hypertension
Right arrow Genetics of cardiovascular disease

(Circulation. 2001;104:1236.)
© 2001 American Heart Association, Inc.


Clinical Investigation and Reports

Point Mutation in the Stalk of Angiotensin-Converting Enzyme Causes a Dramatic Increase in Serum Angiotensin-Converting Enzyme But No Cardiovascular Disease

Cornelis Kramers, MD, PhD; Sergei M. Danilov, MD, PhD; Jaap Deinum, MD, PhD; Irina V. Balyasnikova, PhD; Nicole Scharenborg, BS; Maaike Looman, BS; Frans Boomsma, MD, PhD; Marinus H. de Keijzer, MD, PhD; Cornelia van Duijn, PhD; Sabrina Martin, BS; Florent Soubrier, MD, PhD; Gosse J. Adema, PhD

From the Department of Pharmacology/Toxicology and Department of Internal Medicine (C.K.), Laboratory of Tumor Immunology (N.S., M.L., G.J.A.), the Department of Clinical Chemistry (M.H.d.K.), University Medical Center, Nijmegen, the Netherlands; the Department of Anesthesiology, University of Illinois (S.M.D., I.V.B.), Chicago; the Department of Internal Medicine (J.D., F.B.) and the Department of Epidemiology and Biostatistics (C.v.D.), Erasmus University Medical Center, Rotterdam, the Netherlands; and INSERM U 525 (S.M., F.S.), Hôpital Saint-Louis; Paris, France.

Correspondence to Dr G.J. Adema, Laboratory of Tumor Immunology, UMC Nijmegen, Philips van Leydenlaan 25, PO Box 9101, 6500 HB Nijmegen, The Netherlands. E mail g.adema{at}dent.kun.nl


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— Angiotensin-converting enzyme (ACE) metabolizes many small peptides and plays a key role in blood pressure regulation. Elevated serum ACE is claimed to be associated with an increased risk for cardiovascular disease. Previously, two families with dramatically increased serum ACE were described, but no systematic survey of affected individuals was performed, and the molecular background of this trait is unknown.

Methods and Results— Eight families were identified with autosomal dominant inheritance of a dramatic (5-fold) increase of serum ACE activity. Strikingly, no clinical abnormalities were apparent in the affected subjects. Isolated blood cells were used for genetic and biochemical analysis. The level of ACE expression on the blood leukocytes and dendritic cells and total cell-associated ACE of the affected individuals was similar to that in nonaffected relatives; however membrane-bound mutant ACE was much more efficiently clipped from the cell surface compared with its wild-type counterpart. A point mutation causing Pro1199Leu in the stalk region of the ACE molecule cosegregates with the increase in serum ACE (LOD score, 6.63).

Conclusions— A point mutation in the stalk region of the ACE protein causes increased shedding, leading to increased serum ACE, whereas cell-bound ACE is unaltered, and affected individuals exhibit no clinical abnormalities. These findings qualify the importance of serum ACE and establish a new determinant of ACE solubilization.


Key Words: genetics • angiotensin • proteins • blood pressure


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Angiotensin-converting enzyme (ACE) (kininase II, EC 3.4.15.1, CD 143) is a membrane-bound Zn+-metalloendopeptidase that is involved in the metabolism of many small peptides, such as the conversion of angiotensin I to angiotensin II or hydrolysis of bradykinin.1 It is expressed on the cell surface and plays a key role in blood pressure regulation and vascular remodeling.2,3 Its importance is best illustrated by the impact that ACE inhibitors have had on the treatment of hypertension and heart failure.4 Somatic ACE has two homologous domains at its N-terminus, each with an active center with distinctive catalytic properties.5,6 Somatic ACE also exists in a catalytically active soluble form, derived from endothelial cells7 by proteolytic cleavage at the juxtamembrane stalk region.6 This cleavage/secretion process is catalyzed by an unidentified membrane-bound secretase.8 The activity of this protease, and thus ACE release, is stimulated by various agonists such as phorbolesters, calcium ionophores, and unidentified serum factors.9,10 Therefore, proteolytic cleavage of ACE appears to be a highly regulated process, suggesting that membrane-bound and soluble ACE may have different functions.

The concentration of soluble serum ACE appears to be genetically determined.11 A 287-bp Alu-repeat sequence insertion/deletion (I/D) polymorphism in intron 16 of the ACE gene has been proposed to be associated with a modest elevation in serum ACE activity and with cardiovascular disease.12,13 This increase in serum ACE levels does not exceed the upper limit of normal, however, and the association with cardiovascular disease has not been found in other studies.14

More pronounced elevation of serum ACE activity is found in granulomatous disorders such as sarcoidosis and in some other diseases.15 This increase is rarely >3 times the upper limit of normal. Extreme elevation of serum ACE activity (>4 times the upper limit of normal) has been described in two families.16,17 In both families, the distribution of high serum ACE levels (hyper-ACE) among the family members suggested autosomal dominant inheritance. No known disease could explain or could be ascribed to the increased ACE level. Until now, a systematic study into the genetic and biochemical basis of this familial hyper-ACE phenotype has not been performed.

In this study, we describe 8 new hyper-ACE families and demonstrate that the molecular basis of the hyper-ACE phenotype is a point mutation located in the stalk region of the ACE molecule.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Clinical Evaluation
The study was approved by the hospital ethics committee. The procedures followed were in accordance with institutional guidelines. All plasma ACE activities determined in the last 5 years in the UMC Nijmegen (n={approx}2900) were reviewed, and 4 unrelated patients were identified with serum ACE activities >80 U/L. In addition, 4 other unrelated patients were identified elsewhere in the Netherlands. First-degree (and in some instances second-degree) relatives of these patients were asked to participate in the clinical evaluation.

After giving written informed consent, these family members (not the probands) were given an interview and physical examination. An ECG was recorded, and blood pressure was recorded automatically every 3 minutes during 20 minutes (Dinamap, Critikon Inc). Serum samples were taken for determination of ACE activity, erythrocyte sedimentation rate, hematology and blood chemistry (including blood minerals, kidney function, liver enzymes, albumin, and glucose), and thyroid-stimulating hormone. Blood samples for renin, angiotensinogen, aldosterone, and angiotensin I and II determination were taken and processed as described.18,19 Aldosterone was measured in plasma by a radioimmunoassay kit (DPC). In one family (No. 6, Figure 1) an echocardiography (Diasonics Vingmed Ultrasound, System V) was performed in all 12 family members (8 with elevated ACE). In the left parasternal short- and long-axis views, the cardiac dimensions were assessed; in the apical 2-, 4-, and 5-chamber views, the wall motions and valvular function were assessed. In 7 selected individuals 300 mL of blood was drawn in tubes containing heparin for additional in vitro analysis of isolated blood cells.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. Family trees of 8 families with hyper-ACE subjects. Affected individuals are indicated by filled symbols. Arrows indicate probands; shaded symbol, subject who died. Seven individuals whose cells were tested for in vitro ACE solubilization are marked (#).

Serum ACE and ACE genotype were determined in 166 randomly selected, unrelated individuals from an epidemiological survey in Rotterdam.

Blood Cell Isolation Cultivation and Fluorescently Activated Cell Sorter Analysis
Activated peripheral blood lymphocytes (PBL) and immature dendritic cells (DC) were generated from 4 individuals with elevated ACE and 3 nonaffected family members (subjects indicated in Figure 1) as described.20 Cells were cultured for 6 days, with a complete change of medium at day 4. Nonadherent PBL were activated for 3 days with PHA (1 µg/mL) and IL-2 (20 U/mL) in the same culture medium. Flow cytometric analysis of the leukocyte populations was performed with the primary antibody (10 µg/mL) and FITC-conjugated GAM IgG F(ab')2 (Zymed) as the secondary antibody on a FACScan flow cytometer (Becton and Dickinson & Co). An isotype-matched mAb was used as a control.

ACE Activity Measurements
Colorimetric determination of ACE activity in the plasma was performed with a kit by Fujirebio Inc, which uses a p-hydroxy-Hip-His-Leu substrate.21 The reference range in our laboratory is 8.3 to 31.4 U/L (n=215). Fluorimetric assay of ACE activity in serum, plasma, culture fluids, or lysate of cultured cells was performed by measuring the release of His-Leu from the substrates Hip-His-Leu and Z-Phe-His-Leu.22,23 In isolated cells, ACE levels were corrected for the amount of cells and volume of culture medium.

ACE Plate Precipitation Assay and ACE ELISA
These assays were performed as described in References 24 and 25, respectively.24,25

DNA and RNA Characterization
The ACE gene was sequenced in 3 unrelated individuals by means of an automatic sequencer (ABI). After the discovery of the mutation, genotyping of other individuals was performed by polymerase chain reaction (PCR)-based restriction fragment length polymorphism assessment. Genomic DNA was amplified with Goldstar Taq (Eurogentec), with the use of a forward primer ATGTTGAGCTACTTCAAGCCGGC and a reverse primer GTTAAGACCCAAGGCTGGAGGT, resulting in a 141-bp fragment. This fragment was digested with AcyI (Boehringer Mannheim). The C-to-T mutation at position 3705 eliminates this AcyI restriction site. The same primers were used for reverse transcription-PCR to confirm the mutation at mRNA level and to estimate the amount of ACE mRNA isolated from the cultured cells described above. Haplotyping of mutation-containing alleles of the ACE gene was performed by typing of two single nucleotide polymorphisms, 577 bp upstream (C/T, frequencies 0.54/0.46) and 154 bp downstream (A/G, frequencies 0.50/0.50) of the mutation, respectively.26 A PCR (forward primer CAGCCTTGACTGGCAGATTT, reverse CAGTGTTCCCATCCCAGTCT) spanning 1508 bp around the mutation and the two flanking polymorphisms was performed. The wild-type amplimer was digested by AcyI, and the resulting fragments were removed by agarose electrophoresis. The 5' polymorphic marker on the undigested fragment was typed by single base extension with a commercial kit (SnaPshot, Applied Biosystems). The 3' marker was characterized by digestion with BlpI (New England Biolabs).

Statistical Evaluation
Linkage
We calculated 2-point LOD scores by using the subroutine MLINK of the LINKAGE program (version 5.1).27 A mutated ACE allele frequency of 0.01 (a robust estimate, based on the fact that in 166 randomly selected, unrelated individuals, this mutation was not found) and a penetrance of 95% were assumed.

The data collected in the clinical study were analyzed by the use of a Mann-Whitney U test and data of the in vitro analysis by a Student’s t test.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Clinical Data
Eight Dutch individuals were identified with ACE values exceeding 4 times the upper limit of normal. In all of them, ACE activity was measured because of a suspicion of sarcoidosis. The patients had a variety of complaints, including fatigue, arthralgia, nephrolithiasis and hypercalciuria, restrictive pulmonary disease, and premature stroke. Despite an extensive workup, this diagnosis could be made in none. Subsequent analysis revealed additional individuals with hyper-ACE in each of the 8 families participating in the study (ACE=105±23 U/L, ranging from 53 to 134 U/L, n=28). The Table summarizes the relevant clinical and laboratory data in these family members. The hyper-ACE segregation pattern was compatible with autosomal dominant inheritance (Figure 1).


View this table:
[in this window]
[in a new window]
 
Table 1. Comparison of Subjects With Elevated and Normal ACE Levels

Elevated ACE was not accompanied by any apparent clinical abnormality. In each group, 2 individuals had hypertension (diastolic blood pressure >90 mm Hg), 1 individual (female, 68 years of age, with normal ACE level) had heart failure and angina pectoris, and 1 individual (female, 72 years of age, with elevated ACE) had angina pectoris and proven coronary artery disease. Renin, aldosterone (Table), and angiotensinogen (not shown) levels did not differ significantly. Angiotensin II levels were slightly increased in subjects with high serum ACE (Table). The results of all other blood analyses performed were without abnormalities (not shown). ECG recordings were normal, except for the 2 patients with known heart disease. There were no signs of left ventricular hypertrophy on ECG (Table). In one family, echocardiography of all 12 members (8 with elevated ACE) was without abnormalities.

Defect in Hyper-ACE Patients Occurs at the Level of ACE Secretion
We determined the activity, amount, and possible structural abnormalities of serum ACE in affected and nonaffected family members. The increase of ACE activity (4- to 6-fold) was similar with application of different substrates (Table comparing 20 affected with 21 nonaffected individuals, P<0.0001; Figure 2A comparing 4 affected with 3 nonaffected individuals, P<0.01) and correlated with the increase found in the ACE ELISA (not shown). Moreover, the ratio between the hydrolysis of the substrates Hip-His-Leu and Z-Phe-His-Leu in affected subjects was normal (not shown), suggesting that neither one of two catalytic domains of ACE was altered.25,28 The binding characteristics of a panel of anti-ACE mAbs recognizing 9 different epitopes of ACE were not different between affected and nonaffected family members (not shown). This binding pattern, as assessed by immunoprecipitation, is very sensitive even to subtle changes in the conformation of ACE molecule.24



View larger version (33K):
[in this window]
[in a new window]
 
Figure 2. Biochemical and immunologic characterization of ACE in hyper-ACE individuals (n=4) and nonaffected family members (n=3) from 2 independent families (see also Figure 1). Data are represented as mean±SEM. *P<0.05, **P<0.01 (Student’s t test). A, Serum ACE activity. ACE activity was measured fluorimetrically with Hip-His-Leu as substrate. Data are expressed as percentage from normal individuals (28 mU/mL). B, Cell-associated ACE activity. Lysates from thoroughly washed cell pellets from peripheral blood mononuclear cells (PBMC), activated PBL, and immature DC were prepared with 3-[(3-cholamidopropyl)dimethyl-ammonio]-1-propane sulfonate (CHAPs) as detergent. Cell-bound ACE activity was determined with Hip-His-Leu. C, Cell-surface ACE expression: FACS analysis of immature DC and freshly isolated peripheral blood mononuclear cells (gated monocytes and lymphocytes are shown separately) with anti-ACE mAb (9B9). Similar results were obtained with other ACE-specific mAbs (not shown). Cell-surface ACE expression is indicated as mean fluorescence relative to isotype control. D, Rate of ACE secretion. ACE activity24 in culture medium of immature DC and PHA/IL-2 activated PBL, from which cell pellets were used in part B. Rate of ACE cleavage was determined as ratio between ACE in culture medium and total amount of cell-associated ACE. Data are expressed as percentage from mean of normal individuals. Determination of ACE amount27 gave similar results.

In Figure 2, cells obtained from 4 affected and 3 nonaffected individuals were tested. Fluorescently activated cell sorter (FACS) analysis of leukocytes and dendritic cells from hyper-ACE and normal individuals demonstrated that they express a similar amount of ACE on the cell surface (Figure 2C). Also, the total amount of cell-associated ACE (Figure 2B) and ACE mRNA (not shown) was identical. In contrast, in both the activated PBL and immature DC, a 5- to 6-fold increase in the amount of secreted ACE was observed (Figure 2D, P<0.01). These findings implicate that the rate of ACE shedding by activated PBL and DC is affected in the hyper-ACE individuals.

Point Mutation in the ACE Gene Cosegregates With the Hyper-ACE Phenotype
Sequence analysis in 3 affected, unrelated, individuals yielded a C-T mutation at nucleotide position 3705, which leads to the replacement of a proline residue by a leucine at amino acid position 1199 in the stalk region of the mature ACE protein (Figure 3) [nt and aa numbering according to Reference 5].5 All affected individuals were heterozygous for this mutation, and the mutation was not present in the family members and 166 unrelated Dutch individuals with normal ACE levels. Moreover, sequence analysis of the complete coding region of the ACE gene in 3 affected individuals revealed that besides known polymorphisms,26 the C-T mutation at position 3705 is the only mutation present in the coding sequence of the ACE gene. Linkage analysis of this mutation with the hyper-ACE phenotype showed a highly significant maximum LOD score of 6.63 at a {theta} of 0.00. All affected individuals had an identical haplotype carrying the mutation with T at position 577 bp upstream and G at position 154 bp downstream. Finally, analysis of RNA isolated from the DC from affected individuals confirmed the mutation (not shown).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 3. Schematic representation of ACE protein and amino acid sequence surrounding Pro1199Leu mutation found in hyper-ACE individuals. Mutant is indicated in italics. Catalytic domains (1+2) and transmembrane region (TM and underlined), cleavage site (italic and underlined31,33), and site of mutation (large arrow) are indicated.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
In our study, a complete segregation of a mutation in the stalk region of ACE with the hyper-ACE phenotype was observed. Our additional findings implicate that this ACE-Pro/Leu is more susceptible to the ACE secretase. Analysis of ACE secretion of cells transfected with the ACE cDNA encoding the Pro1199Leu mutation are in line with this conclusion.29

One determinant of ACE solubilization is the presence of the distal domain, since testicular ACE, lacking this domain, is cleaved much more efficiently than somatic ACE.9,3032 The amino acid sequence of the stalk region is thought to be of minor importance. Recently, the peptide bond preceding the Arg-1204 site was shown to be the processing site in somatic ACE expressed in transfected Chinese Hamster Ovary (CHO) cells.31,33 Apparently, the mutation of Pro-1199 into Leu results in more efficient cleavage of somatic ACE. Proline residues allow cis-trans isomerization of the peptide bond, and leucine at this site may force the peptide chain into a conformation that is much more favorable to processing by the secretase.

At first sight, it may appear confusing that cells harboring the 1199 Pro/Leu alteration shed 5-fold the amount of ACE but maintain the same level of membrane-bound ACE without an increase in the mRNA level. The fact that cell-surface ACE is unaltered despite increased shedding is also found in cultured human umbilical vein endothelial cells, where shedding can be increased severalfold by repeated change of the culture medium (S.M. Danilov et al, unpublished observation, Moscow, 1990). Concerning the unaltered mRNA level, one must realize that the method we used may be unable to detect a subtle change of mRNA. Second, assuming that mRNA is not changed, there may be alteration in ACE trafficking/breakdown in cells carrying the mutation. Interestingly, CHO cells stably transfected with mutated ACE revealed a decreased amount of ACE in the lysosomal fraction relative to their wild-type counterpart.29 So, increased shedding may be compensated by decreased lysosomal breakdown of ACE.

Although it is thought that the balance between membrane-bound and solubilized proteins is physiologically important, for ACE this appears not to be true. In the presence of similar amounts of membrane-bound ACE, the higher extracellular concentration of ACE is of no clinical significance. The unaltered plasma renin levels indicate that this mutation has no consequences for the physiology of the renin-angiotensin system. The slightly increased plasma angiotensin II level in the hyper-ACE individuals can be explained by increased conversion during blood sampling as a consequence of the increased amount of ACE.34 In contrast to our hyper-ACE individuals, in subjects with the DD genotype, both membrane-bound and soluble ACE are elevated.35 This might explain that some authors have found that the DD genotype influences cardiovascular morbidity, whereas we do not find clinical effects in the hyper-ACE individuals.

In summary, we define a mutation in the ACE gene leading to an alteration in the juxtamembrane stalk region of the ACE protein. This mutation causes a dramatic increase in serum ACE levels found in familial elevation of ACE. This is the first mutation of the ACE gene to correlate with an increase of circulating ACE far higher than the upper limit of normal. Because no alteration of renin physiology nor of blood pressure or other clinical parameters was found, this finding sheds new light on the physiological role of circulating versus cell-bound ACE. Moreover, this experiment of nature provides further insight into the mechanism and physiology of the solubilization of ACE.


*    Acknowledgments
 
We are grateful to Jeanette van Gool, Jeanette Vergeer, André Uitterlinden, and Pascal Arp for expert technical assistance. We thank Dr Helmut Gehlmann for performing the echocardiographs and the TIL-DC group for help with DC culturing.

Received April 13, 2001; revision received July 11, 2001; accepted July 11, 2001.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Corvol P, Michaud A, Soubrier F, et al. Recent advances in knowledge of the structure and function of the angiotensin I converting enzyme. J Hypertens Suppl. 1995; 13 (suppl 3): S3–S10.[Medline] [Order article via Infotrieve]

2. Hirsch AT, Talsness CE, Schunkert H, et al. Tissue-specific activation of cardiac angiotensin converting enzyme in experimental heart failure. Circ Res. 1991; 69: 475–482.[Abstract/Free Full Text]

3. Baker KM, Chernin MI, Wixson SK, et al. Renin-angiotensin system involvement in pressure-overload cardiac hypertrophy in rats. Am J Physiol. 1990; 259: H324–H332.[Abstract/Free Full Text]

4. Pfeffer MA, Braunwald E, Moye LA, et al. Effect of captopril on mortality and morbidity in patients with left ventricular dysfunction after myocardial infarction: results of the survival and ventricular enlargement trial: the SAVE Investigators. N Engl J Med. 1992; 327: 669–677.[Abstract]

5. Soubrier F, Alhenc Gelas F, Hubert C, et al. Two putative active centers in human angiotensin I-converting enzyme revealed by molecular cloning. Proc Natl Acad Sci U S A. 1988; 85: 9386–9390.[Abstract/Free Full Text]

6. Wei L, Alhenc Gelas F, Soubrier F, et al. Expression and characterization of recombinant human angiotensin I-converting enzyme: evidence for a C-terminal transmembrane anchor and for a proteolytic processing of the secreted recombinant and plasma enzymes. J Biol Chem. 1991; 266: 5540–5546.[Abstract/Free Full Text]

7. Ching SF, Hayes LW, Slakey LL. Angiotensin-converting enzyme in cultured endothelial cells: synthesis, degradation, and transfer to culture medium. Arteriosclerosis. 1983; 3: 581–588.[Abstract/Free Full Text]

8. Hooper NM, Karran EH, Turner AJ. Membrane protein secretases. Biochem J. 1997; 321: 265–279.

9. Ehlers MR, Schwager SL, Scholle RR, et al. Proteolytic release of membrane-bound angiotensin-converting enzyme: role of the juxtamembrane stalk sequence. Biochemistry. 1996; 35: 9549–9559.[Medline] [Order article via Infotrieve]

10. Santhamma KR, Sen I. Specific cellular proteins associate with angiotensin-converting enzyme and regulate its intracellular transport and cleavage-secretion. J Biol Chem. 2000; 275: 23253–23258.[Abstract/Free Full Text]

11. Rigat B, Hubert C, Alhenc Gelas F, et al. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest. 1990; 86: 1343–1346.

12. Cambien F, Poirier O, Lecerf L, et al. Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature. 1992; 359: 641–644.[Medline] [Order article via Infotrieve]

13. Staessen JA, Wang JG, Ginocchio G, et al. The deletion/insertion polymorphism of the angiotensin converting enzyme gene and cardiovascular-renal risk. J Hypertens. 1997; 15: 1579–1592.[Medline] [Order article via Infotrieve]

14. Keavney B, McKenzie C, Parish S, et al. Large-scale test of hypothesised associations between the angiotensin-converting-enzyme insertion/deletion polymorphism and myocardial infarction in about 5000 cases and 6000 controls. Lancet. 2000; 355: 434–442.[Medline] [Order article via Infotrieve]

15. Beneteau Burnat B, Baudin B. Angiotensin-converting enzyme: clinical applications and laboratory investigations on serum and other biological fluids. Crit Rev Clin Lab Sci. 1991; 28: 337–356.[Medline] [Order article via Infotrieve]

16. Okabe T, Fujisawa M, Yotsumoto H, et al. Familial elevation of serum angiotensin converting enzyme. Q J Med. 1985; 55: 55–61.[Abstract/Free Full Text]

17. Luisetti M, Martinetti M, Cuccia M, et al. Familial elevation of serum angiotensin converting enzyme activity. Eur Respir J. 1990; 3: 441–446.[Abstract]

18. Deinum J, Derkx FH, Schalekamp MA. Improved immunoradiometric assay for plasma renin. Clin Chem. 1999; 45: 847–854.[Abstract/Free Full Text]

19. Admiraal PJ, Derkx FH, Danser AH, et al. Metabolism and production of angiotensin I in different vascular beds in subjects with hypertension. Hypertension. 1990; 15: 44–55.[Abstract/Free Full Text]

20. Adema GJ, Hartgers F, Verstraten R, et al. A dendritic-cell-derived C-C chemokine that preferentially attracts naive T cells. Nature. 1997; 387: 713–717.[Medline] [Order article via Infotrieve]

21. Kasahara Y, Ashihara Y. Colorimetry of angiotensin-I converting enzyme activity in serum. Clin Chem. 1981 27; 1922–1925.[Abstract/Free Full Text]

22. Friedland J, Silverstein E. A sensitive fluorometric assay for serum angiotensin converting enzyme. Am J Clin Pathol. 1976; 66: 416–424.[Medline] [Order article via Infotrieve]

23. Piquilloud Y, Reinharz A, Roth M. Studies on the angiotensin converting enzyme with different substrates. Biochim Biophys Acta. 1970; 206: 136–142.[Medline] [Order article via Infotrieve]

24. Danilov S, Jaspard E, Churakova T, et al. Structure-function analysis of angiotensin I-converting enzyme using monoclonal antibodies: selective inhibition of the amino-terminal active site. J Biol Chem. 1994; 269: 26806–26814.[Abstract/Free Full Text]

25. Danilov S, Savoie F, Lenoir B, et al. Development of enzyme-linked immunoassays for human angiotensin I converting enzyme suitable for large-scale studies. J Hypertens. 1996; 14: 719–727.[Medline] [Order article via Infotrieve]

26. Rieder MJ, Taylor SL, Clark AG, et al. Sequence variation in the human angiotensin converting enzyme. Nat Genet. 1999; 22: 59–62.[Medline] [Order article via Infotrieve]

27. Lathrop G, Lalouel J. Easy calculations of lod scores and genetic risks on small computers. Am J Hum Genet. 1984; 36: 460–465.[Medline] [Order article via Infotrieve]

28. Williams TA, Danilov S, Alhenc Gelas F, et al. A study of chimeras constructed with the two domains of angiotensin I-converting enzyme. Biochem Pharmacol. 1996; 51: 11–14.[Medline] [Order article via Infotrieve]

29. Eyries M, Michaud A, Deinum J, et al. Increased shedding of angiotensin-converting enzyme by a mutation identified in the stalk region. J Biol Chem. 2001; 276: 5525–5532.[Abstract/Free Full Text]

30. Sadhukhan R, Sen GC, Ramchandran R, et al. The distal ectodomain of angiotensin-converting enzyme regulates its cleavage-secretion from the cell surface. Proc Natl Acad Sci U S A. 1998; 95: 138–143.[Abstract/Free Full Text]

31. Woodman ZL, Oppong SY, Cook S, et al. Shedding of somatic angiotensin-converting enzyme (ACE) is inefficient compared with testis ACE despite cleavage at identical stalk sites. Biochem J. 2000; 347: 711–718.

32. Beldent V, Michaud A, Wei L, et al. Proteolytic release of human angiotensin-converting enzyme. Localization of the cleavage site. J Biol Chem. 1993; 268: 26428–26434.[Abstract/Free Full Text]

33. Hooper TM, Turner AJ. Protein processing mechanisms: from angiotensin-converting enzyme to Alzheimer’s disease. Biochem Soc Trans. 2000; 28: 441–446.[Medline] [Order article via Infotrieve]

34. Admiraal PJ, Danser AH, Jong MS, et al. Regional angiotensin II production in essential hypertension and renal artery stenosis. Hypertension. 1993; 21: 173–184.[Abstract/Free Full Text]

35. Costerousse O, Allegrini J, Lopez M, et al. Angiotensin I-converting enzyme in human circulating mononuclear cells: genetic polymorphism of expression in T-lymphocytes. Biochem J. 1993; 290: 33–40.




This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
K. Kohlstedt, R. Kellner, R. Busse, and I. Fleming
Signaling via the Angiotensin-Converting Enzyme Results in the Phosphorylation of the Nonmuscle Myosin Heavy Chain IIA
Mol. Pharmacol., January 1, 2006; 69(1): 19 - 26.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
S. M. Danilov, J. Deinum, I. V. Balyasnikova, Z.-L. Sun, C. Kramers, C. E.M. Hollak, and R. F. Albrecht
Detection of Mutated Angiotensin I-Converting Enzyme by Serum/Plasma Analysis Using a Pair of Monoclonal Antibodies
Clin. Chem., June 1, 2005; 51(6): 1040 - 1043.
[Full Text] [PDF]


Home page
ChestHome page
J. Hotta, M. Hanaoka, Y. Droma, Y. Katsuyama, M. Ota, and T. Kobayashi
Polymorphisms of Renin-Angiotensin System Genes With High-Altitude Pulmonary Edema in Japanese Subjects
Chest, September 1, 2004; 126(3): 825 - 830.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
M. Linnebank, K. Kesper, M. Jeub, H. Urbach, U. Wullner, T. Klockgether, and S. Schmidt
Hereditary elevation of angiotensin converting enzyme suggesting neurosarcoidosis
Neurology, December 23, 2003; 61(12): 1819 - 1820.
[Full Text] [PDF]


Home page
Journal of Renin-Angiotensin-Aldosterone SystemHome page
M. D Witham, S. D Hutcheon, C. G Fraser, M. E. McMurdo, and A. D Struthers
Grossly elevated serum angiotensin-converting enzyme activities are still suppressible with ACE inhibitor therapy
Journal of Renin-Angiotensin-Aldosterone System, June 1, 2002; 3(2): 138 - 138.
[PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kramers, C.
Right arrow Articles by Adema, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kramers, C.
Right arrow Articles by Adema, G. J.
Right arrowPubmed/NCBI databases
*OMIM*Protein
*Substance via MeSH
Related Collections
Right arrow Clinical genetics
Right arrow Other heart failure
Right arrow ACE/Angiotension receptors
Right arrow Other hypertension
Right arrow Genetics of cardiovascular disease